Anti-IL27R antibodies and methods of use thereof

By developing antibodies that specifically bind to IL27RA and gp130, the problem of lack of treatment targeting IL27R in existing technologies has been solved, and effective treatment of inflammatory bowel disease and autoimmune diseases has been achieved.

CN120603847APending Publication Date: 2025-09-05PFIZER INC
View PDF 20 Cites 0 Cited by

Patent Information

Application Number
CN202380057465.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-06-30
Filing Date
2023-08-01
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

The existing technology lacks effective IL27R-targeted therapeutic approaches for treating inflammatory bowel diseases such as Crohn's disease and ulcerative colitis, as well as other autoimmune diseases.

Method used

Develop antibodies, including bispecific antibodies, that specifically bind to IL27RA and gp130 to modulate the IL-27 signaling pathway and inhibit excessive immune responses.

Benefits of technology

By inhibiting IL-27 signaling, it reduces inflammatory responses and provides effective treatment for diseases such as IBD, CD, multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity and type 2 diabetes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120603847A_ABST
    Figure CN120603847A_ABST
Patent Text Reader

Abstract

The present invention relates to antibodies that specifically bind to one or both of IL27RA and gp130. The present invention further relates to bispecific antibodies that specifically bind to IL27RA and gp130. The invention also relates to related molecules, such as nucleic acids encoding such antibodies or bispecific antibodies; a composition; and related methods, for example, methods for producing and purifying such antibodies and bispecific antibodies; and their use for diagnosis and therapy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Sequence Listing Reference

[0002] This application contains a sequence listing that has been submitted electronically in .xml format and is hereby incorporated by reference in its entirety. The .xml copy was created on June 30, 2023, is named PC072877 Sequence Listing ST26.xml, and is 72,523 bytes in size. Background Art

[0003] The present invention relates to antibodies that specifically bind to one or both of IL27RA and gp130. The present invention further relates to bispecific antibodies that specifically bind to IL27RA and gp130. The present invention also relates to related molecules, such as nucleic acids encoding such antibodies or bispecific antibodies; compositions; and related methods, such as methods for producing and purifying such antibodies and bispecific antibodies; and their use in diagnosis and therapy.

[0004] Inflammatory bowel disease (IBD), including Crohn's disease (Crohn's disease, CD) and ulcerative colitis (ulcerative colitis, UC), refers to a collection of idiopathic chronic inflammatory conditions of the intestine. Crohn's disease involves the ileum and colon, but it can usually affect any area of ​​the intestine discontinuously. Ulcerative colitis involves the rectum, part of the colon or the entire colon (pancolitis (pancolitis)) in an uninterrupted pattern. The pathogenesis of IBD is still unclear, but it is believed to be multifactorial, including genetic and environmental components, in which abnormal immune responses to commensal bacteria and / or food antigens can constitute a central part. Therefore, developing an efficient treatment method for regulating excessive immune response for patients is an important unmet need (Hazel K and O'Connor A.Emerging treatments for inflammatory bowel disease.Therapeutic Advances in Chronic Disease.2020, Vol. 11: 1-12).

[0005] Interleukin (IL)-27 is a heterodimeric cytokine in the IL-12 cytokine family. It is composed of two subunits: Epstein-Barr virus-induced gene 3 (EBi3) and IL-27p28. IL-27 exerts immunomodulatory effects after binding to its heterodimeric receptor, which contains the IL-27-selective subunit, IL27RA, and the subunit shared by multiple signaling receptors, glycoprotein 130 (gp130). Co-expression of the two receptor subunits has been demonstrated on T cells, monocytes, macrophages, dendritic cells, colonic epithelial cells, keratinocytes, and the like. The engagement of the two receptor subunits directly activates JAK1, JAK2, and Tyk2 kinases, and induces tyrosine phosphorylation of signal transducers and activators of transcription (STAT), which form homodimers or heterodimers and translocate to the cell nucleus to regulate gene expression. In addition to the Jak / STAT signaling pathway, IL-27 has also been reported to induce p38 MAPK, ERK, and Akt signaling in certain cellular contexts (Hunter CA and Kastelein R. Fifteen years of interleukin-27-discovery, advances and translation. Immunity. 2012 Dec 14; 37(6):960-969).

