RPA-CRISPR one-pot method detection system based on sustained-release agent sequential control

Abstract

The invention belongs to the technical field of molecular detection, and particularly relates to an RPA-CRISPR one-pot detection system based on slow release agent sequential control, which comprises an RPA pre-amplification system, a CRISPR detection system and poloxamer temperature-sensitive hydrogel, the poloxamer temperature-sensitive hydrogel wraps a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (clustered regularly interspaced short palindromic repeats) compound in a normal temperature environment, and the concentration of the poloxamer is 10-20% w / v; according to the invention, a sustained-release agent is introduced to wrap CRISPR components, the sustained-release agent begins to disintegrate and release an amplification product at an RPA amplification temperature of 37 DEG C, and a CRISPR detection system is automatically released in an environment of 42 DEG C after amplification is completed, so that one-pot closed-tube sequential control of first amplification and then detection is realized, and the sensitivity of the method is equivalent to that of a standard two-step method with pollution risk; and high-sensitivity detection of single copy can be realized.

Description

Technical Field

[0001] The present invention belongs to the field of molecular detection technology, and specifically relates to an RPA-CRISPR one-pot detection system based on time-sequential control of sustained-release agents. Background Art

[0002] Combining RPA amplification technology with the CRISPR / Cas system can effectively improve the specificity and sensitivity of molecular point-of-care (POCT) techniques. Technologies such as SHERLOCK (RPA+Cas13a) and DETECTR (RPA+Cas12a) have been developed. However, RPA amplification and CRISPR detection must be performed in a sequential order, requiring a two-step reaction (amplification followed by decapping and transfer of the product to the CRISPR system), effectively creating a "amplification-first, detection-later" approach.

[0003] The step-by-step procedure of RPA-CRISPR combined methods significantly increases the risk of aerosol contamination (false positive rates increase by 10%-20%). The one-pot RPA-CRISPR approach of "amplification first, then detection" is the most direct and effective solution to avoid aerosol contamination, and it is also the main technical bottleneck and research hotspot for the application of this technology.

[0004] The main research approaches currently in use include: adding a layer of lyophilized CRISPR reagent to the tube wall or lid, covering the RPA reaction system with mineral oil; separating the CRISPR system and RPA system in time or space; delaying the CRISPR detection reaction, including modifying the 3' end of the crRNA to weaken the affinity of the Cas12a / crRNA complex for the target DNA; designing PAM-independent crRNA to reduce cis-cleavage activity; and using light-regulated Cas enzymes or light-regulated caged crRNA. The drawbacks of these one-pot approaches are high design costs, low stability, or the need for external equipment intervention.

[0005] Especially in the detection of monkeypox virus, the timing control adopted by the existing scheme is too complicated and does not meet the needs of virus detection. The actual demand for rapid and highly sensitive on-site detection of monkeypox virus cannot be met for the time being. Since RPA is directly mixed with the CRISPR system, the Cas12a protein will competitively bind to the DNA template and inhibit the RPA primer extension efficiency, resulting in a detection limit that is 5-10 times lower than that of the two-step method (for example, the detection limit of the two-step method is 1 copy / μL, while the one-pot method can only reach 10 copies / μL).

[0006] Therefore, how to overcome the lack of sensitivity in the one-pot RPA-CRISPR monkeypox virus on-site detection is a technical problem that urgently needs to be solved in this field.

[0007] It should be noted that the above information disclosed in this background technology section is only used to understand the background technology of the present application concept, and therefore, the above description is not considered to constitute information of the prior art. Summary of the Invention

[0008] The embodiments of the present disclosure at least provide an RPA-CRISPR one-pot detection system based on time-sequential control of a sustained-release agent.

[0009] In a first aspect, an embodiment of the present disclosure provides an RPA-CRISPR one-pot detection system based on sustained-release agent timing control, comprising: an RPA pre-amplification system, a CRISPR detection system, and a poloxamer thermosensitive hydrogel; the poloxamer thermosensitive hydrogel encapsulates the CRISPR / Cas12a complex at room temperature, and the concentration of the poloxamer is 10-20% w / v.

