A method for identifying ethylene-sensitive varieties or lines of pineapple
By designing specific primer sets for ethylene sensitivity identification of pineapples, the problems of long identification cycles and low accuracy in existing technologies have been solved, enabling rapid and accurate ethylene sensitivity identification and supporting pineapple breeding and management.
Patent Information
- Application Number
- CN202511114534.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-11
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2045-08-11
AI Technical Summary
Existing methods for identifying the ethylene sensitivity of pineapple varieties (lines) are time-consuming, have low accuracy, rely on field observation, consume a lot of manpower and resources, and lack support from molecular marker technology.
A specific primer set was designed, including three primer pairs. The ethylene sensitivity of pineapple was rapidly identified by PCR amplification and Sanger sequencing. Primer pairs 1, 2, and 3 were used to amplify and sequence specific sites in the pineapple genome, respectively.
It enables rapid and accurate identification of pineapple ethylene sensitivity, simplifies operational requirements, is suitable for application in grassroots laboratories, facilitates early screening of superior varieties, and improves pineapple yield and quality.
Smart Images
Figure CN120591461B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant molecular biology and pineapple breeding, specifically to a method for identifying ethylene-sensitive pineapple varieties (lines). Background Technology
[0002] Pineapple( Ananas Comosus Pineapple (L. Merr.) is an important economic crop in tropical and subtropical regions, with its fruit possessing high nutritional and economic value. Flowering is a crucial stage in the growth and development of pineapples, directly affecting fruit yield and quality. Ethylene, as an important plant hormone, plays a vital role in regulating pineapple flowering. Studies have shown that ethylene-sensitive pineapple varieties (lines) exhibit significantly improved flowering rate and uniformity after ethylene application, while ethylene-insensitive varieties (lines) show a weaker response to ethylene, with lower flowering rate and uniformity. Therefore, accurately identifying the ethylene sensitivity of pineapple varieties (lines) is of great significance for selecting superior varieties and improving pineapple flowering rate and yield.
[0003] Currently, the main method for identifying the ethylene sensitivity of pineapple varieties (lines) relies on observing flowering behavior after ethylene treatment in the field. This method is time-consuming, highly susceptible to environmental factors, has low accuracy, and requires significant manpower, resources, and time. Molecular marker technology provides an effective means for early identification of plant traits, but specific molecular markers and related identification methods for pineapple ethylene sensitivity have not yet been reported. Therefore, developing a rapid and accurate method for identifying pineapple ethylene sensitivity at the molecular level has significant application value. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of existing methods for identifying the ethylene sensitivity of pineapple varieties (lines), such as long cycle and low accuracy, and to provide a method for identifying ethylene-sensitive pineapples based on specific primer pairs. This method can quickly and accurately identify the ethylene sensitivity of pineapples, providing technical support for efficient breeding and production management of pineapples.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] The first aspect of this invention provides a specific primer set for identifying ethylene-sensitive pineapples, the specific primer set comprising 3 primer pairs:
[0007] Primer pair 1 includes forward primer F1 and reverse primer R1, the base sequence of F1 is shown in SEQ ID NO .1, and the base sequence of R1 is shown in SEQ ID NO .2;
[0008] Primer pair 2 includes forward primer F2 and reverse primer R2, the base sequence of F2 is shown in SEQ ID NO. 3, and the base sequence of R2 is shown in SEQ ID NO. 4;
[0009] Primer pair 3 includes forward primer F3 and reverse primer R3, the base sequence of F3 is shown in SEQ ID NO. 5, and the base sequence of R3 is shown in SEQ ID NO. 6;
[0010] A second aspect of the present invention provides a method for identifying ethylene-sensitive pineapples using the aforementioned specific primer set, comprising the following steps:
[0011] S1. Extract total genomic DNA from the pineapple germplasm materials to be tested;
[0012] S2. Using the DNA extracted from the sample to be tested in step S1 as an amplification template, and using the above two pairs of primers as amplification primers, perform PCR amplification to obtain PCR amplification products.
[0013] S3. Sequencing of PCR amplification products: The PCR amplification products of the two primer pairs were sequenced using Sanger first-generation conventional sequencing.