[0006] IL-27 has been implied as a candidate for IBD therapy in multiple studies. A genome-wide association study of early-onset IBD identified IL-27 within a susceptibility locus in a North American-European population. To support that conclusion, the authors also demonstrated that healthy individuals with two copies of the risk allele expressed significantly less IL-27 than individuals with two copies of the non-risk allele, and that IL-27 colon gene expression in samples obtained from individuals with early-onset CD and UC cases was significantly lower than in normal tissue. Imielinski M, Baldassano RN, and Griffiths A, et al. Common variants at five new loci associated with early-onset inflammatory bowel disease. Nat Genet. December 2009; 41 (12): 1335-1340. IL-27 polymorphism is also associated with IBD risk in Chinese and Korean populations. Wang Z, Wang L, Fan R, et al. Association of IL-27gene three polymorphisms with Crohn's diseasesusceptibility in a Chinese Han population. Int J Clin Exp Pathol. 2014;7(12):8952-8957 and Li CS, Zhang Q, Lee KJ, et al. Interleukin-27polymorphisms are associated with inflammatory bowel diseases in a Korean population. JGastroenterol Hepatol.2009;24(10):1692-1696.

[0007] IL-27 has been shown to ameliorate colitis in mouse models by attenuating induced colonic inflammation through IL-27 administration and direct promotion of intestinal epithelial barrier function via transcriptional activation of anti-inflammatory and antibacterial genes, and conversely, by more severe colitis in mice lacking IL-27Rα due to a genetic knockout. Hanson ML, Hixon JA, Li W, et al., Oral Delivery of IL-27Recombinant BacteriaAttenuates Immune Colitis in Mice. Gastroenterology 2014;146:210-221; Troy AE, Zaph C, Du Y, et al., IL-27Regulates Homeostasis of the Intestinal CD4_EffectorT Cell Pool and Limits Intestinal Inflammation in a Murine Model ofColitis.JI,2009,183:2037-2044; Diegelmann J, Olszak T and B, et al., cA Novel Role for Interleukin-27 (IL-27) as Mediator of Intestinal Epithelial Barrier Protection Mediated via Differential Signal Transducer and Activator of Transcription (STAT) Protein Signaling and Induction of Antibacterial and Anti-inflammatory Proteins. JBC. 2012, 287(1), pp. 286-298. More specifically, mucosal administration of the food-grade bacterium Lactococcus lactis (LL-IL-27) expressing IL-27 or subcutaneous treatment with IL-27 has been shown to protect mice from death in enterocolitis, as well as T cell transfer-induced colitis and 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis models. Hanson ML, Hixon JA and Li W, et al., Oral Delivery of IL-27Recombinant Bacteria Attenuates Immune Colitis in Mice. Gastroenterology2014;146:210-221; Sasaoka T, Ito M, Yamashita J, et al., Treatment with IL-27attenuates experimental colitis through the suppression of the development of IL-17-producing T helper cells. Am J Physiol Gastrointest Liver Physiol 2011,300:G568-G576; Andrews C, McLean MH, and Durum SK. IL-27 as a novel therapy for inflammatory bowel disease: a critical review of the literature. Inflamm BowelDis. 2016 Sep;22(9):2255-2264.

[0008] IL-27 has been implicated as a potential therapeutic for a variety of autoimmune conditions other than IBD, including asthma and allergic diseases. [11,12] Metabolic disorders such as obesity and type 2 diabetes would also be attractive therapeutic areas to consider, where IL-27 agonism could be beneficial.

[13]

[0009] There is a long-standing unmet need for novel therapies to treat or ameliorate IBD, including UC and CD, as well as to treat other autoimmune conditions. Although IL27R has been implicated as a target for treating IBD, including UC and CD, there are currently no effective therapies targeting IL27R. The present invention addresses this need. Summary of the Invention

[0010] Provided herein are antibodies (including antigen-binding fragments thereof) that bind to one or more of interleukin receptor subunit α (IL27RA) and glycoprotein 130 (gp130), including bispecific antibodies and other related antibodies that specifically bind to IL27RA and gp130, as well as uses of such antibodies and related methods.