[0010] In an optional embodiment, the poloxamer encapsulation volume in the poloxamer thermosensitive hydrogel is 10 to 20 μL, the disintegration temperature is 37° C., and the disintegration time is 8 to 10 minutes.

[0011] In an optional embodiment, the RPA primers in the RPA pre-amplification system target the conserved region of the MPXV F3L gene, and the sequence is as SEQ ID NO: 1-2.

[0012] In an optional embodiment, the RPA pre-amplification system includes the following components: forward RPA primer, RPA Buffer, MgOAc, DNA template and nuclease-free water.

[0013] In an optional embodiment, the crRNA in the CRISPR detection system targets the PAM site of the F3L gene, and the sequence is as SEQ ID NO: 3.

[0014] In an optional embodiment, the CRISPR detection system includes the following components: Lba Cas12a, ssDNA reporter gene, 10×NEB Buffer 2.1, crRNA, DNA template and nuclease-free water.

[0015] In an optional embodiment, the amplification temperature of the RPA pre-amplification system is 37°C; the triggering temperature of the CRISPR detection system is 42°C; and the total reaction time of the RPA amplification, poloxamer thermosensitive hydrogel disintegration and CRISPR triggering is less than 40 minutes.

[0016] In an optional embodiment, it further includes: a constant temperature module and a fluorescence collection module.

[0017] In a second aspect, the embodiments of the present disclosure further provide an integrated detection kit, comprising: the RPA-CRISPR one-pot detection system based on sustained-release agent timing control as described above; wherein, the target of the kit is monkeypox virus, and the detection limit is ≤10 copies / μL.

[0018] In a third aspect, the embodiments of the present disclosure also provide an application of the aforementioned integrated detection kit in the field of monkeypox virus detection.

[0019] The beneficial effect of the present invention is that the RPA-CRISPR one-pot detection system based on sustained-release agent timing control introduces a sustained-release agent to encapsulate the CRISPR component. The sustained-release agent begins to disintegrate and release the amplification product at the RPA amplification temperature of 37°C, and automatically releases the CRISPR detection system at a 42°C environment after the amplification is completed, realizing the one-pot closed-tube "amplification first, then detection" timing control. Its sensitivity is comparable to that of the standard two-step method with contamination risks, and high-sensitivity detection of single copies can be achieved.

[0020] Other features and advantages of the present invention will be described in the following description, and in part will become apparent from the description, or understood by practicing the present invention. The purpose and other advantages of the present invention are realized and obtained by the structures particularly pointed out in the description and the drawings.

[0021] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, preferred embodiments are given below and described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 The poloxamer provided in the embodiments of the present disclosure forms micelles to encapsulate the CRISPR components and then disintegrate and release them;

[0024] Figure 2 Transmission electron microscopy images of poloxamer micelles provided in the embodiments of the present disclosure;

[0025] Figure 3 A schematic diagram of the timing control principle provided by an embodiment of the present disclosure;

[0026] Figure 4 A concentration screening diagram for poloxamer-encapsulated CRISPR components provided in an embodiment of the present disclosure;

[0027] Figure 5 A graph showing the effect of different volume combinations of 15% poloxamer-encapsulated CRISPR components on detection sensitivity provided in an embodiment of the present disclosure;

[0028] Figure 6 A graph showing the fluorescence changes over time generated by the one-step method of encapsulating CRISPR components with 15% poloxamer concentration provided in an embodiment of the present disclosure;

[0029] Figure 7 Schematic diagram of the MPXV F3L gene in the MPXV genome and the design bitmap of the MPXV RPA primers and crRNA in this study provided in the embodiments of the present disclosure;

[0030] Figure 8 A fluorescence histogram showing the one-step amplification of MPXV and other common skin disease pathogens using the F5 primers provided in the embodiments of the present disclosure;

[0031] Figure 9 Fluorescence curves of 14 clinical samples provided in the embodiments of the present disclosure in a conventional one-step detection system;

[0032] Figure 10 Fluorescence curves of 14 clinical samples provided in the embodiments of the present disclosure in a conventional two-step detection system;