[0014] S4 If the pineapple material to be tested is an ethylene-sensitive pineapple variety or strain, the base sequence of the PCR amplification product of primer pair 1 is shown in SEQ ID NO. 7, the base sequence of the PCR amplification product of primer pair 2 is shown in SEQ ID NO. 8, and the base sequence of the PCR amplification product of primer pair 3 is shown in SEQ ID NO. 9.
[0015] Further, in step S2, the PCR amplification reaction system of 10 μL includes 1 μL template DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 2*Hieff Robust PCR Master Mix, and 3 μL sterile deionized water; the PCR amplification reaction program is as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 10 s; 55 ℃ annealing for 20 s; 68 ℃ extension for 2 s, 35 cycles, and a final extension at 68 ℃ for 5 min.
[0016] A third aspect of the present invention provides the application of the above-described specific primer set in the identification of ethylene-sensitive pineapples.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] (1) The specific primer set of the present invention is designed for the ethylene-sensitive site of pineapple, which is highly specific and can accurately distinguish between ethylene-sensitive and non-sensitive pineapples.
[0019] (2) The identification method is simple to operate and does not require complicated instruments and equipment, making it suitable for promotion and application in grassroots laboratories and production bases.
[0020] (3) Identification can be carried out during the seedling stage of pineapple, which provides a basis for early screening of superior varieties and reasonable application of ethylene to regulate flowering, and helps to improve the yield and quality of pineapple. Attached Figure Description
[0021] Figure 1 Materials for Tailong 4, Tailong 17, and Tailong 22 AcSOC1-2 A promoter amplification band approximately 1700 bp upstream of the gene transcription start site.
[0022] Figure 2 Electrophoresis results of amplification products from 15 pineapple samples using primers SEQ ID NO. 1 and SEQ ID NO. 2.
[0023] Figure 3 Electrophoresis results of amplification products from 15 pineapple samples using primers SEQ ID NO. 3 and SEQ ID NO. 4.
[0024] Figure 4 Electrophoresis results of amplification products from 15 pineapple samples using primers SEQ ID NO. 5 and SEQ ID NO. 6.
[0025] Figure 5 Field phenotypes of Tainon4 and Tainon17 after applying different concentrations of ethylene.
[0026] Figure 6 Sequence alignment of locus 1 in 23 pineapple samples.
[0027] Figure 7 Sequence alignment of loci 2 and loci 3 was performed on 23 pineapple samples.
[0028] Figure 8 Sequence alignment of loci 4 in 23 pineapple samples. Detailed Implementation
[0029] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0030] Explanation of the sequence list:
[0031] SEQ ID NO. 1:
[0032] 5’-AAACCACCTCAATCGACAGC-3’;
[0033] SEQ ID NO .2:
[0034] 5’-CTACAAAAGAGGAAGCGTTAAAA-3’;
[0035] SEQ ID NO .3:
[0036] 5’-AAGCCCCACCTTACCCC-3’;
[0037] SEQ ID NO .4:
[0038] 5’-CATTCCATTCCGGTTGAAGT-3’;
[0039] SEQ ID NO .5:
[0040] 5’-TGCTCCCTCTAGCTTGCAT-3’;
[0041] SEQ ID NO .6:
[0042] 5’-TTCTTCCGCCGCCGAC-3’;
[0043] SEQ ID NO .7:
[0044] 5-AAACCACCTCAATCGACAGCACCCTCCCCAACTAGAAAAACCATCCCCTGCGCCCGGTGTACAACCGCATCTCGTGCACCGCAATTTACCCCCCCCCCCCCTCATATATGGTTGGGGCTACAAAGTCTTTTCCTTTTTCTTTTTTAACGCTTCCTCTTTTGTAG-3’;
[0045] SEQ ID NO .8:
[0046] 5-AAGCCCCACCTTACCCCTATCAATTACTTTTTCTTTTTTTTCTTTTTTTTCTTTTTTTTTCTGTGTGTGTGTGTGTGTGTGTTGTGTTTGCTCAATTTTTTTTCTAAGTCACTACTTTCTTTTTCTCTTTACTTCAACCGGAATGGAATG-3’;
[0047] 6-SEQ ID NO. 9:
[0048] 5-TGCTCCCTCTAGCTTGCATATATATATTTGCTTCTGTACTCTATTATTATTATTATTATTATTATTATCATCTTCGGTTTAATTACAATTTAGTTTTTTTTCTCTCTTCGGCGTCGGCGGCGGAAGAA-3';
[0049] SEQ ID NO. 10:
[0050] 5'-TATTATTATTAT-3';
[0051] SEQ ID NO. 11:
[0052] 5'-CCGTGCAAATGTTTAATTAGGGA-3';
[0053] SEQ ID NO. 12:
[0054] 5'-CTCTATTCTCTTCATCTCCGTCT-3'.