[0011] The present invention also provides methods for making, preparing, and generating antibodies that bind to one or more of IL27RA and gp130, including bispecific antibodies that specifically bind to IL27RA and gp130. The antibodies of the present invention are useful for diagnosing, preventing, or treating one or more disorders or conditions mediated by or associated with IL27 activity, including but not limited to inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0012] The invention further encompasses the expression of antibodies, and the preparation and manufacture of compositions comprising the antibodies of the invention, such as pharmaceuticals using such antibodies.

[0013] Polynucleotides encode antibodies that bind to one or more of IL27RA and gp130, including bispecific antibodies that specifically bind to IL27RA and gp130. Polynucleotides encoding the heavy or light chains, or both, of the antibodies are also provided. Host cells expressing the antibodies are provided. Therapeutic methods using the antibodies are provided. Such methods include, but are not limited to, one or more methods for treating or preventing diseases associated with or mediated by IL27 expression and / or binding to the IL27 receptor. Diseases associated with or mediated by IL27 expression and / or binding to the IL27 receptor include inflammatory bowel disease (IBD), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0014] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO:7, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO:8.

[0015] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0016] In some embodiments, an isolated antibody is provided that comprises an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and comprises an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0017] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14. In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID: 14.

[0018] In some embodiments, an isolated antibody is provided that competes for binding to IL27RA with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 7 and a VL having the amino acid sequence of SEQ ID NO: 8.

[0019] In some embodiments, an isolated polynucleotide encoding the VH of an antibody that binds IL27RA is provided, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO 31.

[0020] In some embodiments, an isolated polynucleotide encoding the VL of an antibody that binds IL27RA is provided, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32.

[0021] In some embodiments, an isolated polynucleotide encoding the VH and VL of an antibody that binds IL27RA is provided, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 31 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 32.

[0022] In some embodiments, an isolated antibody that specifically binds to glycoprotein 130 (gp130) is provided, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22.

[0023] In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20.

[0024] In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24. In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 30 and a light chain having the amino acid sequence of SEQ ID NO: 24.

[0025] In some embodiments, an isolated antibody is provided that competes for binding to gp130 with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 21 and a VL having the amino acid sequence of SEQ ID NO: 22.

[0026] In some embodiments, an isolated polynucleotide encoding the VH of an antibody that binds gp130 is provided, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:35.

[0027] In some embodiments, an isolated polynucleotide encoding the VL of an antibody that binds gpl30 is provided, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:36.

[0028] In some embodiments, there is provided an isolated polynucleotide encoding the VH and VL of an antibody that binds gpl30, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO:35 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO:36.

[0029] In some embodiments, an isolated polynucleotide is provided that encodes the heavy chain, light chain, or both of an antibody that binds gpl30, and wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:37, the nucleic acid sequence of SEQ ID NO:38, or both.

[0030] In some embodiments, an isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds gpl30 is provided, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:40, the nucleic acid sequence of SEQ ID NO:38, or both.

[0031] In some embodiments, an isolated antibody is provided that comprises a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0032] a. the first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3; and

[0033] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6.

[0034] In some embodiments, an isolated antibody is provided that comprises a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0035] a. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0036] b. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0037] In some embodiments, an isolated antibody is provided that comprises a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein:

[0038] a. The first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3;

[0039] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6;

[0040] c. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0041] d. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0042] In some embodiments, an isolated antibody is provided that comprises a first antigen-binding site that binds IL27RA and a second antigen-binding site that binds gp130, wherein the antibody comprises a first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:7, a first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:8, a second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:21, and a second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:22.

[0043] In some embodiments, an antibody that binds to both IL27RA and gp130 is provided, comprising a first heavy chain and a first light chain, and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO:27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO:14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO:30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO:34. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the bispecific anti-IL27RA / gp130 antibody of the present invention. Fc heterodimerization is driven by mutations engineered in the CH3 domain.