[0033] Figure 11 This is a fluorescence curve graph of 14 clinical samples tested by the commercially available qPCR MPXV kit provided in an embodiment of the present disclosure;

[0034] Figure 12 A comparison chart of the detection results of the one-step detection system, the two-step detection system, and the standard qPCR provided in the embodiments of the present disclosure;

[0035] Figure 13 A fluorescence histogram of the two-step amplification of MPXV F3L plasmids at different concentrations provided in the embodiments of the present disclosure;

[0036] Figure 14 A fluorescence histogram showing the one-step amplification of MPXV and other common skin disease pathogens using the F5 primers provided in the embodiments of the present disclosure;

[0037] Figure 15 This is a fluorescence histogram of one-step amplification of MPXV F3L plasmids at different concentrations using the optimized system provided in the embodiments of the present disclosure;

[0038] Figure 16 Comparative heat map of the specificity verification results of the one-step and two-step methods provided in the embodiment of the present disclosure

[0039] Figure 17A heat map comparing the sensitivity validation results of the one-step and two-step methods provided in the embodiments of the present disclosure. DETAILED DESCRIPTION

[0040] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0041] As used herein, the phrases "in one embodiment," "according to one embodiment," "in some embodiments," and the like generally refer to the fact that the particular feature, structure, or characteristic following the phrase may be included in at least one embodiment of the present disclosure. Thus, a particular feature, structure, or characteristic may be included in more than one embodiment of the present disclosure, such that these phrases do not necessarily refer to the same embodiment. As used herein, the terms "example," "exemplary," and the like are used to "serve as an example, instance, or illustration." Any implementation, aspect, or design described herein as "example" or "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations, aspects, or designs. Instead, the use of the terms "example," "exemplary," and the like is intended to present concepts in a concrete manner.

[0042] Herein, example embodiments of the present disclosure will be described in more detail with reference to the accompanying drawings. As used herein, expressions such as "at least one of..." when following a list of elements modify the entire list of elements, rather than modifying individual elements in the list. For example, the expression "at least one of a, b, and c" should be understood to include only a, only b, only c, both a and b, both a and c, both b and c, or all of a, b, and c.

[0043] The terms used herein are only used to describe specific exemplary configurations and are not intended to be limiting. As used herein, the singular articles "a", "an" and "the" may also be intended to include plural forms, unless otherwise clearly indicated herein. The terms "comprise", "include" and "have" are inclusive and therefore specify the presence of features, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, steps, operations, elements, components and / or combinations thereof. The method steps, processes and operations described herein should not be interpreted as necessarily requiring them to be performed in the particular order discussed or shown, unless specifically identified as an execution order. Additional or alternative steps may be adopted.

[0044] The traditional RPA-CRISPR two-step detection method requires pre-amplification of the nucleic acid target through recombinase polymerase amplification (RPA), and then transfer of the amplified product to an independent reaction system for Cas12a-mediated cleavage detection.

[0045] Although this method has high accuracy, it has the following key drawbacks:

[0046] 1. Aerosol contamination risk: The process of opening and transferring the amplification product can easily lead to aerosol escape, causing laboratory environmental contamination and significantly increasing the risk of false positives. In clinical or point-of-care (POCT) testing scenarios, the operation steps are complex and require high technical skills, limiting its widespread application.

[0047] 2. Reduced detection efficiency: The step-by-step procedure prolongs the total detection time (usually more than 60 minutes), which cannot meet the needs of rapid screening. The transfer of amplification products may lead to loss of sensitivity due to adsorption to the tube wall or dilution effects.

[0048] To overcome this technical shortcoming, integrated detection systems such as SHERLOCKv2 and HOLMESv2 have been developed in recent years. By integrating RPA amplification and CRISPR detection steps, they effectively avoid the contamination risk caused by the capping operation. However, these technologies still have the following bottlenecks:

[0049] 1. Reduced sensitivity: Due to the direct mixing of RPA and CRISPR systems, the Cas12a protein will competitively bind to the DNA template, inhibiting the efficiency of RPA primer extension, resulting in a 5-10-fold decrease in the detection limit compared to the two-step method (for example, the two-step method has a detection limit of 1 copy / μL, while the one-pot method can only reach 10 copies / μL). Mechanistic studies have shown that the electrostatic interaction between Cas12a and RPA core enzymes (such as the recombinase UvsX) further exacerbates the inhibition of enzyme activity.

