Transgenic soybean event lp689-1 and methods for detecting same
By using specific nucleic acid sequences and detection methods, the identification challenge of the LP689-1 genetically modified soybean event was solved, and soybeans were endowed with quadruple herbicide tolerance, achieving rapid detection and high-efficiency herbicide tolerance, thus ensuring soybean yield and weed control capabilities.
Patent Information
- Application Number
- CN202511089985.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Existing technologies are insufficient to effectively identify and detect the LP689-1 genetically modified soybean event, and it is difficult to confer quadruple herbicide tolerance to soybeans through biotechnology, leading to increased weed resistance and decreased herbicide effectiveness.
This invention provides a nucleic acid sequence and its detection method, which identifies the transgenic soybean event LP689-1 using specific nucleic acid primers and probes. Combined with DNA amplification and hybridization techniques, the specificity and accuracy of the detection are ensured. Furthermore, by introducing specific genes, soybeans are endowed with tolerance to 2,4-D class, HPPD inhibitors, glufosinate and glyphosate herbicides.
It enables rapid and accurate detection of the LP689-1 event in genetically modified soybeans, ensuring high tolerance of soybeans to four herbicides, maintaining soybean yield and improving breeding efficiency, and providing broad-spectrum weed control capabilities.
Smart Images

Figure CN120591459B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a transgenic soybean event LP689-1 and a nucleic acid sequence and a method for detecting the transgenic soybean event LP689-1. Background Art
[0002] Soybean( Glycine max Soybean (Linn.) Merr.) is an important food and oil crop in many regions of the world. Biotechnology has been applied to improve soybean agronomic traits and quality. Herbicide tolerance is an important economic trait in soybean production, particularly resistance to common commercial herbicides (such as 2,4-D, HPPD inhibitors, glufosinate, and glyphosate). Soybean resistance to 2,4-D, HPPD inhibitors, glufosinate, and glyphosate can be achieved by expressing herbicide resistance genes in soybean plants through genetic engineering.
[0003] In addition to the functional gene itself, the selection and sequencing of regulatory elements are crucial for achieving a successful transformation event, and their technical effectiveness can be unpredictable. Furthermore, it is known that the expression of exogenous genes in plants is influenced by the location of their insertion into the soybean chromosome, potentially due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. Consequently, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., those in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary significantly between events; spatial or temporal expression patterns can also vary, such as the relative expression of the transgene varies between different plant tissues. This variability manifests itself in actual expression patterns that may be inconsistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Consequently, it is often necessary to generate hundreds or even thousands of different events and screen these events to identify a single event that exhibits the desired transgene expression level and pattern for commercialization. This transformation event confers excellent resistance to 2,4-D, HPPD inhibitors, glufosinate, and glyphosate herbicides without compromising soybean yield. Conventional breeding methods can be used to backcross the transgenic trait into other genetic backgrounds through hybridization. The progeny produced by this hybridization retain the transgenic expression characteristics and trait performance of the original transformant. This strategy ensures reliable gene expression and stable herbicide resistance (such as 2,4-D, HPPD inhibitors, glufosinate, and glyphosate) across a wide range of varieties, providing them with broad-spectrum weed control capabilities and adaptability to local growing conditions.
[0004] It would be beneficial to be able to detect the presence of a specific event to determine whether the progeny of a sexual cross contain the gene of interest. Furthermore, methods for detecting specific events would also facilitate compliance with regulations, such as the need for formal approval and labeling of foods derived from recombinant crops before they can be marketed. Detecting the presence of a transgene is possible using any well-known polynucleotide detection method, such as the polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods typically focus on common genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, such methods cannot be used to distinguish between different events, particularly those generated using the same DNA construct. Therefore, currently, identification of specific transgenic events is often performed by PCR using a pair of primers spanning the junction of the inserted T-DNA and the flanking DNA, specifically comprising a first primer and a second primer.
[0005] In modern agricultural production, soybeans are an important economic crop, and weed control remains a key issue during their cultivation. Significant progress has been made in the development of genetically modified herbicide-tolerant soybeans, primarily through gene editing and transgenic techniques that confer tolerance to specific herbicides, thereby achieving the dual goals of effective weed management and crop protection. However, this field still faces challenges such as low conversion rates of some herbicide-tolerant genes into soybeans, unstable offspring traits, and increased weed resistance, which reduces the effectiveness of traditional herbicides. This has prompted research to develop novel composite traits (such as tolerance to a wider range of herbicides) and environmentally friendly products. Existing technologies primarily use biotechnology to confer soybean dual herbicide tolerance (mostly to glufosinate and glyphosate) or triple herbicide tolerance (such as glyphosate, aryloxyalkanoate, and glufosinate). However, research on conferring soybean tolerance to quadruple herbicides (such as glufosinate, glyphosate, 2,4-D, and HPPD inhibitors) is limited. Summary of the Invention
[0006] The purpose of the present invention is to provide a transgenic soybean event LP689-1 and a detection method thereof.
[0007] The present invention provides a nucleic acid sequence for detecting a transgenic soybean event LP689-1, comprising one or more sequences selected from SEQ ID NOs: 1-7 or their complementary sequences. The nucleic acid sequence is derived from the transgenic soybean event LP689-1. Representative seeds of the transgenic soybean event LP689-1 were deposited with the China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China) on April 13, 2025, with the deposit number CCTCC NO: P202509. The soybean seed is taxonomically designated as Glycine max L. LP689-1.
[0008] In some embodiments of the invention, the nucleic acid sequence is an amplicon diagnostic for the presence of soybean event LP689-1.
[0009] In some embodiments, the present invention provides a nucleic acid sequence comprising SEQ ID NO: 3 or its complementary sequence and / or SEQ ID NO: 4 or its complementary sequence.
[0010] In some embodiments, the nucleic acid sequence comprises at least 11 consecutive nucleotides of SEQ ID NO: 3 or its complementary sequence and / or at least 11 consecutive nucleotides of SEQ ID NO: 4 or its complementary sequence.
[0011] In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO: 1 or its complementary sequence, and / or SEQ ID NO: 2 or its complementary sequence.
[0012] In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO: 1-7 or a complementary sequence thereof.
[0013] The nucleic acid sequence provided by the present invention may be the sequence SEQ ID NO: 1 or its complementary sequence, which is a 22-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic soybean event LP689-1. The sequence SEQ ID NO: 1 or its complementary sequence spans the flanking genomic DNA sequence of the soybean insertion site and the DNA sequence at the 5' end of the insertion sequence. The presence of the transgenic soybean event LP689-1 can be identified by including the sequence SEQ ID NO: 1 or its complementary sequence.
[0014] The nucleic acid sequence provided by the present invention may be the sequence SEQ ID NO: 2 or its complementary sequence, which is a 22-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic soybean event LP689-1. The sequence SEQ ID NO: 2 or its complementary sequence spans the DNA sequence at the 3' end of the insertion sequence and the flanking genomic DNA sequence of the soybean insertion site. The presence of the transgenic soybean event LP689-1 can be identified by including the sequence SEQ ID NO: 2 or its complementary sequence.
[0015] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insertion sequence of the sequence SEQ ID NO: 3 or its complement (first nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking soybean genomic DNA region of the sequence SEQ ID NO: 3 or its complement (second nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of the sequence SEQ ID NO: 3 that includes the entire sequence SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising the sequence SEQ ID NO: 1, the presence of the transgenic soybean event LP689-1 or its progeny can be diagnosed. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist solely of DNA and can also comprise RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides set forth in the sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in the sequences of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe and primer can be about 17 to 50 or more consecutive nucleotides in length. The sequence SEQ ID NO: 3 or its complementary sequence is a 1120-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic soybean event LP689-1. The sequence SEQ ID NO: 3 or its complementary sequence consists of 503 nucleotides of soybean flanking genomic DNA sequence (nucleotides 1-503 of sequence SEQ ID NO: 3), 392 nucleotides of pLP689 construct DNA sequence (nucleotides 504-895 of sequence SEQ ID NO: 3), and 117 nucleotides of the 3' end DNA sequence of the pAtUbi10 promoter (nucleotides 896-1120 of sequence SEQ ID NO: 3). The presence of the transgenic soybean event LP689-1 can be identified by including the sequence SEQ ID NO: 3 or its complementary sequence.
[0016] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insertion sequence of SEQ ID NO:4 or its complementary sequence (third nucleic acid sequence), or at least 11 or more contiguous nucleotides of any portion of the 3'-flanking soybean genomic DNA region of SEQ ID NO:4 or its complementary sequence (fourth nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of SEQ ID NO:4 that includes the entire SEQ ID NO:2 sequence. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences can be used in a DNA amplification method that produces an amplification product including a DNA primer pair. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including the sequence SEQ ID NO:2, the presence of transgenic soybean event LP689-1 or its progeny can be diagnosed. The sequence SEQ ID NO:4 or its complementary sequence is a 1005-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic soybean event LP689-1. The sequence SEQ ID NO:4 or its complementary sequence consists of a 119-nucleotide tPsE9 terminator partial sequence (nucleotides 1-119 of sequence SEQ ID NO:4), a 188-nucleotide pLP689 construct DNA sequence (nucleotides 120-307 of sequence SEQ ID NO:4), and a 698-nucleotide soybean integration site flanking genomic DNA sequence (nucleotides 308-1005 of sequence SEQ ID NO:4). The presence of the transgenic soybean event LP689-1 can be identified by including the sequence SEQ ID NO:4 or its complementary sequence.