[0055] Example 1: Field identification of ethylene sensitivity in 23 pineapple samples
[0056] A total of 23 pineapple materials were selected (Table 1). To evaluate the sensitivity of these 23 pineapple materials to ethylene, statistical tests on ethylene sensitivity were conducted by applying ethylene concentrations of 200 mg / L and 800 mg / L (Table 4). Based on field performance, the flowering rate and uniformity of the pineapple materials under ethylene treatments of 200 mg / L and 800 mg / L were compared: if the flowering rate and uniformity were both greater than 50% under the low concentration of ethylene (200 mg / L), and the flowering rate was greater than 80% and the uniformity was greater than 70% under the high concentration of ethylene (800 mg / L), the pineapple material was identified as an ethylene-sensitive variety (line); otherwise, it was identified as ethylene-insensitive. The results of the statistical tests on ethylene sensitivity are shown in Table 1.
[0057] Table 1. Statistical analysis of field ethylene sensitivity test results for 23 pineapple varieties.
[0058]
[0059] Example 2: Molecular identification of ethylene sensitivity in 23 pineapple samples
[0060] 1. Selection of experimental materials
[0061] A total of 23 pineapple samples from Example 1 were selected.
[0062] 2. InDel marker detection
[0063] 2.1 Extract total genomic DNA from the pineapple germplasm materials to be tested;
[0064] 2.2 The inventors of this invention have discovered that insensitive pineapples, compared to sensitive pineapples, exhibit... AcSOC1-2 There are four deleted base sequences in the promoter approximately 1700 bp upstream of the gene transcription start site. The first deletion corresponds to the 10666584~10666590 bp position on chromosome 8 of the pineapple reference genome F153, and the deleted base sequence is shown as 5'-CCCCCCC-3'. The second deletion corresponds to the 10667526~10667529 bp position on chromosome 8 of the pineapple reference genome F153, and the deleted base sequence is shown as 5'-CTTT-3'. The third deletion corresponds to the 10667544~10667550 bp position on chromosome 8 of the pineapple reference genome F153, and the deleted base sequence is shown as 5'-CTTTTTT-3'. The fourth deletion corresponds to the 10667901~106677912 bp position on chromosome 8 of the pineapple reference genome F153, and the deleted base sequence is shown as 5'-TATTATTATTAT-3' (SEQ ID NO. 10).
[0065] Using amplification AcSOC1-2 The full-length gene promoter was amplified by PCR using primer pairs (forward primer F: SEQ ID NO.11: 5'-CCGTGCAAATGTTTAATTAGGGA-3', reverse primer R: SEQ ID NO.12: 5'-CTCTATTCTCTTCATCTCCGTCT-3'), yielding... AcSOC1-2 The full-length gene promoter amplification product was used as a template to develop specific primer pairs targeting four deletions. Specific primer pairs 1 and 3 were designed based on the base sequences of the first and fourth deletions. For the second and third deletions, which are located close to each other, a single specific primer pair 2 was designed. The forward primer binds to the upstream region of the second and third deletions, while the reverse primer binds to the downstream region. Both deletions are "wrapped" within the amplification fragment between primer pairs 2.
[0066] Primer pair 1 includes forward primer F1 and reverse primer R1, the base sequence of F1 is shown in SEQ ID NO .1, and the base sequence of R1 is shown in SEQ ID NO .2;
[0067] Primer pair 2 includes forward primer F2 and reverse primer R2, the base sequence of F2 is shown in SEQ ID NO. 3, and the base sequence of R2 is shown in SEQ ID NO. 4;
[0068] Primer pair 3 includes forward primer F3 and reverse primer R3. The base sequence of F3 is shown in SEQ ID NO. 5, and the base sequence of R3 is shown in SEQ ID NO. 6.
[0069] Using the DNA extracted from the pineapple sample in step 2.1 as the amplification template, PCR amplification was performed using the two primer pairs mentioned above to obtain the PCR amplification products.