[0046] Figure 2 The co-crystal structure of the parental anti-IL27RA clone 2255 Fab fragment in complex with human IL27RA extracellular domain recombinant protein can be Protein fractions were expressed in HEK293 cells.

[0047] Figure 3 The co-crystal structure of a humanized version (3754) of the parental anti-gp130 clone 2246 Fab fragment in complex with human gp130 extracellular domain recombinant protein can be Protein fractions were expressed in HEK293 cells.

[0048] Figure 4 demonstrated that IL-27R agonists had no effect on IFNγ production in Th1 cells after differentiation.

[0049] Figure 5 The anti-IL27RA / gp130 antibodies of the present invention increase the CD4+CD25+FoxP3+iTreg population and increase the surface expression of LAG-3 and TIM-3.

[0050] Figure 6 Schematic representation of a single Fc version of the IL27 ligand complex. CH23LS-Fc: human IgG1 Fc with mutations that stabilize the monomeric Fc; Flag: Flag tag; H6: His tag; p28(f29-p243)-C107-L212C: p28 subunit of the IL27 ligand, amino acid sequence F29 to P243 stabilized by mutations at C107 to S and L212 to C to allow disulfide bond formation between L212 of p28 and M99 of Ebi3; Ebi3(R21-K229)-M99C: Ebi3 subunit of the IL27 ligand, amino acids R21 to K229, with an M99 to C mutation to stabilize disulfide bond formation with L212C of the p28 subunit. CID1613 and 1617: construct numbers.

[0051] Figure 7 Schematic representation of the knob and hole versions of the IL27 ligand complex. huIgG1Fc "knob": human IgG1 Fc with a "knob" mutation; huIgG1Fc "hole": human IgG1 Fc with a "hole" mutation; Flag: Flag tag; H6: His tag; p28(f29-p243)-C107-L212C: p28 subunit of the IL27 ligand, amino acid sequence F29 to P243, with mutations at C107 to S and L212 to C stabilizing the disulfide bond between L212 of p28 and M99 of Ebi3; Ebi3(R21-K229)-M99C: Ebi3 subunit of the IL27 ligand, starting at amino acid R21 and ending at K229, with an M99 to C mutation stabilizing the disulfide bond with L212C of the p28 subunit. CID1353, 1643 and 1617: construct numbers.

[0052] Figure 8Octet competition assay sensorgrams of GBT-IL-27R-2255 versus IL-27 ligand for IL27RA were aligned at the end of the first association step (approximately 1059 seconds). The 1060-second sensorgram assessed whether GBT-IL-27R-2255 could bind to hIL27R-CH23Fc-Flag in the presence of hIL27:EBi3. (Middle line on the right panel) hIL27:EBi3 bound to hIL27R, and GBT-IL-27R-2255 showed no binding. This suggests that IL27Ra directs IgG GBT-IL-27R-2255 to compete with the IL-27 ligand for binding to IL27R. In this assay format, sensor C6 (upper line on the right panel) exhibits binding to GBT-IL-27R-2255 with only hIL27R on the sensor, without hIL27LEBi3. Sensor D6 (lower line on the right panel) is a buffer control. When immersed in buffer, sensor D6 did not overlap with B6, likely due to the dissociation of hIL27:EBi3 on sensor D6.

[0053] Figure 9 Schematic diagrams of two bispecific formats. Left: EE / RR format (GBT-IL27R-4894). Right: Knob-in-hole mFd format (GBT-IL27R-4933). IL-27RA and gp130-binding Fabs, along with their VH, VL, CH1, and CL components, are labeled. Features used for heterodimerization (E and R mutations or knob and hole) are indicated. DETAILED DESCRIPTION

[0054] The present invention may be more readily understood by reference to the following detailed description of embodiments of the invention and the Examples included therein. It should be understood that the present invention is not limited to a particular method of manufacture, which may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0055] Exemplary embodiments (E) of the present invention provided herein include:

[0056] E1. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8;

[0057] E2. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0058] E3. The antibody of E1 or E2, comprising an IL27RA-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77.