[0050] 2. High technical complexity: Existing improvement schemes (such as one-pot light-controlled or chemically regulated methods) rely on complex designs, for example: crRNA modification without a PAM sequence (increasing synthesis cost and design difficulty); photosensitive materials (such as azobenzene) to control the reaction sequence (requiring dedicated light source equipment and cumbersome operation).

[0051] 3. Limitations of thermosensitive materials: When attempting to use traditional thermosensitive materials such as agarose, their phase transition temperature (usually >60°C) far exceeds the optimal reaction temperature of RPA / CRISPR (37°C), making dynamic regulation impossible. The uneven pore size of the gel leads to uncontrollable release of the amplified product, affecting detection repeatability.

[0052] The defects in the above solutions are the results obtained by the inventors after practice and careful research. Therefore, the process of discovering the above problems and the solutions proposed by this disclosure for the above problems below should be the contributions made by the inventors to this disclosure during the disclosure process.

[0053] It should be noted that similar reference numerals and letters denote similar items in the following drawings, and therefore, once an item is defined in one drawing, it does not need to be further defined or explained in subsequent drawings.

[0054] The following embodiments of the present invention are described in detail with reference to the accompanying drawings. In the absence of conflict, the following embodiments and features therein may be combined with each other.

[0055] The disclosed embodiments provide an RPA-CRISPR one-pot detection system based on sustained-release agent timing control, comprising: an RPA pre-amplification system, a CRISPR detection system, and a poloxamer thermosensitive hydrogel; the poloxamer thermosensitive hydrogel encapsulates the CRISPR / Cas12a complex at room temperature, and the poloxamer concentration is 10-20% w / v.

[0056] In some embodiments, specifically, the poloxamer encapsulation volume in the poloxamer thermosensitive hydrogel is 10 to 20 μL, the disintegration temperature is 37° C., and the disintegration time is 8 to 10 minutes.

[0057] In some embodiments, specifically, the RPA primers in the RPA pre-amplification system target the conserved region of the MPXV F3L gene, and the sequences are as shown in SEQ ID NO: 1-2, as specifically shown in Table 1.

[0058] Table 1 SEQ ID NO. 1-2

[0059]

[0060] In some embodiments, specifically, the RPA pre-amplification system includes the following components: forward RPA primer, RPA Buffer, MgOAc, DNA template and nuclease-free water.

[0061] In some embodiments, specifically, the crRNA in the CRISPR detection system targets the PAM site of the F3L gene, and the sequence is SEQ ID NO: 3, as specifically shown in Table 2.

[0062] Table 2 SEQ ID NO.3

[0063]

[0064] In some embodiments, specifically, the CRISPR detection system includes the following components: Lba Cas12a, ssDNA reporter gene, 10×NEB Buffer 2.1, crRNA, DNA template and nuclease-free water.

[0065] In some embodiments, specifically, the amplification temperature of the RPA pre-amplification system is 37° C.; the triggering temperature of the CRISPR detection system is 42° C.; and the total reaction time of the RPA amplification, poloxamer thermosensitive hydrogel disintegration and CRISPR triggering is less than 40 minutes.

[0066] In some embodiments, specifically, it further includes: a constant temperature module and a fluorescence collection module.

[0067] In a second aspect, the embodiments of the present disclosure further provide an integrated detection kit, comprising: the RPA-CRISPR one-pot detection system based on sustained-release agent timing control as described above; wherein, the target of the kit is monkeypox virus, and the detection limit is ≤10 copies / μL.

[0068] In a third aspect, the embodiments of the present disclosure also provide an application of the aforementioned integrated detection kit in the field of monkeypox virus detection.