[0017] The nucleic acid sequence provided by the present invention may be the sequence SEQ ID NO: 5 or its complementary sequence, which is a sequence of 11885 nucleotides in length characterizing the transgenic soybean event LP689-1, wherein the sequence SEQ ID NO: 5 includes a target gene and a specific region nucleic acid sequence, wherein the target gene includes a gene for 2,4-D tolerance traits. aad12 , HPPD inhibitor-tolerant genes hppd , genes for glufosinate-ammonium tolerance traits pat , genes for glyphosate tolerance traits epspsThe specific region nucleic acid sequence includes the 5' end nucleic acid sequence of SEQ ID NO:5 and the 3' end nucleic acid sequence of SEQ ID NO:5, wherein the 5' end nucleic acid sequence of SEQ ID NO:5 includes the sequence of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:6; and the 3' end nucleic acid sequence of SEQ ID NO:5 includes the sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:7. The specific genomic and genetic elements included are shown in Table 1. The presence of SEQ ID NO:5 or its complementary sequence can be used to identify the presence of transgenic soybean event LP689-1.
[0018] Table 1 Genome and genetic elements included in sequence SEQ ID NO: 5
[0019]
[0020] The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to produce an amplification product, and the presence of the transgenic soybean event LP689-1 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic soybean event LP689-1 or its progeny in a biological sample.
[0021] The present invention provides a DNA primer pair, comprising a first primer and a second primer. When the first primer and the second primer are used together with DNA containing transgenic soybean event LP689-1 for an amplification reaction, an amplicon of soybean event LP689-1 in a detection sample is generated.
[0022] The first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14; furthermore, the first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 9 or SEQ ID NO: 13; furthermore, the first primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.
[0023] The present invention also provides a DNA probe, comprising SEQ ID NO: 1-7 or a complementary sequence thereof, wherein the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequence SEQ ID NO: 1-7 or a complementary sequence thereof under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the sequence SEQ ID NO: 1-7 or a complementary sequence thereof under stringent hybridization conditions; the stringent conditions may be hybridization in a 6×SSC, 0.5% SDS solution at 65° C., followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0024] In some embodiments, the DNA probe comprises the sequence SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
[0025] In some embodiments, the DNA probe comprises at least 11 consecutive nucleotides of the sequence SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of the sequence SEQ ID NO: 4 or its complementary sequence.
[0026] In some embodiments, the DNA probe comprises consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 2 or its complementary sequence.
[0027] In some embodiments, at least one of the DNA probes is labeled with at least one fluorescent group.
[0028] The present invention also provides a marker nucleic acid molecule, wherein the marker nucleic acid molecule is selected from SEQ ID NO: 1-7 or its complementary sequence, and the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions; the stringent hybridization conditions are hybridization in a 6×SSC, 0.5% SDS solution at 65° C., and then washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0029] In some embodiments, the marker nucleic acid molecule is selected from the sequence SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
[0030] In some embodiments, the marker nucleic acid molecule is selected from the sequence SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence.
[0031] In some embodiments, the marker nucleic acid molecule is selected from at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 4 or its complementary sequence.
[0032] In some embodiments, the marker nucleic acid molecule includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 2 or its complementary sequence.
[0033] The present invention provides a method for detecting the presence of DNA of transgenic soybean event LP689-1 in a sample, comprising:
[0034] (1) contacting the sample to be tested with the DNA primer pair in a nucleic acid amplification reaction;
[0035] (2) Performing nucleic acid amplification reaction;
[0036] (3) Detecting the presence of amplification products;
[0037] The amplified product includes a nucleic acid sequence selected from the above sequences SEQ ID NO: 1-7 or complementary sequences thereof, indicating the presence of DNA of the transgenic soybean event LP689-1 in the test sample.
[0038] The present invention provides a method for detecting the presence of DNA of transgenic soybean event LP689-1 in a sample, comprising:
[0039] (1) contacting the sample to be tested with the DNA probe and / or the marker nucleic acid molecule;
[0040] (2) The sample to be tested is hybridized with the DNA probe and / or the marker nucleic acid molecule under stringent hybridization conditions; the stringent conditions may be hybridization in a 6×SSC, 0.5% SDS solution at 65°C, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS;
[0041] (3) Detecting the hybridization between the sample to be detected and the probe and / or the marker nucleic acid molecule.
[0042] Among them, hybridization with the probe, the hybridization situation includes successful hybridization of the sample to be tested with the DNA probe and unsuccessful hybridization of the sample to be tested with the DNA probe. The successful hybridization of the sample to be tested with the DNA probe indicates that the DNA of the transgenic soybean event LP689-1 is present in the test sample.
[0043] The hybridization between the sample to be tested and the marker nucleic acid molecule is performed, and the hybridization status between the sample to be tested and the marker nucleic acid molecule is detected. The hybridization status includes successful hybridization between the sample to be tested and the marker nucleic acid molecule and unsuccessful hybridization between the sample to be tested and the marker nucleic acid molecule. Successful hybridization between the sample to be tested and the marker nucleic acid molecule indicates that the DNA of the transgenic soybean event LP689-1 is present in the test sample. Then, marker-assisted breeding analysis is performed to determine the gene for the 2,4-D herbicide tolerance trait. aad12 , HPPD inhibitor herbicide tolerance genes hppd , glufosinate herbicide tolerance genes pat , genes for glyphosate-tolerance herbicide epsps Four herbicide tolerance genes are genetically linked to the marker nucleic acid molecules.
[0044] The present invention also provides a DNA detection kit comprising the probes, primer pairs, and / or marker nucleic acid molecules of the present invention. Specifically, the kit comprises: a DNA primer pair that produces an amplicon diagnostic for transgenic soybean event LP689-1, a probe specific for the sequences of SEQ ID NOs: 1-7, and / or a marker nucleic acid molecule specific for the sequences of SEQ ID NOs: 1-7.
[0045] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 4 or its complementary sequence, which can be used as a DNA primer or probe specific for the transgenic soybean event LP689-1 or its progeny.
[0046] Furthermore, the DNA molecule includes the 1st to 11th or 12th to 22nd consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st to 11th or 12th to 22nd consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.
[0047] Furthermore, the DNA molecule includes a homologous sequence of SEQ ID NO: 1 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 2 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 6 or a complementary sequence thereof, or a homologous sequence of SEQ ID NO: 7 or a complementary sequence thereof.
[0048] The present invention also provides a plant cell, the genome of which contains the nucleic acid sequence SEQ ID NO: 1-7 or its complementary sequence.
[0049] The sequences provided by the present invention include the sequences listed in Table 2 below:
[0050] Table 2 Related sequences of the present invention
[0051] Sequence number (SEQ ID NO) Sequence Description 1 RB end junction sequence (including part of the T-DNA RB end sequence and genomic sequence, 22bp) 2 LB end junction sequence (including part of the T-DNA LB end sequence and genomic sequence, 22bp) 3 The 5' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the RB end for T-DNA (containing about 500bp of genomic sequence and about 600bp of T-DNA sequence). 4 The 3' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the LB end for T-DNA (containing about 700bp of genomic sequence and about 300bp of T-DNA). 5 Full-length T-DNA sequence (including genomic sequence extending approximately 700 bp from the LB end and approximately 500 bp from the RB end) 6 Sequence located within SEQ ID NO: 3, LP689 T-DNA sequence 7 Sequence located within SEQ ID NO: 4, LP689 T-DNA sequence 8 The first primer for amplifying SEQ ID NO: 3, primer 11 9 Amplify the second primer of SEQ ID NO:3, primer 12 10 The first primer for amplifying SEQ ID NO: 4, primer 13 11 A second primer for amplifying SEQ ID NO: 4, primer 14 12 5' flanking genomic primer, primer 15 13 Primer 16 on T-DNA that pairs with sequence 12 14 3' flanking genomic primer, primer 17 15 Primer 18 on T-DNA that pairs with sequence 14 16 Taqman assay for AAD12 primer 1 17 Taqman assay for AAD12 primer 2 18 Taqman Assay for AAD12 Probe 1 19 Taqman assay for HPPD primer 3 20 Taqman assay for HPPD primer 4 21 Taqman assay for HPPD probe 2 22 Taqman assay PAT primer 5 23 Taqman assay PAT primer 6 24 Taqman assay for PAT probe 3 25 Taqman assay for EPSPS primer 7 26 Taqman assay for EPSPS primer 8 27 Taqman assay for EPSPS probe 4 28 Soybean endogenous gene lectin primer 9 29 Soybean endogenous gene lectin primer 10 30 Probe 5 for AAD12 in Southern hybridization detection 31 HPPD probe 6 in Southern hybridization detection 32 Probe 7 for PAT in Southern hybridization 33 Probe 8 for EPSPS in Southern hybridization detection 34 Primer 19 located on the T-DNA, in the same direction as SEQ ID NO: 13 35 Primer 20 located on the T-DNA, in the opposite direction to SEQ ID NO: 13 36 Primer 21 located on T-DNA, in the opposite direction to SEQ ID NO: 13 37 Primer 22 located on the T-DNA, in the same direction as SEQ ID NO: 15 38 Primer 23 located on T-DNA, in the opposite direction to SEQ ID NO: 15 39 Primer 24 located on the T-DNA, in the opposite direction to SEQ ID NO: 15
[0052] The present invention also provides a method for protecting soybean plants from damage caused by herbicides, comprising planting at least one transgenic soybean plant, wherein the genome of the transgenic soybean plant sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 504-11187 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic soybean plant comprises the sequence SEQ ID NO: 5.