[0059] E4. The antibody as E1 or E2, which comprises an IL27RA-VH framework sequence derived from a human germline DP54 sequence.

[0060] E5. The antibody of any one of E1 to E4, comprising an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of: DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9.

[0061] E5. The antibody of any one of E1 to E4, comprising an IL27RA-VL framework sequence derived from a human germline DPK9 sequence.

[0062] E6. The antibody of any one of E1 to E5, comprising an IL27RA-VL framework sequence and an IL27RA-VH framework sequence, wherein one or both of the IL27RA-VL framework sequence and the IL27RA-VH framework sequence are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the human germline sequence from which they are derived.

[0063] E7. The antibody of any one of E1 to E6, comprising an IL27RA-VL framework sequence and an IL27RA-VH framework sequence, wherein one or both of the IL27RA-VL framework sequence or the IL27RA-VH framework sequence are identical to the human germline sequence from which they are derived.

[0064] E8. The antibody of any one of E1 to E7, comprising an IL27RA-VH sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 7, and comprising an IL27RA-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8.

[0065] E9. The antibody of any one of E1 to E8, comprising the IL27RA-VH sequence of SEQ ID NO: 7 and the IL27RA-VL sequence of SEQ ID NO: 8.

[0066] E10. The antibody of any one of E1 to E9, comprising an IL27RA-VH sequence encoded by the polynucleotide sequence of SEQ ID NO: 31.

[0067] E11. The antibody of any one of E1 to E10, comprising an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO 32.

[0068] E12 An isolated antibody comprising an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0069] E13. The antibody of any one of E1 to E12, further comprising an Fc domain, wherein the Fc domain is of the isotype of IgA (eg, IgA1 or IgA2), IgD, IgE, IgM, or IgG (eg, IgG1, IgG2, IgG3, or IgG4).

[0070] E14. The antibody of any one of E1 to E13, which comprises an Fc domain of the IgG isotype.

[0071] E15. The antibody of any one of E1 to E14, which comprises an Fc domain of the IgG1 isotype.

[0072] E16. The antibody of any one of E13 to E15, wherein the Fc domain has human IgG1 comprising one or more substitutions selected from the group consisting of L234A, L235A and G237A according to EU numbering (this group may also be referred to as L247A, L248A and G250A according to Kabat numbering), wherein the numbering is based on human IgG1 wild type.

[0073] E17. The antibody of E16, wherein the antibody comprises an Fc domain comprising substitutions L234A, L235A and G237A (by EU numbering) or L247A, L248A and G250A (by Kabat numbering), wherein the numbering is according to human IgG1 wild type.

[0074] E18. The antibody of any one of E1 to E17, wherein the antibody comprises an Fc domain comprising substitutions D221E and L368E (by EU numbering) or D234E and L381E (by Kabat numbering); wherein the numbering is according to human IgG1 wild type.

[0075] E19. The antibody of any one of E1 to E17, wherein the antibody comprises an Fc domain comprising substitutions D221R and K409R (by EU numbering) or D234R and K422R (by Kabat numbering), wherein the numbering is according to human IgG1 wild type.

[0076] E20. The antibody of any one of E1 to E19, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 27.

[0077] E21. The antibody of any one of E1 to E20, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13.

[0078] E22. The antibody of any one of E1 to E20, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 27.

[0079] E23. The antibody of any one of E1 to E22, which comprises a light chain having the amino acid sequence of SEQ ID NO: 14.

[0080] E24. The antibody of any one of E1 to E23, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14.

[0081] E25. The antibody of any one of E1 to E24, wherein the antibody antagonizes IL27RA.

[0082] E26. The antibody of any one of E1 to E25, wherein the antibody agonizes IL27RA.

[0083] E27. The antibody of any one of E1 to E25, wherein the antibody binds to cynomolgus IL27RA.