[0069] See also Figure 1-Figure 3 ,like Figure 1-Figure 3 As shown, Poloxamer sustained-release system: Poloxamer thermosensitive hydrogel is introduced as a time-space separation medium to construct an RPA-CRISPR / Cas12a integrated detection platform. This material forms micelles ( Figure 1 Left), the amphiphilic block copolymer properties of poloxamer enable it to self-assemble into micelle structures under specific conditions ( Figure 2 ), thereby achieving effective packaging and release of CRISPR components, and then achieving physical isolation of RPA amplification and CRISPR detection reactions; when the temperature rises to 37°C, poloxamer undergoes a reversible phase change and releases the RPA amplification product to the CRISPR reaction area ( Figure 1 Right), triggering CRISPR-specific recognition ( Figure 3 Experiments have shown that its sensitivity is comparable to that of the standard two-step method. This method optimizes reaction compatibility by simply adding a sustained-release agent, providing a cost-effective technical path for the development of highly sensitive integrated molecular diagnostic systems.

[0070] See also Figure 4 ,like Figure 4 As shown, different concentration-volume combinations of poloxamer (concentration of 15% or 20%, volume of 10 μL, 15 μL and 20 μL) had an effect on the same concentration of plasmid template (10 5The fluorescence detection results of the CRISPR component coated with poloxamer at a concentration of 15% showed that fluorescence could be detected in 8-10 minutes, while the fluorescence signal could be detected in 1 minute by the one-pot method without sustained-release agent coating. The fluorescence intensity detected by the CRISPR component coated with poloxamer at a concentration of 15% was higher than that of the CRISPR component coated with poloxamer at a concentration of 20%. Figure 4 ); The experimental results also demonstrated the feasibility of applying the sustained-release technology to RPA-CRISPR one-pot detection and the compatibility of the buffer.

[0071] See also Figure 5 ,like Figure 5 As shown, the effects of 15% poloxamer-encapsulated CRISPR components and different volume combinations on detection sensitivity were tested according to the following steps:

[0072] S1, 2.5 μl Cas12a enzyme (150 nM), 0.5 μl crRNA, 0.5 μl nuclease-free water, 1 μl 2.1 Buffer, 4 μl fluorescent probe and 15 μl 15% poloxamer solution (dissolved in deionized water) were mixed and centrifuged at 12000 rpm for 60 seconds;

[0073] S2, standing at 20 °C for 30 min to form a micellar encapsulation structure;

[0074] S3, the RPA reaction system (containing After the freeze-dried powder, nuclease-free water, primers, template DNA, and magnesium ions are mixed, added to the sol after standing for 30 minutes, centrifuged briefly, and placed in a portable fluorescent quantitative PCR instrument to start amplification;

[0075] S4, heating to 37°C, can trigger micelle disintegration, release CRISPR components, and activate fluorescence detection (40 minutes).

[0076] Figure 5 a Poloxamer concentration - volume is 15% - 10 μL; b Poloxamer concentration - volume is 15% - 15 μL; c Poloxamer concentration - volume is 15% - 20 μL.

[0077] The “one-pot sequential control strategy” based on the integration of sustained-release agent (15% poloxamer) and RPA-CRISPR technology (volume of poloxamer-encapsulated CRISPR: 10 μL, 15 μL, 20 μL) was used to detect different concentrations of plasmid templates (1-10 5 copies / μL) of the fluorescence signal dynamics ( Figure 5 ).

[0078] The experimental results show that:

[0079] 1. Time-dependent activation of the fluorescence signal: The fluorescence signal can be detected 8–10 minutes after the reaction is initiated, and the signal intensity gradually increases over time. This phenomenon indicates that the CRISPR components encapsulated by the poloxamer sustained-release agent are gradually disintegrated and released during the reaction, thereby achieving the temporal activation of the trans-cleavage activity of the Cas protein.

[0080] 2. Detection sensitivity and quantitative correlation: The minimum detection limit can reach 1 copy / μL, and the fluorescence intensity is significantly positively correlated with the initial template concentration (1-10 5 copies / μL), demonstrating its potential for quantitative detection.

[0081] 3. Volume optimization and performance comparison: The fluorescence intensity detected by the 15μL system was significantly higher than that of the 10μL and 20μL groups. The 15μL system may achieve the best match between sustained-release kinetics and detection efficiency by optimizing the local concentration and diffusion rate of the reactants.