[0053] The present invention also provides a method for controlling weeds in a field where soybean plants are planted, comprising applying an effective dose of a 2,4-D or HPPD inhibitor or a glufosinate or glyphosate herbicide to a field where at least one transgenic soybean plant is planted, wherein the genome of the transgenic soybean plant sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 504 to 11187 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic soybean plant comprises the sequence SEQ ID NO: 5.
[0054] In some embodiments, the present invention provides a method for producing a soybean plant tolerant to an AAD12 herbicide, comprising introducing a transgenic soybean event LP689-1 into the genome of the soybean plant, and selecting soybean plants tolerant to the AAD12 herbicide. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of a transgenic soybean event LP689-1 that is tolerant to an AAD12 herbicide with a second parent soybean plant that lacks tolerance to the AAD12 herbicide, thereby producing a plurality of progeny plants; treating the progeny plants with an AAD12 herbicide; and selecting the progeny plants that are tolerant to the AAD12 herbicide.
[0055] In some embodiments, the present invention provides a method for producing soybean plants tolerant to an HPPD-inhibitor herbicide (e.g., basil), comprising introducing a transgenic soybean event LP689-1 into the genome of the soybean plant and selecting soybean plants tolerant to the HPPD-inhibitor herbicide. In some embodiments, the method comprises: sexually crossing a first parent soybean plant, a transgenic soybean event LP689-1 tolerant to the HPPD-inhibitor herbicide, with a second parent soybean plant lacking tolerance to the HPPD-inhibitor herbicide, thereby producing a plurality of progeny plants; treating the progeny plants with the HPPD-inhibitor herbicide; and selecting the progeny plants tolerant to the HPPD-inhibitor herbicide.
[0056] In some embodiments, the present invention provides a method for producing soybean plants tolerant to glufosinate herbicide, comprising introducing transgenic soybean event LP689-1 into the genome of the soybean plant and selecting soybean plants tolerant to glufosinate. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of transgenic soybean event LP689-1 tolerant to glufosinate with a second parent soybean plant lacking glufosinate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with glufosinate herbicide; and selecting the progeny plants that are tolerant to glufosinate.
[0057] In some embodiments, the present invention provides a method for producing soybean plants tolerant to glyphosate herbicides, comprising introducing transgenic soybean event LP689-1 into the genome of the soybean plants and selecting soybean plants that are tolerant to glyphosate. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of transgenic soybean event LP689-1 that is tolerant to glyphosate herbicides with a second parent soybean plant that lacks glyphosate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate herbicide; and selecting the progeny plants that are tolerant to glyphosate.
[0058] The present invention also provides a processed product produced from transgenic soybean event LP689-1, including but not limited to soybean meal, soybean oil, soy protein, soy products, grains, feed or industrial products or commodities, and any other food product to be consumed by animals as a food source, or as a component of soybean oil or stearic acid for food industry use. If sufficient expression levels are detected in the processed product, the processed product is expected to contain a nucleic acid sequence that is diagnostic for the presence of transgenic soybean event LP689-1 material in the processed product.
[0059] In summary, the transgenic soybean event LP689-1 of the present invention exhibits quadruple herbicide tolerance, offering the following advantages: 1) protection from economic losses caused by 2,4-D herbicides; protection from economic losses caused by HPPD inhibitor herbicides (such as chloramphenicol); the ability to apply agricultural herbicides containing glufosinate to soybean crops for broad-spectrum weed control; and the ability to apply agricultural herbicides containing glyphosate to soybean crops for broad-spectrum weed control. 2) soybean yield is not reduced. The event exhibits high tolerance to 2,4-D, HPPD inhibitor, glufosinate, and glyphosate herbicides, safely tolerating four times the herbicide dose, protecting plants from damage as low as 0%. Plants containing this event also exhibit excellent agronomic traits, with yield percentages exceeding 100%. Furthermore, the genes encoding the four herbicide tolerance traits are linked to a single DNA segment and present at a single locus in the genome of transgenic soybean event LP689-1. This improves breeding efficiency and enables the use of molecular markers to track transgenic inserts in breeding populations and their progeny. Furthermore, the primer or probe sequences provided in the detection method of the present invention can produce amplification products identified as transgenic soybean event LP689-1 or its progeny, enabling rapid, accurate, and stable identification of plant material derived from transgenic soybean event LP689-1.
[0060] the term
[0061] The following definitions and methods can better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise specified, the terms are understood according to conventional usage by those skilled in the art.
[0062] The soybean ( Glycine max ), and includes all plant species that can be crossed with soybean, including wild soybean species.
[0063] The term “comprising” means “including but not limited to.” The term “processed product” refers to a product obtained by processing raw materials such as plants and seeds, such as a composition.
[0064] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It is understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, as well as flowers, stems, fruits, leaves and roots, which are derived from transgenic plants previously transformed with a DNA molecule of the present invention and thus consist at least in part of transgenic cells, or their progeny.
[0065] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding the coding sequence (5' non-coding sequences) and following the coding sequence (3' non-coding sequences). A "native gene" refers to a gene found in nature that has its own regulatory sequences. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not found in nature. An "endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. An "exogenous gene" is a foreign gene that is now present in the genome of an organism and did not originally exist, and also refers to a gene that is introduced into a recipient cell through a transgenic step. Exogenous genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."
[0066] In some embodiments, the present invention provides the nucleotide sequence of the present invention. " flanking DNA " can comprise the genome that is naturally present in the organism of for example plant or the foreign source (heterologous) DNA that is introduced by transformation process, for example the fragment relevant to transformation event.Therefore, flanking DNA can comprise the combination of natural and foreign DNA.In the present invention, " flanking region " or " flanking sequence " or " genome border zone " or " genome border sequence " refer to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at the direct upstream or downstream of initial external source insertion DNA molecule and is adjacent to initial external source insertion DNA molecule.When this flanking region was positioned at downstream, it also can be called " left boundary flank " or " 3 ' flank " or " 3 ' genome border zone " or " genome 3 ' border sequence " etc. When the flanking region is located upstream, it may also be referred to as the "right border flank" or the "5' flank" or the "5' genomic border region" or the "genomic 5' border sequence" or the like.
[0067] Transformation procedures that cause random integration of exogenous DNA will result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are generally unchanged. Transformants will also contain unique junctions between segments of heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. "Junction" is the point where two specific DNA fragments connect. For example, a junction is present at the position where the insert DNA connects to the flanking DNA. Junctions are also present in transformed organisms where two DNA fragments are linked together in a manner modified from that found in natural organisms. "Junction DNA" refers to the DNA that comprises a junction.
[0068] The present invention provides a transgenic soybean event named LP689-1 and its progeny, wherein the transgenic soybean event LP689-1 is a soybean plant LP689-1, which includes plants and seeds of the transgenic soybean event LP689-1 and plant cells or regenerable parts thereof, and the plant parts of the transgenic soybean event LP689-1 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves and products from the soybean plant LP689-1, such as soybean meal, soybean flour, soybean oil, soybean pulp, soybean silk, soybean starch and biomass remaining in the soybean crop field.
[0069] The transgenic soybean event LP689-1 of the present invention comprises a DNA construct that, when expressed in plant cells, confers tolerance to 2,4-D, HPPD inhibitors, glufosinate, and glyphosate herbicides.
[0070] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes, the first expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence encoding AAD12 derived from Delftia acidovorans, the AAD12 protein having resistance to 2,4-D herbicides; the second expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence conferring resistance to para-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors, the HPPD having resistance to HPPD herbicides; the third expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence encoding a phosphinothricin acetyltransferase (PAT) protein, the nucleic acid sequence of the PAT protein having resistance to glufosinate herbicides. The fourth expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, wherein the promoter is operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), and the nucleic acid sequence of the EPSPS protein is tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including a constitutive, inducible and / or tissue-specific promoter, and the suitable promoter includes but is not limited to a cauliflower mosaic virus (CaMV) 35S promoter, a figwort mosaic virus (FMV) 35S promoter, an ubiquitin promoter, an actin promoter, an Agrobacterium tumefaciens promoter, a cytochrome c 647 ... Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes ( Agrobacterium rhizogenes )RolD promoter and Arabidopsis ( Arabidopsis thaliana ) Suc2 promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, polyadenylation signal sequences derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) polyadenylation signal sequence from the nopaline synthase (NOS) gene, the 35S terminator from the cauliflower mosaic virus (CaMV), the polyadenylation signal sequence from the proteinase inhibitor II (PIN II) gene, and the polyadenylation signal sequence from the α-tubulin gene.
[0071] In addition, the expression cassette may further comprise other genetic elements, including but not limited to enhancers and signal peptide / transit peptide nucleic acid coding sequences. The enhancers may enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transit peptide may direct the transport of AAD12, HPPD, PAT, or EPSPS proteins to specific organelles or compartments outside or within the cell, for example, by targeting the chloroplast using a chloroplast transit peptide sequence, or by targeting the endoplasmic reticulum using a 'KDEL' retention sequence.
[0072] The AAD12 is derived from Delftia acidovorans, HPPD is derived from 4-hydroxyphenylpyruvate dioxygenase, PAT is derived from Streptomyces viridis, and the 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene is derived from Agrobacterium tumefaciens and can be modified by optimizing codons or other methods. aad12、hppd、pat and epsps The nucleic acid sequence of the gene is modified to increase the stability and availability of the transcript in the transformed cells.