[0084] E28. The antibody of E1 to E27, wherein the KD of the antibody for binding to cynomolgus monkey IL27RA is within 10 orders of magnitude of the KD of the antibody for binding to human IL27RA as measured by SPR.

[0085] E29. An isolated antibody that competes for binding to IL27RA with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 7 and a VL having the amino acid sequence of SEQ ID NO: 8.

[0086] E30. A pharmaceutical composition comprising a therapeutically effective amount of the antibody of any one of E1 to E29 and a pharmaceutically acceptable carrier.

[0087] E31 An isolated polynucleotide encoding the antibody of any one of E1 to E29

[0088] E32. The polynucleotide of E31, wherein the polynucleotide is RNA.

[0089] E33. The polynucleotide of E32, wherein the polynucleotide comprises at least one chemical modification.

[0090] E34. The polynucleotide of E33, wherein the chemical modification is selected from pseudouridine, 1-methylpseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine.

[0091] E35. The polynucleotide of E31, wherein the polynucleotide does not comprise a chemical modification.

[0092] E35. An isolated polynucleotide encoding the VH of an antibody that binds IL27RA, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO 31.

[0093] E36. An isolated polynucleotide encoding the VL of an antibody that binds IL27RA, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32.

[0094] E37. An isolated polynucleotide encoding VH and VL of an antibody that binds IL27RA, wherein the polynucleotide encoding VH comprises the nucleic acid sequence of SEQ ID NO: 31 and the polynucleotide encoding VL comprises the nucleic acid sequence of SEQ ID NO: 32.

[0095] E38. An isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both.

[0096] E39. An isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 39, the nucleic acid sequence of SEQ ID NO: 34, or both.

[0097] E40. A vector comprising the polynucleotide of any one of E31 to E39.

[0098] E41. An isolated host cell comprising the polynucleotide of any one of E31 to E39 or the vector of E40.

[0099] E42. A method of producing an isolated antibody, comprising culturing a host cell such as E41 under conditions that result in production of the antibody and recovering the antibody.

[0100] E43. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30 for use as a medicament.

[0101] E44. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30, for use in treating an inflammatory disease.

[0102] E45. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30, for use in treating one or more selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0103] E46. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30, for use in treating inflammatory bowel disease (IBD).

[0104] E47. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30, for use according to E46, wherein the use is for treating Crohn's disease (CD) or ulcerative colitis (UC).

[0105] E48. A method of treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody according to any one of E1 to E29 or a pharmaceutical composition according to E30.

[0106] E49. The method of E48, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0107] E50. The method of E48, wherein the condition is an inflammatory disease.

[0108] E51. The method of E48, wherein the condition is inflammatory bowel disease (IBD).

[0109] E52. The method of any one of E48 to E51 or the use of E43 to E47, comprising subcutaneous administration of the antibody or pharmaceutical composition.

[0110] E53. The method of any one of E48 to E51 or the use of E43 to E47, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0111] E54. Use of an antibody as described in any one of E1 to E29 for the manufacture of a medicament for the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0112] E55. Use of the antibody of any one of E1 to E29 for the manufacture of a medicament for the treatment of an inflammatory disease.

[0113] E56. Use of the antibody of E54 or E55, wherein the condition is inflammatory bowel disease (IBD).

[0114] E57. An isolated antibody that specifically binds to glycoprotein 130 (gp130), comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22;

[0115] E58. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20.

[0116] E59 An antibody such as E57 or E58 comprising a gp130-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77

[0117] E60. The antibody of any one of E57 to E59, which comprises a gp130-VH framework sequence derived from a human germline DP10 sequence.

[0118] E61. The antibody of any one of E57 to E60, comprising a gp130-VL framework sequence derived from a human germline VL sequence selected from the group consisting of: DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9

[0119] E62. The antibody of any one of E57 to E61, which comprises a gp130-VL framework sequence derived from a human germline DPK9 sequence.

[0120] E63. The antibody of any one of E57 to E62, comprising a gp130-VL framework sequence and a gp130-VH framework sequence, wherein one or both of the gp130-VL framework sequence and the gp130-VH framework sequence are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the human germline sequence from which they are derived.