[0082] See also Figure 6 ,like Figure 6 As shown, a "one-pot timing control strategy" based on the integration of a sustained-release agent (15% poloxamer) and RPA-CRISPR technology was used to detect plasmid templates (10 5 copies / μL) of the fluorescence signal dynamics ( Figure 5 The experimental results showed that after about 10 minutes of reaction, the fluorescence curve of the plasmid showed a clear upward trend, indicating that the Cas protein was successfully released from the disintegrated poloxamer, thereby achieving the temporal activation of the Cas protein's trans-cleavage activity.

[0083] See also Figure 7 ,like Figure 7 As shown, RPA primers and crRNA of monkeypox virus were designed and tested according to the following steps:

[0084] S1, design RPA primers and crRNA of monkeypox virus (target gene, primers, crRNA sequences see Figure 10 );

[0085] S2, pre-loaded primers and slow-release packaged CRISPR components into the assay tube;

[0086] S3, adding monkeypox virus sample to start the one-pot reaction;

[0087] S4: The detector displays the fluorescence curve in real time and outputs the results within 40 minutes (sensitivity 1 copy / μL, specificity 100%).

[0088] Specifically, Figure 7The F3L gene of MPXV is indicated by a green box, and the red underline in the magnified box indicates the location of the forward and reverse primers designed in this study. The red annotation indicates the location of the PAM site.

[0089] This study compared the full genome sequences of the Central and West African monkeypox virus (MPXV) clades using the NCBI platform, identifying the highly conserved F3L gene as a target region between the two clades. To facilitate subsequent crRNA design, amplification regions containing multiple PAM (Protospacer Adjacent Motif) sites were prioritized.

[0090] Based on the sequence characteristics of the PAM (Protospacer Adjacent Motif) site, eligible PAM sites were screened within the preselected amplicon region for gRNA design. To ensure crRNA specificity, the designed crRNA sequence was compared with the standard nucleic acid database using the NCBI BLAST tool. Among the candidate sequences that met the PAM site requirements (ccaataaataatttttttaacc and aaccggaataacatcatcaaaag), taking into account the complementary base pairing effect of crRNA itself, aaccggaataacatcatcaaaag was finally selected as the base adapter sequence of the hairpin structure, successfully constructing the crRNA molecule required for the CRISPR system.

[0091] See also Figure 8 ,like Figure 8 The figure shows fluorescence histograms of one-step amplification of MPXV and other common skin disease pathogens using primer F5. C1-C5 represent MPXV (positive control), herpes simplex virus, herpes zoster virus, coxsackievirus, and scarlet fever pathogens, respectively, while NC represents a negative control. The results demonstrate that primer F5 exhibits no cross-reactivity with any of the aforementioned pathogens.

[0092] The one-step specificity test was evaluated. This specificity evaluation included negative clinical samples and four common skin disease pathogens (herpes simplex virus, herpes zoster virus, coxsackie virus, and scarlet fever). The goal was to verify the system's ability to identify negative samples and exclude cross-reactivity with pathogens with similar clinical symptoms. The results of the one-step specificity test demonstrated high specificity, with no cross-reactivity with the aforementioned pathogens.

[0093] See also Figures 9-12 , Figure 9Figure 2 shows the fluorescence curves of 14 clinical samples using a conventional one-step detection system (S1-S14 are sample numbers, NC is the negative control). After heat inactivation, nucleic acids were extracted using a nanomagnetic bead method. RPA solution was added to the CRISPR sol and incubated for 40 minutes. The fluorescence signal was then observed under 300 nm ultraviolet light. Figure 10 Figure 2 shows fluorescence curves for 14 clinical samples using a conventional two-step detection system (S1-S14 are sample numbers; NC is the negative control). After heat inactivation, nucleic acids were extracted using a nanomagnetic bead method. A 20-minute RPA reaction was followed by a 20-minute CRISPR reaction. Fluorescence signals were then observed under 300 nm UV light. Figure 11 Fluorescence curves of 14 clinical samples tested using a commercially available qPCR MPXV kit. qPCR results served as the gold standard to validate the accuracy of the F-IPS system. Figure 12 The following chart compares the results of the one-step and two-step detection systems, as well as standard qPCR. The results demonstrate high consistency between the one-step and two-step detection systems and qPCR results, further validating the reliability and accuracy of the F-IPS system.