[0073] In some embodiments of the present invention, soybean cells, seeds or plants comprising transgenic soybean event LP689-1 sequentially comprise the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 504-11187 of SEQ ID NO: 5 and SEQ ID NO: 2 in their genome, or comprise the sequence of SEQ ID NO: 5.
[0074] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with a "glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. The selection of a specific glyphosate formulation rate to achieve a biologically effective dose is within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from transgenic soybean event LP689-1 with any glyphosate-containing herbicide formulation will control weed growth in the field without affecting the growth or yield of the plant material derived from transgenic soybean event LP689-1.
[0075] The DNA construct is introduced into the plant using a transformation method including, but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.
[0076] Agrobacterium-mediated transformation is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right consensus border sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissue, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.
[0077] The gene gun transformation method is to bombard plant cells with vectors containing foreign DNA (particle-mediated biolistic transformation).
[0078] The pollen tube channel transformation method utilizes the natural pollen tube channel (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac through the nucellus channel.
[0079] Following transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny harboring the foreign DNA selected using appropriate markers.
[0080] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct specifically can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and contained restriction endonuclease sites are used to import the DNA molecule that functional gene element is provided, i.e. promoter, intron, leader sequence, coding sequence, 3 ' terminator region and other sequences.Expression cassette contained in the DNA construct comprises the necessary gene element that messenger RNA is transcribed, and described expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.Expression cassette of the present invention is designed to express in plant cell the most specifically.
[0081] A transgenic "event" is obtained by transforming plant cells with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, transgenically inserted into the plant genome to produce a plant population, regenerate the plant population, and select for specific plants characterized by the insertion at a specific genomic locus. The term "event" refers to the original transformant that contains the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexually crossing a transformant with individuals of another variety containing the heterologous DNA, wherein the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the hybrid, even after repeated backcrossing with the recurrent parent. The term "event" also refers to a DNA sequence from the original transformant that contains the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which is expected to be transferred to progeny produced by sexually crossing a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from selfing thereof) with a parental line that does not contain the inserted DNA, and which progeny receive the inserted DNA containing the gene of interest.
[0082] As used herein, "recombinant" refers to a form of DNA and / or protein and / or organism not normally found in nature and therefore produced by human intervention. Such human intervention can produce recombinant DNA molecules and / or recombinant plants. A "recombinant DNA molecule" is one obtained by artificially combining two otherwise separate sequence segments, for example, by chemical synthesis or manipulation of separate nucleic acid segments through genetic engineering techniques. Techniques for nucleic acid manipulation are well known.
[0083] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant whose genotype is altered by the presence of heterologous nucleic acid, including the original transgenic so altered and progeny individuals generated by sexual hybridization or asexual reproduction of the original transgenic. In the present invention, the term "transgenic" does not include alterations (chromosomal or extrachromosomal) of the genome by conventional plant breeding methods or naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0084] As used herein, "heterologous" means that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus, such a molecule is heterologous to the host cell and has been artificially introduced into the genome of the host cell.
[0085] Cultivation of a transgenic soybean event LP689-1 that is tolerant to 2,4-D herbicides, HPPD inhibitor herbicides, glufosinate ammonium, and glyphosate herbicides can be achieved by the following steps: first, sexually hybridizing a first parent soybean plant with a second parent soybean plant to produce a variety of first-generation progeny plants, wherein the first parent soybean plant is composed of soybean plants cultivated from the transgenic soybean event LP689-1 and its progeny, and the transgenic soybean event LP689-1 and its progeny are obtained by transformation using the expression cassette of the present invention that is tolerant to 2,4-D herbicides, HPPD inhibitor herbicides, glufosinate ammonium, and glyphosate herbicides, and the second parent soybean plant lacks tolerance to the above herbicides; and then selecting progeny plants that are tolerant to the above herbicides to cultivate soybean plants that are tolerant to the above four types of herbicides. These steps can further include backcrossing progeny plants that are tolerant to 2,4-D herbicides, HPPD inhibitor herbicides, glufosinate, and glyphosate with the second parent soybean plant or the third parent soybean plant, and then selecting the progeny by applying 2,4-D, HPPD inhibitor, glufosinate, and glyphosate herbicides or by identifying molecular markers associated with the traits (such as DNA molecules comprising the junction sites identified at the 5' and 3' ends of the insertion sequence in the transgenic soybean event LP689-1), thereby producing soybean plants that are tolerant to the above four types of herbicides.
[0086] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can produce offspring plants that are homozygous for both added exogenous genes. Backcrossing of the parent plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual propagation.
[0087] The term "probe" refers to an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme, may be conjugated. Such a probe is complementary to a strand of a target nucleic acid. In the present invention, the probe is complementary to a strand of genomic DNA from transgenic soybean event LP689-1, whether the genomic DNA is from transgenic soybean event LP689-1 or seeds, or from plants, seeds, or extracts thereof. The probes of the present invention include not only deoxyribonucleic acids (DNAs) or RNAs, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
[0088] The term "primer" refers to an isolated nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forming a hybrid between the primer and the target DNA strand, which is then extended along the target DNA strand by a polymerase (e.g., DNA polymerase). The primer pairs of the present invention relate to their use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.
[0089] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of sequences SEQ ID NOs: 1-7 can be used as primers and probes for detecting soybean event LP689-1 and can be easily designed by those skilled in the art using the sequences provided herein.
[0090] The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers specifically hybridize with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers of the present invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.
[0091] Primers and probes based on the flanking genomic DNA and insert sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from transgenic soybean event LP689-1 and determining the nucleic acid sequence of the DNA molecules. The DNA molecules contain the transgenic insert sequence and the soybean genomic flanking regions, and fragments of the DNA molecules can be used as primers or probes.
[0092] The nucleic acid probes and primers of the present invention hybridize to target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic soybean event LP689-1 in a sample. Nucleic acid molecules or fragments thereof are capable of specific hybridization to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specific hybridization to each other if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. As used herein, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are permissible as long as they do not completely prevent the two molecules from forming a duplex structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary that it possess sufficient complementarity in sequence to allow a stable duplex structure to form under the particular solvent and salt concentration employed.
[0093] As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to the complementary strand of a matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the wash step can be selected from about 2.0×SSC at 50°C for low stringency conditions to about 0.2×SSC at 50°C for high stringency conditions. In addition, the temperature in the wash step can be increased from room temperature, about 22°C, for low stringency conditions, to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be held constant while the other is varied. Specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under moderate stringency conditions, for example, at about 2.0×SSC and about 65° C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under high stringency conditions. In the present invention, a preferred marker nucleic acid molecule has the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or their complementary sequences, or any fragments thereof. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or its complement, or any fragment thereof. The sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify progeny of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radioactive labels, antibody-based labels, and chemiluminescent labels.
[0094] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, wherein the primers having a wild-type sequence corresponding to the target nucleic acid sequence (or its complementary sequence) are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.
[0095] The term "specifically binds to (a target sequence)" means that the probe or primer hybridizes only to the target sequence in a sample containing the target sequence under stringent hybridization conditions.
[0096] As used herein, "amplified DNA," "amplification product," or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a soybean plant was produced by sexual crosses containing the transgenic soybean event LP689-1 of the present invention, or whether a soybean sample collected from a field contains the transgenic soybean event LP689-1, or whether a soybean extract, such as meal, flour, or oil, contains the transgenic soybean event LP689-1, DNA extracted from the soybean plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA from the transgenic soybean event LP689-1. The primer pair comprises a first primer and a second primer. The amplicon has a length and sequence that is also diagnostic for the transgenic soybean event LP689-1. The amplicon can have a length ranging from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.
[0097] Alternatively, the primer pairs can be derived from flanking genomic sequences on either side of the insert DNA to produce an amplicon that includes the entire insert nucleic acid sequence. One of the primer pairs derived from a plant genomic sequence can be positioned at a distance from the insert DNA sequence that can range from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal DNA amplification reactions.
[0098] Nucleic acid amplification reactions can be performed by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22 kb of genomic DNA and 42 kb of phage DNA. These methods, as well as other DNA amplification methods in the art, can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event LP689-1 can be amplified by using the provided primer sequences on the genome of the transgenic soybean event LP689-1, and the PCR amplicons or cloned DNA are subjected to standard DNA sequencing after amplification.
[0099] DNA detection kits based on DNA amplification methods can contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide agarose gel-based detection methods or many methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers homologous or complementary to any portion of the soybean genomic region of sequence SEQ ID NO:3 or SEQ ID NO:4, and homologous or complementary to any portion of the transgenic insertion region of sequence SEQ ID NO:5 are provided by the present invention. In particular, the primer pairs identified as useful in DNA amplification methods are sequences SEQ ID NO:8 and SEQ ID NO:9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene / genomic region of transgenic soybean event LP689-1, wherein the amplicon includes the sequence SEQ ID NO:1. Other DNA molecules used as DNA primers can be selected from the sequence SEQ ID NO:5.
[0100] The amplicons generated by these methods can be detected using a variety of techniques. One method is GeneticBit Analysis, in which a DNA oligonucleotide strand is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. This oligonucleotide strand is immobilized in a microwell of a microplate, and after PCR amplification of the target region (using one primer within the insert sequence and one primer within the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide strand and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained using fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions were successful.