[0121] E64. The antibody of any one of E57 to E63, which comprises a gp130-VL framework sequence and a gp130-VH framework sequence, and wherein one or both of the gp130-VL framework sequence or the gp130-VH framework sequence are identical to the human germline sequence from which they are derived.

[0122] E65. The antibody of any one of E57 to E64, comprising a gp130-VH sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 21, and comprising a gp130-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 22.

[0123] E66. The antibody of any one of E57 to E65, which comprises the gp130-VH sequence of SEQ ID NO: 21 and the gp130-VL sequence of SEQ ID NO: 22.

[0124] E67. The antibody of any one of E57 to E66, which comprises the gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35.

[0125] E68. The antibody of any one of E57 to E67, which comprises the gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO 36.

[0126] E69 An antibody comprising a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36.

[0127] E70. The antibody of any one of E57 to E69, further comprising an Fc domain, wherein the Fc domain is of the isotype of IgA (eg, IgA1 or IgA2), IgD, IgE, IgM, or IgG (eg, IgG1, IgG2, IgG3, or IgG4).

[0128] E71. The antibody of E70, which comprises an Fc domain of the IgG isotype.

[0129] E72. The antibody of E70 or E71, which comprises an Fc domain of the IgG1 isotype.

[0130] E73. The antibody of E72, wherein the Fc domain is of human IgG1 comprising one or more substitutions selected from L234A, L235A and G237A (by EU numbering) or L247A, L248A and G250A (by Kabat numbering), wherein the numbering is according to human IgG1 wild type.

[0131] E74. The antibody of E73, wherein the antibody comprises substitutions L234A, L235A, G237A (by EU numbering) or L247A, L248A, G250A (by Kabat numbering), wherein the numbering is according to human IgG1 wild type.

[0132] E75. The antibody of any one of E57 to E74, wherein the Fc domain comprises substitutions D221E and L368E (by EU numbering) or D234E and L381E (by Kabat numbering); wherein the numbering is according to human IgG1 wild type.

[0133] E76. The antibody of any one of E57 to E74, wherein the Fc domain comprises substitutions D221R and K409R (by EU numbering) or D234R and K422R (by Kabat numbering), wherein the numbering is according to human IgG1 wild type.

[0134] E77. The antibody of any one of E57 to E76, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 30.

[0135] E78. The antibody of any one of E57 to E77, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 23.

[0136] E79. The antibody of any one of E57 to E77, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 30.

[0137] E80. The antibody of any one of E57 to E79, which comprises a light chain having the amino acid sequence of SEQ ID NO: 24.

[0138] E81. The antibody of any one of E57 to E80, which comprises a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24.

[0139] E82. The antibody of any one of E57 to E81, wherein the antibody antagonizes gp130.

[0140] E83. The antibody of any one of E57 to E82, wherein the antibody binds to cynomolgus monkey gpl30.

[0141] E84. The antibody of E57 to E83, wherein the KD for binding of the antibody to cynomolgus monkey gp130 is within 3 orders of magnitude of the KD for binding of the antibody to human gp130 as measured by SPR.

[0142] E85. An isolated antibody that competes for binding to gp130 with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 21 and a VL having the amino acid sequence of SEQ ID NO: 22.

[0143] E86. A pharmaceutical composition comprising a therapeutically effective amount of the antibody of any one of E57 to E85 and a pharmaceutically acceptable carrier.

[0144] E87. An isolated polynucleotide encoding the antibody of any one of E57 to E87.

[0145] E88. The polynucleotide of E87, wherein the polynucleotide is RNA.

[0146] E89. The polynucleotide of E88, wherein the polynucleotide comprises at least one chemical modification.

[0147] E90. The polynucleotide of E89, wherein the chemical modification is selected from pseudouridine, 1-methylpseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine.

[0148] E91. The polynucleotide of E87 or E88, wherein the polynucleotide does not comprise a chemical modification.

[0149] E92. An isolated polynucleotide encoding the VH of an antibody that binds gp130, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 35.