[0094] Reaction system composition:

[0095] RPA pre-amplification system: contains 1.2 μl forward and reverse primers (10 μM) (sequences shown in Table 1), 15 μl RPA Buffer, 1.25 μl MgOAc and 2 μl DNA template, and finally fills up to 25 μl with nuclease-free water.

[0096] CRISPR detection system: 2.5 μL Lba Cas12a (1 μM), 4 μL ssDNA reporter gene (10 μM), 1 μL 10× NEB Buffer 2.1, 0.5 μL crRNA (10 μM) and 2 μL DNA template, add nuclease-free water to adjust the final volume to 10.5 μL.

[0097] Sustained-release agent: poloxamer sol (concentration 10-20%, preferably 15%).

[0098] Operation process:

[0099] Premixing the CRISPR detection solution with poloxamer to form a sol;

[0100] Add RPA reaction solution and react at 37°C for 40 minutes;

[0101] Fluorescence signals are collected in real time, and positive results are determined by threshold values.

[0102] Detection performance

[0103] Sensitivity: single copy / μL MPXV DNA;

[0104] Specificity: No cross-reaction with HSV, VZV, CVA, GAS;

[0105] Clinical consistency: The 14 MPXV-positive samples were 100% consistent with the qPCR results.

[0106] Example 1: Construction of RPA-CRISPR reaction system

[0107] Primer design: Based on the conserved region of the MPXV F3L gene (GenBank: AF380138.1), as shown in Table 1, primers F5 and R5 were designed, and the amplified product length was 200 bp;

[0108] crRNA design: targeting the PAM site (5'-TTTN) of the F3L gene, the sequence is shown in Table 2 and Figure 7 As shown;

[0109] Prepare 15% poloxamer sol: dissolve 1.5 g of poloxamer powder in 10 ml of TAE solution and let stand in a water bath at 20°C to form a homogeneous solution;

[0110] When using, add 15 μl of poloxamer solution to the CRISPR solution, centrifuge, and let it stand at 37°C for about ten minutes before adding the RPA reagent.

[0111] Reaction procedure: constant temperature at 37°C for 40 minutes, and fluorescence signal was collected every 30 seconds.

[0112] Example 2: Clinical sample testing and verification

[0113] Sample processing: Throat swab DNA was extracted using the magnetic bead method;

[0114] Reaction system: Add 2 μL DNA template to the premixed sol, then add RPA solution, and react at 37°C for 40 min;

[0115] Interpretation of results: The fluorescence signal was judged as positive if it exceeded the threshold.

[0116] See also Figure 13-15 ,like Figure 13-15 As shown, Figure 13 The fluorescence histogram of the two-step amplification of MPXV F3L plasmid at different concentrations, c1-c6 corresponds to 10 5 concentration gradient to 1 copy / μL. Figure 14 The fluorescence histogram of one-step amplification of MPXV and other common skin disease pathogens by F5 primers is shown. Figure 13 consistent; Figure 15This is the fluorescence histogram of the one-step amplification of MPXVF3L plasmid with different concentrations after optimization. c1-c6 correspond to 10 5 The concentration was adjusted to 1 copy / μL.

[0117] See also Figure 16-17 ,like Figure 16-17 Figure 2 shows a heat map comparing the specificity and sensitivity validation results of the one-step and two-step assays. Group 1 represents the one-step assay, and Group 2 represents the two-step assay.

[0118] comprehensive Figure 12-17 The results showed that the one-step and two-step detection systems were highly consistent with qPCR results, further validating the reliability and accuracy of the one-step system. Statistical analysis was performed using a two-tailed Student's t-test. **** indicates P < 0.0001 (extremely significant difference), Ns indicates no statistical significance, and NC / NTC serves as the negative control.