[0101] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence) and then incubated with DNA polymerase, ATP, sulfhydrylase, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the resulting light signal is measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.
[0102] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicon of the present invention. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer each is used in the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension will result in the insertion of ddNTPs. This insertion can be measured using a fluorescence instrument to measure its polarization change. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization and single-base extension reactions are successful.
[0103] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, and the method is detailed in the manufacturer's instructions. As a brief example, a FRET oligonucleotide probe is designed to span the binding sites of an inserted DNA sequence and the adjacent genomic flanking region. This FRET probe and PCR primers (one primer within the insert sequence and one primer in the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs.
[0104] Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching moieties on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, indicating that amplification and hybridization were successful.
[0105] Based on the principle of hybridization, suitable techniques for detecting plant material derived from transgenic soybean event LP689-1 can also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. In particular, suitable techniques include incubating the probe and sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe. For example, radiolabeled probes can be detected by exposure and development of X-ray film, or enzyme-labeled probes can be detected by color change caused by substrate conversion.
[0106] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) introduced the application of molecular markers in sequence detection. A brief description is as follows: a FRET oligonucleotide probe is designed that spans the insertion DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain a fluorescent moiety and a quenching moiety in close proximity. The FRET probe and PCR primers (one primer each is used in the insertion sequence and in the adjacent flanking genomic sequence) are cyclically reacted in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, the hybridization of the FRET probe and the target sequence causes the loss of the probe secondary structure, thereby separating the fluorescent moiety and the quenching moiety in space and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insertion / flanking sequence, indicating that the amplification and hybridization are successful.
[0107] Other described methods, such as microfluidics, provide methods and apparatus for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices comprising electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of the present invention.
[0108] DNA detection kits can be developed using the compositions of the present invention and methods described or known in the art of DNA detection. The kits are useful for identifying the presence of DNA from transgenic soybean event LP689-1 in a sample and for growing soybean plants containing DNA from transgenic soybean event LP689-1. The kits can contain DNA primers or probes that are homologous to or complementary to at least a portion of the sequence of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous to or complementary to DNA contained in transgenic genetic elements of the DNA. These DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.
[0109] Contained in the soybean genome and in Figure 1 The DNA constructs for the transgene insert and soybean genome junctions described in Table 1 comprise: the soybean LP689-1 flanking genomic region located at the 5' end of the transgene insert, a portion of the insert from the right border region (RB) of Agrobacterium tumefaciens, and a first expression cassette driven by the Arabidopsis thaliana ubiquitin gene promoter (pAtUbi10) operably linked to a gene encoding 2,4-D herbicide tolerance from Delftia acidovorans. aad12 (AAD12), operably linked to the 3'UTR sequence of the PT1 gene encoding a phosphate transporter from Medicago truncatula; the second expression cassette consists of the Arabidopsis thaliana histone gene H4 gene promoter (pPh4a748 ABBC), operably linked to the leader sequence of tobacco etch virus (5'tev), operably linked to the coding sequence of a transit peptide derivative (TPotp Y), operably linked to the gene for resistance to 4-hydroxyphenylpyruvate dioxygenase inhibitors (HPPD), and operably linked to the transcription terminator of nopaline synthase (tNos); the third expression cassette consists of the Arabidopsis thaliana cauliflower mosaic virus promoter (p35s), operably linked to the Arabidopsis thaliana glufosinate acetyltransferase (PAT), and operably linked to the cauliflower mosaic virus terminator (t35s); the fourth expression cassette consists of the elongation factor EF-1 from soybean The promoter of the Tsf1 gene of alpha (pGm17gTsf1) is operably linked to the Arabidopsis thaliana chloroplast transit peptide (AtCTP2), the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium tumefaciens strain CP4, and the 3'-terminator sequence of the non-transcribed sequence (tPsE9) from the ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene of pea. The transgene insert is derived from a portion of the left border region (LB) of Agrobacterium tumefaciens and a flanking genomic region (SEQ ID NO: 5) from soybean plant LP689-1 located 3' to the transgenic insert. In the DNA amplification method, the DNA molecule used as a primer can be any portion of the transgenic insert sequence from transgenic soybean event LP689-1 or any portion of the flanking soybean genomic DNA region from transgenic soybean event LP689-1.
[0110] The transgenic soybean event LP689-1 can be combined with other transgenic soybean varieties, such as soybeans tolerant to herbicides such as dicamba. Various combinations of these different transgenic events, when bred with the transgenic soybean event LP689-1 of the present invention, can provide improved hybrid transgenic soybean varieties tolerant to multiple herbicides. These varieties can exhibit superior characteristics, such as increased yield, compared to non-transgenic varieties and single-trait transgenic varieties.
[0111] The present invention provides a transgenic soybean event LP689-1, as well as nucleic acid sequences and methods for detecting soybean plants containing this event. The transgenic soybean event LP689-1 is tolerant to the phytotoxic effects of agricultural herbicides including 2,4-D, HPPD inhibitors, glufosinate, and glyphosate. The multi-trait soybean plants express AAD12, HPPD, PAT, and EPSPS proteins, providing tolerance to these four herbicide classes. BRIEF DESCRIPTION OF THE DRAWINGS
[0112] Figure 1 This is a schematic diagram of the structure of the binding site between the transgenic insertion sequence of the present invention and the soybean genome;
[0113] Figure 2 Schematic diagram of the structure of the recombinant expression vector pLP689-1 of the present invention;
[0114] Figure 3 This is the field spraying effect of transgenic soybean comprising transgenic soybean event LP689-1 of the present invention on 4 times the dose of target herbicide. DETAILED DESCRIPTION
[0115] The following is a detailed description of the transgenic soybean event LP689-1 and its detection method.
[0116] Example 1 Cloning and transformation
[0117] 1.1. Vector cloning
[0118] Standard gene cloning techniques were used to construct the recombinant expression vector pLP689-1 ( Figure 2 The vector pLP689-1 contains four tandem transgenic expression cassettes, the first of which is composed of the Arabidopsis thaliana ubiquitin gene promoter Ubi (pAtUbi10), operably linked to a gene encoding 2,4-D herbicide tolerance from Delftia acidovorans ( aad12), operably linked to the 3'UTR sequence of the PT1 gene encoding a phosphate transporter from Medicago truncatula; the second expression cassette consists of the Arabidopsis thaliana histone gene H4 gene promoter (pPh4a748 ABBC), operably linked to the leader sequence (5'tev) of tobacco etch virus, operably linked to the coding sequence of the transit peptide derivative (TPotp Y), and operably linked to the resistance gene to 4-hydroxyphenylpyruvate dioxygenase inhibitors ( hppd ) is operably linked to the transcriptional terminator (tNos) of nopaline synthase; the third expression cassette consists of the promoter (p35s) of Arabidopsis encoding cauliflower mosaic virus, operably linked to the promoter (tNos) of Arabidopsis encoding glufosinate acetyltransferase ( pat ) and is operably linked to the cauliflower mosaic virus terminator (t35s); the fourth expression cassette is composed of the promoter of the Tsf1 gene of the elongation factor EF-lalpha from soybean (pGm17gTsf1) operably linked to the Arabidopsis thaliana chloroplast transit peptide (AtCTP2), operably linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of the Agrobacterium CP4 strain, and operably linked to the 3' non-transcribed sequence terminator (tPsE9) from the pea ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene. The vector pLP689-1 was transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No: 18313-015) using the liquid nitrogen method, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.
[0119] 1.2 Plant Transformation
[0120] Conventional Agrobacterium infection was used for transformation. Aseptically cultured soybean (soybean variety JACK) immature embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP689-1 into the soybean chromosome to produce a transgenic soybean event.
[0121] For Agrobacterium-mediated soybean transformation, briefly, immature embryos are isolated from soybeans and contacted with a suspension of Agrobacterium, which is able to transform aad12、hppd、 The nucleic acid sequence of the gene and epsps The nucleic acid sequence of the gene is transferred to at least one cell of one of the embryos (step 1: infection step), in which the embryo is immersed in a suspension of Agrobacterium (OD 660= 0.4-0.6, and inoculated with infection medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / L sucrose, 36 g / L glucose, 40 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) for initial inoculation. The immature embryos are co-cultivated with Agrobacterium for a period of three days (Step 2: Co-cultivation Step). Specifically, after the infection step, the immature embryos are cultured on solid medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH 5.8). This co-cultivation period can be followed by an optional "recovery" step. During the "recovery" step, the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L phytagel, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit Agrobacterium growth, and no selective agent for plant transformants is added (Step 3: Recovery Step). Specifically, immature embryos are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the inoculated immature embryos are cultured on medium containing the selective agent (N-(phosphonomethyl)glycine) to select for growing transformed callus (Step 4: Selection Step). Specifically, immature embryos are cultured on a selective solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8) containing a selective agent, resulting in the selective growth of transformed cells. Callus tissue is then regenerated into plants (step 5: regeneration step). Specifically, callus tissue grown on a medium containing a selective agent is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.
[0122] The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25°C to a height of about 10 cm, and then moved to a greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 28°C for 16 hours and then at 20°C for 8 hours each day.
[0123] 1.3 Identification and screening of transgenic events
[0124] A total of 1,500 independent transgenic T0 plants were generated. All T0 plants were subjected to molecular testing (including target gene copy number and insertion location), target trait (tolerance to four herbicides), and agronomic trait evaluation. Abnormal transformants were eliminated, and plants representing the transgenic soybean event LP689-1 were screened.