[0070] 2.3 PCR reaction system: The PCR amplification reaction system (10 μL) includes 1 μL template DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 2*Hieff Robust PCR Master Mix, and 3 μL sterile deionized water. The PCR amplification reaction program is as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 10 s; 55 ℃ annealing for 20 s; 68 ℃ extension for 2 s, 35 cycles, and a final extension at 68 ℃ for 5 min.
[0071] 2.4 The PCR products described above were sequenced using the Sanger first-generation sequencing method.
[0072] 3. Testimonial Results:
[0073] The sequencing results were analyzed, and 23 pineapple samples were identified. The results are shown in Tables 2 to 5.
[0074] Table 2 Sequencing results of 23 pineapple samples at locus 1
[0075]
[0076] Table 3 Sequencing results of 23 pineapple samples at locus 2
[0077]
[0078] Table 4. Sequencing results of 23 pineapple samples at locus 3.
[0079]
[0080] Table 5. Sequencing results of 23 pineapple samples at locus 4.
[0081]
[0082] The PCR products were sequenced and analyzed to identify 23 pineapple materials (Table 6). The specific primers provided in this invention were used to amplify and sequence the ethylene-sensitive pineapple gene fragment. Figure 2-4As shown, field phenotypic identification revealed 15 ethylene-insensitive varieties (lines) and 8 ethylene-sensitive varieties (lines); InDel molecular marker identification identified 12 ethylene-insensitive varieties (lines) and 11 ethylene-sensitive varieties (lines). Statistical results indicate that the molecular markers developed in this application showed a genotypic-to-field phenotypic match rate of over 85% in these litchi materials.
[0083] Table 6. Identification of Markers in 23 Pineapple Samples
[0084]
[0085] In summary, the specific primers provided in this application can identify the ethylene sensitivity of pineapples.
[0086] Specific embodiments have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.
Claims
1. A specific primer set for identifying ethylene-sensitive pineapples, characterized in that, The specific primer set consists of 3 primer pairs: Primer pair 1 consists of forward primer F1 and reverse primer R1. The base sequence of F1 is shown in SEQ ID NO. 1, and the base sequence of R1 is shown in SEQ ID NO.
2. Primer pair 2 consists of forward primer F2 and reverse primer R2. The base sequence of F2 is shown in SEQ ID NO. 3, and the base sequence of R2 is shown in SEQ ID NO.
4. Primer pair 3 consists of forward primer F3 and reverse primer R3. The base sequence of F3 is shown in SEQ ID NO. 5, and the base sequence of R3 is shown in SEQ ID NO.
6.
2. The method for identifying ethylene-sensitive pineapples using the specific primer set according to claim 1, characterized in that, Includes the following steps: S1. Extract total genomic DNA from the pineapple germplasm materials to be tested; S2. Using the DNA extracted in step S1 as the template for amplification, and using the three primer pairs described in claim 1 as amplification primer pairs, perform PCR amplification to obtain PCR amplification products. S3. Sequencing of PCR amplification products: The PCR amplification products of the three primer pairs were sequenced using Sanger first-generation conventional sequencing. S4 If the PCR amplification product of primer pair 1 has the base sequence shown in SEQ ID NO. 7, the PCR amplification product of primer pair 2 has the base sequence shown in SEQ ID NO. 8, and the PCR amplification product of primer pair 3 has the base sequence shown in SEQ ID NO. 9, then the pineapple material to be tested is an ethylene-sensitive pineapple variety or strain.
3. The method according to claim 2, characterized in that, In step S2, the PCR amplification reaction system of 10 μL includes 1 μL template DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 2*Hieff Robust PCR Master Mix, and 3 μL sterile deionized water. The PCR amplification reaction program is as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 10 s, 55 ℃ annealing for 20 s, 68 ℃ extension for 2 s, 35 cycles; 68 ℃ final extension for 5 min.
4. The application of the specific primer set according to claim 1 in the identification of ethylene-sensitive pineapples, characterized in that, If the PCR amplification product of primer pair 1 has the base sequence shown in SEQ ID NO. 7, the PCR amplification product of primer pair 2 has the base sequence shown in SEQ ID NO. 8, and the PCR amplification product of primer pair 3 has the base sequence shown in SEQ ID NO. 9, then the pineapple material to be tested is an ethylene-sensitive pineapple variety or strain.