[0119] Specifically, the target gene F3L sequence used in monkeypox virus detection is:

[0120] tcagaatctaatgatgacataactaagaagtttatctacagccaatttagctgcattatttttagcatctcgtttagattttccatctgccttatcgaatactcttccgtcaatg tctacacaggcataaaatgtaggagagttaggccccactgattcaatacgaaaagaccaatctctcctagttatatttgacagtactcattaataacggtgacagggttaacacc tttccaataaataatttttttaAccggaataacatcatcaaaagacttatgatcctctctcattgatttttcgcgggatacatcatttatagcatcagcatcagaatctgta ggccgtgtatcagcatccattgtcgtagaccaacgaggaggagtatcgttggagctgtaaaccatagcactacgttgaagatcatacagagctttattaacttctcgcttctccat

[0121] Specifically, the RPA primer sequences used in monkeypox virus detection are:

[0122] Upstream primer: caatacgaaaagaccaatctctcctagttatttga

[0123] Downstream primer: gcatccattgtcgtagaccaacgaggaggagta

[0124] Specifically, the CRISPR primer sequences used in monkeypox virus detection are:

[0125] tttaAccggaataacatcatcaaaag

[0126] In summary, this RPA-CRISPR one-pot detection system based on sustained-release agent timing control introduces a sustained-release agent to encapsulate the CRISPR components. The sustained-release agent begins to disintegrate and release the amplification product at the RPA amplification temperature of 37°C, and automatically releases the CRISPR detection system at 42°C after the amplification is completed, realizing the one-pot closed-tube "amplification first, then detection" timing control. Its sensitivity is comparable to that of the standard two-step method with contamination risks, and can achieve high-sensitivity detection of single copies.

[0127] With the above-described preferred embodiments of the present invention as a guide, and with reference to the above description, relevant personnel are fully capable of making various changes and modifications without departing from the technical scope of this invention. The technical scope of this invention is not limited to the contents of the specification and must be determined according to the scope of the claims.

Claims

1. A one-pot RPA-CRISPR detection system based on time-sequential control of sustained-release agents, characterized in that: include: RPA pre-amplification system, CRISPR detection system and poloxamer temperature-sensitive hydrogel; The poloxamer thermosensitive hydrogel encapsulates the CRISPR / Cas12a complex at room temperature, and the concentration of the poloxamer is 10-20% w / v.

2. The detection system according to claim 1, wherein: The poloxamer encapsulation volume in the poloxamer thermosensitive hydrogel is 10 to 20 μL, the disintegration temperature is 37° C., and the disintegration time is 8 to 10 minutes.

3. The detection system according to claim 1, wherein: The RPA primers in the RPA pre-amplification system target the conserved region of the MPXV F3L gene, and the sequence is as shown in SEQ ID NO: 1-2.

4. The detection system according to claim 1, wherein: The RPA pre-amplification system includes the following components: Forward RPA primer, RPA Buffer, MgOAc, DNA template, and nuclease-free water.

5. The detection system according to claim 1, wherein: In the CRISPR detection system, crRNA targets the PAM site of the F3L gene, and the sequence is as shown in SEQ ID NO:

3.

6. The detection system according to claim 1, wherein: The CRISPR detection system includes the following components: LbaCas12a, ssDNA reporter gene, 10×NEB Buffer 2.1, crRNA, DNA template, and nuclease-free water.

7. The detection system according to claim 1, wherein: The amplification temperature of the RPA pre-amplification system is 37°C; The trigger temperature of the CRISPR detection system is 42°C; Furthermore, the total reaction time of the RPA amplification, poloxamer thermosensitive hydrogel disintegration and CRISPR triggering is less than 40 minutes.

8. The detection system according to claim 1, wherein: Also includes: Constant temperature module and fluorescence acquisition module.

9. An integrated detection kit, characterized in that: include: The RPA-CRISPR one-pot detection system based on time-sequential control of a sustained-release agent according to any one of claims 1 to 8; The target of the kit is monkeypox virus, and the detection limit is ≤10 copies / μL.

10. Use of the integrated detection kit according to claim 9 in the field of monkeypox virus detection.

Images