[0125] Furthermore, processed products can be produced from plants comprising transgenic soybean event LP689-1, and if sufficient expression is detected in the processed products, the processed products are expected to contain nucleic acid sequences diagnostic for the presence of transgenic soybean event LP689-1 material in the processed products. Such processed products include, but are not limited to, soybean meal, soybean oil, soybean protein, soybean products, grains, feed or industrial products or commodities, and any other food products to be consumed by animals as a food source, or to be used in the food industry as a component of soybean oil or stearic acid.
[0126] Example 2 Detection of transgenic soybean event LP689-1 using TaqMan
[0127] About 100 mg of leaves from transgenic soybean event LP689-1 were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The Taqman probe fluorescence quantitative PCR method was used to detect the aad12 、 hppd 、 pat and epsps The copy number of the gene was determined. Wild-type soybean plants (non-transgenic, transgenic recipients) were used as controls and the assays were performed according to the above method. The experiment was repeated three times and the average value was taken.
[0128] The specific method is as follows:
[0129] Step 11: 100 mg of leaves from the transgenic soybean event LP689-1 were taken and ground into a homogenate using liquid nitrogen in a mortar. Three replicates were taken for each sample.
[0130] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual.
[0131] Step 13: Determine the genomic DNA concentration of the sample using NanoDrop 2000 (Thermo Scientific);
[0132] Step 14: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μl;
[0133] Step 15: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. The sample with known copy number was used as the standard, and the sample of wild-type soybean plant (non-transgenic, transformed recipient) was used as the control. Each sample was repeated three times, and the average value was taken. The fluorescence quantitative PCR primer and probe sequences were:
[0134] The following primers and probes were used to detect aad12 Gene sequence:
[0135] Primer 1: CACCTTGCCACACTTGACGAT, as shown in SEQ ID NO: 16 in the sequence listing;
[0136] Primer 2: TGTTGAAGCCAGGCTGCAT, as shown in SEQ ID NO: 17 in the sequence listing;
[0137] Probe 1: TGGTTTCGCTGCCC, as shown in SEQ ID NO: 18 in the sequence listing;
[0138] The following primers and probes were used to detect hppd Gene sequence:
[0139] Primer 3: CCGTGGAAGGCGACAAAC, as shown in SEQ ID NO: 19 in the sequence listing;
[0140] Primer 4: GAACACCGGGCCCATCA, as shown in SEQ ID NO: 20 in the sequence listing;
[0141] Probe 2: CCTGCTGCTGCAGATCTTCTCGGAA, as shown in SEQ ID NO: 21 in the sequence listing;
[0142] The following primers and probes were used to detect pat Gene sequence:
[0143] Primer 5: CCGCGGTTTGTGATATCGTT, as shown in SEQ ID NO: 22 in the sequence listing;
[0144] Primer 6: TCTTGCAACCTCTCTAGATCATCAA, as shown in SEQ ID NO: 23 in the sequence listing;
[0145] Probe 3: TAGGACAGAGCCACAAACACCACAAGAGTG, as shown in SEQ ID NO: 24 in the sequence listing;
[0146] The following primers and probes were used to detect epsps Gene sequence:
[0147] Primer 7: GGTGTGCAGGTGAAGTCTGAAG, as shown in SEQ ID NO: 25 in the sequence listing;
[0148] Primer 8: TTGGCGTTGGAGTCTTTGGT, as shown in SEQ ID NO: 26 in the sequence listing;
[0149] Probe 4: CGGTGATCGTCTTCCAGTTACCTTGCG, as shown in SEQ ID NO: 27 in the sequence listing;
[0150] The PCR reaction system is:
[0151] JumpStart TM Taq ReadyMix TM (Sigma) 10 μL;
[0152] 50× primer / probe mixture 1 μL;
[0153] 3 μL of genomic DNA;
[0154] Water (ddH2O) 6 μL;
[0155] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in amber tubes at 4°C.
[0156] PCR reaction conditions are:
[0157] Step Temperature Time
[0158] 21 95℃ 5min;
[0159] 22 95℃ 30s;
[0160] 23 60℃ 1min;
[0161] 24 Return to step 22 and repeat 40 times.
[0162] The data were analyzed using SDS2.3 software (Applied Biosystems), and a single-copy transgenic soybean event LP689-1 was obtained.
[0163] Example 3 Detection of Transgenic Soybean Event LP689-1
[0164] 3.1 Genomic DNA Extraction
[0165] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic soybean event LP689-1 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)], adjust the pH to 8.0 with NaOH, mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000 rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 1 volume of isopropanol, gently shake the centrifuge tube, and let it stand at -20°C for 30 minutes; centrifuge at 12000 rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 0.5 mL of 70% ethanol; centrifuge at 12000 rpm for 5 minutes; vacuum dry or blow dry in a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.
[0166] 3.2 Analysis of flanking DNA sequences
[0167] The concentration of the DNA sample extracted above was measured to make the concentration of the sample to be tested between 80-100 ng / μL. Spe I. Pst I. Bss HII (5' end analysis) and Sac I. Kpn I. Xma I. NheI (3' end analysis) digested the genomic DNA separately. Add 26.5 μL of genomic DNA, 0.5 μL of the restriction endonuclease selected above, and 3 μL of digestion buffer to each digestion system, and digest for 1 hour at an appropriate temperature. After the digestion is completed, add 70 μL of anhydrous ethanol to the digestion system, ice bath for 30 minutes, centrifuge at 12000 rpm for 7 minutes, discard the supernatant, blow dry, then add 8.5 μL of double distilled water (ddH2O), 1 μL of 10×T4 Buffer, and 0.5 μL of T4 ligase and connect at 4°C overnight. PCR amplification is performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA includes sequences SEQ ID NO: 13 and SEQ ID NO: 34 as first primers, sequences SEQ ID NO: 35 and SEQ ID NO: 36 as second primers, and sequence SEQ ID NO: 13 as a sequencing primer. The primer combination for isolating 3' transgene / genomic DNA includes sequences of SEQ ID NO: 15 and SEQ ID NO: 37 as first primers, sequences of SEQ ID NO: 38 and SEQ ID NO: 39 as second primers, and sequence of SEQ ID NO: 15 as sequencing primer. The PCR reaction conditions are shown in Table 3.
[0168] The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate the PCR products, and the target fragments were subsequently isolated from the agarose matrix using a QIAquickGel extraction kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed.
[0169] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:8 or SEQ ID NO:12, or in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:11 or SEQ ID NO:14, or in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking and junction sequences.
[0170] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of soybean plants or seeds derived from transgenic soybean event LP689-1.
[0171] The soybean genomic sequence is found at nucleotides 1-503 of SEQ ID NO:5, flanking the right border of the insertion sequence of transgenic soybean event LP689-1 (the 5' flanking sequence), and the soybean genomic sequence is found at nucleotides 11188-11885 of SEQ ID NO:5, flanking the left border of the insertion sequence of transgenic soybean event LP689-1 (the 3' flanking sequence). The 5' junction sequence is listed in SEQ ID NO:1, and the 3' junction sequence is listed in SEQ ID NO:2.
[0172] 3.3. PCR zygosity determination
[0173] Junction sequences are relatively short polynucleotide molecules that are novel DNA sequences that, when detected in a polynucleotide detection assay, are diagnostic for transgenic soybean event LP689-1 DNA. The binding sequence of SEQ ID NO:1 consists of 11 bp on either side of the T-DNA RB region insertion site and the soybean genomic DNA insertion site of transgenic soybean event LP689-1. The binding sequence of SEQ ID NO:2 consists of 11 bp on either side of the T-DNA LB region insertion site and the soybean genomic DNA insertion site of transgenic soybean event LP689-1. Longer or shorter polynucleotide junction sequences can be selected from sequences of SEQ ID NO:3 or SEQ ID NO:4. Junction sequences (5' junction region sequence SEQ ID NO:1 and 3' junction region sequence SEQ ID NO:2) are useful as DNA probes or primers in DNA detection methods. Junction sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences in transgenic soybean event LP689-1 and can also be used as DNA probes or primers to detect the presence of transgenic soybean event LP689-1 DNA. The sequence SEQ ID NO:6 (nucleotides 504-1120 of SEQ ID NO:3) spans the LP689 construct DNA sequence and the pAtUbil0 transcription promoter sequence, and the sequence SEQ ID NO:7 (nucleotides 1-307 of SEQ ID NO:4) spans the tPsE9 transcription termination sequence and the LP689 construct DNA sequence.
[0174] Additionally, amplicons were generated by using primers derived from at least one of the sequences of SEQ ID NO: 3 or SEQ ID NO: 4, which when used in a PCR method produced an amplicon diagnostic for transgenic soybean event LP689-1.
[0175] Specifically, a PCR product was generated from the 5' end of the transgenic insert sequence, which PCR product was a portion of genomic DNA flanking the 5' end of the T-DNA insert sequence from the genome of plant material derived from transgenic soybean event LP689-1. This PCR product comprises SEQ ID NO: 3. For PCR amplification, primer 11 (SEQ ID NO: 8) was designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 12 (SEQ ID NO: 9) was paired with primer 11, which is located in the transcriptional promoter sequence of the transgenic pAtUbil0.
[0176] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product included a portion of genomic DNA from plant material of transgenic soybean event LP689-1 flanking the 3' end of the T-DNA insert sequence. This PCR product included the sequence SEQ ID NO: 4. For PCR amplification, primer 14 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insert sequence. Primer 13 (SEQ ID NO: 10) was paired with primer 14 to hybridize to the tNos transcriptional terminator sequence located at the 3' end of the insert sequence.
[0177] The DNA amplification conditions described in Tables 3 and 4 can be used in the above-described PCR zygosity assay to generate diagnostic amplicons for transgenic soybean event LP689-1. Detection of the amplicons can be performed using a Stratagene Robocycle, MJEngine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler, or other methods and equipment known to those skilled in the art.
[0178] Table 3 5' transgenic insert / genomic junction region for transgenic soybean event LP689-1
[0179] Identified PCR steps and reaction mixture conditions
[0180]
[0181] Table 4 Perkin-Elmer 9700 Thermal Cycler Conditions
[0182]
[0183] Mix gently and add 1-2 drops of mineral oil over each reaction mixture if there is no insulating cap on the thermal cycler. PCR was performed using the above cycling parameters (Table 4) on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.
[0184] The experimental results showed that: primers 11 and 12 (sequence SEQ ID NO: 8 and 9), when used in the PCR reaction of the transgenic soybean event LP689-1 genomic DNA, produced an amplification product of a 1120bp fragment, when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP689-1 soybean genomic DNA, no fragment was amplified; primers 13 and 14 (sequence SEQ ID NO: 10 and 11), when used in the PCR reaction of the transgenic soybean event LP689-1 genomic DNA, produced an amplification product of a 1005bp fragment, when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP689-1 soybean genomic DNA, no fragment was amplified.
[0185] PCR zygosity assays can also be used to identify whether material derived from transgenic soybean event LP689-1 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13), and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14), and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon for transgenic soybean event LP689-1. The DNA amplification conditions described in Tables 5 and 6 can be used in the above zygosity assays to generate a diagnostic amplicon for transgenic soybean event LP689-1.
[0186] Table 5 Zygosity assay reaction solution
[0187]
[0188] Table 6 Zygosity determination conditions of Perkin-Elmer 9700 thermal cycler
[0189]
[0190] PCR was performed using the above cycling parameters (Table 6) on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.
[0191] In the amplification reaction, the biological sample containing template DNA contains DNA diagnostic for the presence of transgenic soybean event LP689-1 in the sample. Alternatively, the reaction will produce two distinct DNA amplicons from a biological sample containing DNA derived from a soybean genome that is heterozygous for the allele corresponding to the inserted DNA present in transgenic soybean event LP689-1. These two distinct amplicons will correspond to a first amplicon derived from a wild-type soybean genomic locus and a second amplicon diagnostic for the presence of transgenic soybean event LP689-1 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnostic for the presence of transgenic soybean event LP689-1 in the sample, and the sample is produced from soybean seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic soybean plant LP689-1.
[0192] It should be noted that primer pairs specific to transgenic soybean event LP689-1 were used to generate amplicons diagnostic for genomic DNA from transgenic soybean event LP689-1. These primer pairs, including but not limited to primers 11 and 12 (SEQ ID NOs: 8 and 9), and primers 13 and 14 (SEQ ID NOs: 10 and 11), were used in the described DNA amplification method. Additionally, control primers 9 and 10 (SEQ ID NOs: 28 and 29), used to amplify endogenous soybean genes, were included as an internal standard for reaction conditions. Analysis of transgenic soybean event LP689-1 DNA extracts should include a positive control DNA extract from transgenic soybean event LP689-1, a negative control DNA extract from a non-transgenic soybean event LP689-1, and a negative control containing no template soybean DNA. In addition to these primer pairs, any primer pair derived from the sequence of SEQ ID NO: 3 or the sequence of SEQ ID NO: 4, or their complements, which, when used in a DNA amplification reaction, produce an amplicon comprising the sequence of SEQ ID NO: 1 or the sequence of SEQ ID NO: 2, respectively, that is diagnostic for tissue derived from transgenic soybean event LP689-1, can also be used. The DNA amplification conditions described in Tables 4-6 can be used to generate diagnostic amplicons for transgenic soybean event LP689-1 using appropriate primer pairs. Extracts presumed to contain soybean plant or seed DNA comprising transgenic soybean event LP689-1, or products derived from transgenic soybean event LP689-1, that produce amplicons diagnostic for transgenic soybean event LP689-1 when tested in a DNA amplification method can be used as templates for amplification to determine the presence of transgenic soybean event LP689-1.
[0193] Example 4 Detection of Transgenic Soybean Event LP689-1 by Southern Blot Hybridization
[0194] 4.1 DNA Extraction for Southern Blot Hybridization
[0195] Southern blot analysis was performed using homozygous transformation events from the T4 and T5 generations. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). The supernatant was discarded and the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37°C for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently by inversion, and centrifuge at 4000rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000rpm for 5 minutes to precipitate DNA after adding 0.54 volume isopropanol. Discard the supernatant and resuspend the DNA pellet in 500μL TE. In order to degrade any RNA present, at 37°C, DNA and 1μL 30mg / mL RNAaseA were incubated for 30 minutes, centrifuged at 4000rpm for 5 minutes, and in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, precipitate the DNA by centrifugation at 14000rpm for 10 minutes. After discarding the supernatant, wash the pellet with 500μL of 70% ethanol by mass and resuspend it in 100μL TE after drying.
[0196] 4.2 Restriction enzyme digestion
[0197] Quantify the DNA concentration using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). Digest 5 μg of DNA each time in a 100 μL reaction system. Sac I and Avi II digested the genomic DNA separately, and T-DNA was used to aad12 and hppd The partial sequence of Sac I and Avi The genomic DNA was digested separately using the partial sequences of PAT and EPSPS on the T-DNA as probes. The digests were incubated overnight at an appropriate temperature for each enzyme. The samples were spun down using a speed vacuum to reduce the volume to 30 μL.
[0198] 4.3 Gel Electrophoresis
[0199] Bromophenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.
[0200] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. In 0.4M NaOH, pre-wet 1 thin blotting paper and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on the top of the gel and fill the buffer tray with 0.4M NaOH. Connect the gel stack and buffer tray with a wick pre-soaked in 0.4M NaOH and transfer the DNA to the membrane. Carry out DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.
[0201] 4.4 Hybridization
[0202] Use PCR to amplify a suitable DNA sequence for probe preparation. The DNA probe is the sequence SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, or is partially homologous or complementary to the above sequences. Boil 25ng of probe DNA in 45μL TE for 5 minutes, place on ice for 7 minutes, and then transfer to a Rediprime II (AmershamPharmacia Biotech, #RPN1633) test tube. After adding 5μl 32P-labeled dCTP to the Rediprime test tube, incubate the probe at 37°C for 15 minutes. Purify the probe by centrifugation through a microcentrifuge G-50 column (AmershamPharmaciaBiotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity is measured using a scintillation counter. Prehybridize the Hybond membrane by wetting it with 20 mL of pre-warmed Church's prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. Boil the labeled probe for 5 minutes and place on ice for 10 minutes. Add an appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) to the prehybridization buffer and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 mL of Church's wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 mL of Church's wash solution 1 at 65°C for 20 minutes. Repeat this process twice with Church's wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect probe binding sites.
[0203] Two control samples were included on each Southern run: (1) DNA from a negative (untransformed) segregant, which was used to identify any endogenous soybean sequences that hybridized to the element-specific probe; and (2) DNA from a positive segregant, in which the Hin The amount of dIII-digested pLP689 was equivalent to one copy number based on the probe length to illustrate the sensitivity of the assay in detecting a single gene copy within the soybean genome.
[0204] Hybridization data provide conclusive evidence supporting TaqMan TM PCR analysis showed that soybean plant LP689-1 contained aad12、hppd、pat and epsps Using the AAD12 probe, Sac I and Avi II and Mfe I digestion produced single bands of approximately 15.025 kb and 12.642 kb, respectively; using HPPD probe, Sac I and Avi II enzyme digestion produced single bands of approximately 15.025 kb and 12.642 kb, respectively; using PAT probe, Sac I and Avi II enzyme digestion produced single bands of approximately 20.857 kb and 12.642 kb, respectively; using this EPSPS probe, Sac I and Avi II digestion produced single bands of approximately 20.857 kb and 12.642 kb, respectively. aad12、hppd、pat and epsps One copy of each is present in soybean transformation event LP689-1.
[0205] Example 5 Herbicide tolerance testing
[0206] 5.1. 2,4-D herbicides
[0207] This example uses Jintaihe 2,4-D dimethylamine salt herbicide for spraying. A randomized block design was used with 3 replicates. 20m 2 340 seedlings were planted in plots (5m×4m), with conventional cultivation management and a 1m wide isolation zone between plots. The transgenic LP689-1 soybean and the non-transgenic variety (transformation recipient control, CK) were subjected to the following two treatments:
[0208] 1) Spray with clean water;
[0209] 2) 2,4-D dimethylamine herbicide was sprayed at the third leaf stage (V3) at a dose of 756 g.ai / ha (recommended dose) and 3024 g.ai / ha (four times the recommended dose). Roundup herbicide was then sprayed again at the eighth leaf stage (V8) at the same dose. It should be noted that the following conclusions apply when 2,4-D dimethylamine herbicide at different concentrations and formulations is converted to an equivalent amount of 2,4-D dimethylamine. Injury symptoms were observed one and two weeks after application, and plot yields were measured at harvest.
[0210] The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of transgenic plants. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the damage rate of 2,4-D dimethylamine salt, which is determined based on the results of the phytotoxicity survey 2 weeks after 2,4-D dimethylamine salt treatment. The soybean yield of each plot is the total yield (weight) of soybean grains in the middle 3 rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, and the yield percentage (%) = spraying yield / non-spraying yield. The results of the transgenic soybean event LP689-1's tolerance to 2,4-D dimethylamine salt herbicide and the soybean yield results are shown as follows: Figure 3 , as shown in Table 7.
[0211] Table 7 Results of 2,4-D herbicide tolerance and soybean yield of transgenic soybean event LP689-1
[0212]
[0213] 5.2 HPPD inhibitor herbicides
[0214] In this example, BASF's herbicide (30 wt% benzylpyridamole) was used for spraying. A randomized block design was used with 3 replicates. 2 340 seedlings were planted in plots (5m x 4m) with conventional cultivation and management, with 1m wide isolation strips between plots. Transgenic LP689-1 soybeans and a non-transgenic variety (transformation recipient control, CK) were subjected to the following two treatments:
[0215] 1) Spray with clean water;
[0216] 2) Baowei herbicide was sprayed at the V3 leaf stage at 25 g / ha (recommended dose) and 100 g / ha (four times the recommended dose). Roundup herbicide was then sprayed again at the V8 leaf stage at the same dose. It should be noted that the following conclusions are based on the conversion of different Baowei herbicide dosages and formulations to equivalent amounts of fenpyrazone. Injury symptoms were observed one and two weeks after application, and plot yields were measured at harvest.
[0217] The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of transgenic plants. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the bract damage rate, which is determined based on the results of the pesticide damage survey 2 weeks after the bract treatment. The soybean yield of each plot is the total yield (weight) of soybean grains in the middle 3 rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, and the yield percentage (%) = spraying yield / non-spraying yield. The results of the transgenic soybean event LP689-1's tolerance to bract herbicides and the soybean yield results are shown in the figure. Figure 3 , as shown in Table 8.
[0218] Table 8 Transgenic soybean event LP689-1 tolerance to herbicides and soybean yield results
[0219]
[0220] 5.3 Glufosinate herbicide
[0221] This experiment selected the herbicide Glufosinate-ammonium for spraying. A randomized block design was used with 3 replicates. The plot area was 20m 2 (5m×4m), 340 seedlings were planted, and conventional cultivation and management were carried out. There was a 1m wide isolation zone between the plots. The transgenic soybean event LP689-1 and the non-transgenic variety (transformation recipient control, CK) were subjected to the following two treatments:
[0222] 1) Spray with clean water;
[0223] 2) Roundup herbicide was sprayed at a dose of 1600 g·i. / ha (4 times the recommended dose) at the V3 leaf stage, followed by a second spray of Prostanol at the V8 stage. It should be noted that the following conclusions apply when glufosinate herbicide dosages and formulations are converted to equivalent amounts of glufosinate acid. Injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest.
[0224] The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of affected plants in the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the glufosinate damage rate, which is determined based on the results of the phytotoxicity survey two weeks after glufosinate treatment. The soybean yield of each plot is the total soybean yield (weight) of the three middle rows of each plot. The yield difference between different treatments is measured as a yield percentage, which is the yield percentage (%) = glufosinate spraying yield / water spraying yield. The results of the glufosinate herbicide tolerance and soybean yield of the transgenic soybean event LP689-1 are shown in the figure. Figure 3 and shown in Table 9.
[0225] Table 9 Results of glufosinate tolerance and soybean yield of transgenic soybean event LP689-1
[0226]
[0227] 5.4 Glyphosate herbicide
[0228] This experiment used Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) for spraying. A randomized block design was used with 3 replicates. The plot area was 20m 2 (5m×4m), 340 seedlings were planted, and conventional cultivation management was carried out. There was a 1m wide isolation zone between the plots. The transgenic soybean event LP689-1 and the transformed receptor control (CK-) were subjected to the following two treatments:
[0229] 1) Spray with clean water;
[0230] 2) Roundup herbicide was sprayed at a dose of 3360 g ae / ha (4 times the recommended dose) at the V3 leaf stage, followed by a second spray at the V8 stage at the same dose. It should be noted that the following conclusions apply when glyphosate herbicide dosages and formulations are converted to equivalent amounts of glyphosate acid. Pesticide injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. The grading criteria for phytotoxicity symptoms are shown in Table 10.
[0231] Table 10 Grading standard for phytotoxicity symptoms
[0232]
[0233] The herbicide damage rate was used as an evaluation metric to assess the herbicide tolerance of the transformation event. Specifically, herbicide damage rate (%) = ∑ (number of affected plants in the same class × number of classes) / (total number of plants × highest class) × 100. The herbicide damage rate refers to the glyphosate damage rate, which was determined based on the results of a two-week phytotoxicity survey. The soybean yield of each plot was calculated by weighing the total soybean yield (weight) of the three central rows of each plot. Yield differences between treatments were measured as yield percentages: Yield percentage (%) = sprayed yield / sprayed water yield × 100. The results of glyphosate herbicide tolerance and soybean yield for the transgenic soybean event LP689-1 are shown in the figure. Figure 3 and as shown in Table 11.
[0234] Table 11 Results of glyphosate herbicide tolerance and soybean yield of transgenic soybean event LP689-1
[0235]
[0236] The results showed that in terms of the damage rate of herbicides (2,4-D dimethylamine salt, glutathione, glufosinate and glyphosate): the damage rate of the transgenic soybean event LP689-1 was basically zero under the treatment of 2,4-D dimethylamine salt (3024 g.ai. / ha), glutathione (100 g.ai. / ha), glufosinate (1600 g ae. / ha) and glyphosate herbicide (3360 g ae / ha). Therefore, the transgenic soybean event LP689-1 has good tolerance to four herbicides.
[0237] In terms of yield: There was no significant difference in the yield of the transgenic soybean event LP689-1 when sprayed with water and sprayed with 4 times the recommended dose of the above four herbicides (2,4-D dimethylamine salt, baufoline, glufosinate and glyphosate). After spraying with 4 times the recommended dose of 2,4-D dimethylamine salt, baufoline, glufosinate and glyphosate herbicides, the yield of the transgenic soybean event LP689-1 did not decrease basically, which further shows that the transgenic soybean event LP689-1 has good tolerance to quadruple herbicides.
[0238] In summary, TaqMan TM The regenerated transgenic soybean plants were assayed (see Example 2) for the presence of aad12、hppd、pat and epsps Genes were identified and the copy number of lines tolerant to 2,4-D, bauhinia, glufosinate, and glyphosate herbicides was characterized. Based on the copy number of the target genes, herbicide tolerance, and agronomic performance (see Example 5), transgenic soybean event LP689-1 was selected as superior due to its single-copy transgene, quadruple herbicide tolerance (2,4-D, bauhinia, glufosinate, and glyphosate), and agronomic performance.
[0239] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A method for detecting the presence of DNA from transgenic soybean event LP689-1 in a sample, characterized in that: include: (1) contacting the sample to be tested with the DNA primer pair in a nucleic acid amplification reaction; (2) Performing nucleic acid amplification reaction; (3) Detecting the presence of amplification products; The amplification product contains the nucleic acid sequence shown in SEQ ID NO: 5, indicating the presence of DNA of the transgenic soybean event LP689-1 in the sample to be tested. Representative samples of seeds of the transgenic soybean event LP689-1 were deposited in the China Center for Type Culture Collection on April 13, 2025, with the deposit number CCTCC NO: P202509, and the classification name is soybean seed LP689-1 Glycine max L. LP689-1.
2. A method for detecting the presence of DNA from transgenic soybean event LP689-1 in a sample, characterized in that: include: (1) contacting the sample to be tested with the DNA probe; (2) hybridizing the sample to be tested with the DNA probe under stringent hybridization conditions; (3) detecting the hybridization between the sample to be detected and the probe; The sample to be tested contains the nucleic acid sequence shown in SEQ ID NO: 5, indicating that the DNA of the transgenic soybean event LP689-1 is present in the sample to be tested. A representative sample of seeds of the transgenic soybean event LP689-1 was deposited in the China Center for Type Culture Collection on April 13, 2025, with the deposit number CCTCC NO: P202509, and the classification name is soybean seed LP689-1 Glycine max L. LP689-1.
3. A method for protecting soybean plants from damage caused by herbicides, characterized in that Plant at least one transgenic soybean plant, a representative sample of seeds of the transgenic soybean plant has been deposited in the China Center for Type Culture Collection on April 13, 2025, with the deposit number CCTCC NO: P202509, and the classification name is soybean seed LP689-1 Glycine max L. LP689-1.
4. A method for controlling weeds in a field where soybean plants are grown, characterized in that The method comprises applying an effective dose of a 2,4-D or HPPD inhibitor or glufosinate or glyphosate herbicide to a field where at least one transgenic soybean plant is planted. A representative sample of seeds of the transgenic soybean plant was deposited in the China Center for Type Culture Collection on April 13, 2025, with the deposit number CCTCC NO: P202509 and the classification name of soybean seed LP689-1 Glycine max L.LP689-1.
Citation Information
Patent Citations
Transgenic soybean event JK1001-2 and detection method thereof
CN116656869A
Transgenic soybean event LP207-1 and detection method thereof
CN120350165A