[0150] E93. An isolated polynucleotide encoding the VL of an antibody that binds gp130, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 36.

[0151] E94. An isolated polynucleotide encoding VH and VL of an antibody that binds gp130, wherein the polynucleotide encoding VH comprises the nucleic acid sequence of SEQ ID NO: 35 and the polynucleotide encoding VL comprises the nucleic acid sequence of SEQ ID NO: 36.

[0152] E95. An isolated polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds gp130, and wherein the polynucleotide comprises: the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0153] E96. An isolated polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds gp130, and wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0154] E97. A vector comprising the polynucleotide of any one of E87-E96.

[0155] E98. An isolated host cell comprising the polynucleotide of any one of E87 to E96 or the vector of E97.

[0156] E99. A method of producing an isolated antibody, comprising culturing a host cell such as E98 under conditions that result in production of the antibody and recovering the antibody.

[0157] E100. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86 for use as a medicament.

[0158] E101. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86, for use in treating an inflammatory disease.

[0159] E102. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86, for use in treating one or more selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0160] E103. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86, for use in the treatment of inflammatory bowel disease (IBD).

[0161] E104. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86, for use according to E46, wherein the use is for treating Crohn's disease (CD) or ulcerative colitis (UC).

[0162] E105. A method of treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody according to any one of E57 to E85 or a pharmaceutical composition according to E86.

[0163] E106. The method of E105, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0164] E107. The method of E105, wherein the condition is an inflammatory disease.

[0165] E108. The method of E106 or E107, wherein the condition is inflammatory bowel disease (IBD).

[0166] E109. The method of any one of E105 to E108 or the use of E100 to E104, comprising administering the antibody or pharmaceutical composition subcutaneously.

[0167] E110. The method of any one of E105 to E108 or the use of E100 to E104, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0168] E111. Use of the antibody of any one of E57 to E85 for the manufacture of a medicament for the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0169] E112. Use of the antibody of any one of E57 to E85 for the manufacture of a medicament for the treatment of an inflammatory disease.

[0170] E113. Use of the antibody of E111 or E112, wherein the condition is inflammatory bowel disease (IBD).

[0171] E114. Use of the antibody of E113, wherein the pathology is Crohn's disease (CD) and ulcerative colitis (UC).

[0172] E115. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0173] a. the first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3; and

[0174] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6.

[0175] E116. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0176] a. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0177] b. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0178] E117. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein:

[0179] a. The first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3;

[0180] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6;

[0181] c. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0182] d. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0183] E118. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the antibody comprises a first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO: 7, a first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO: 8, a second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO: 21, and a second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO: 22.

[0184] E119. The antibody of any one of E115 to E118, wherein the antibody is a bispecific antibody.

[0185] E120. The antibody of any one of E115 to E119, wherein the antibody comprises an Fc domain comprising first and second Fc chains.

[0186] E121. The antibody of E120, wherein the Fc domain is of the IgA (eg, IgA1 or IgA2), IgD, IgE, IgM, or IgG (eg, IgG1, IgG2, IgG3, or IgG4) isotype.

[0187] E122. The antibody of E120 or E121, wherein the Fc domain is an IgG1 Fc domain, an IgG2 Fc domain, or an IgG4 Fc domain.

[0188] E123. The antibody of any one of E120 to E122, comprising an Fc domain of the IgG1 isotype

[0189] E124. The antibody of E123, wherein the first and second Fc chains comprise one or more amino acid modifications at positions 234, 235, and 237 (by EU numbering) of human IgG1.

[0190] E124. The antibody of E124, wherein the first and second Fc chains comprise one or more substitutions selected from L234A, L235A and G237A (by EU numbering) of IgG1.

[0191] E125. The antibody of E124, wherein the first and second Fc chains comprise the substitutions L234A, L235A and G237A of IgG1 (according to EU numbering).

[0192] E126. The antibody of any one of E120 to E125, wherein the first Fc chain and the second Fc chain of the Fc domain each contain one or more amino acid modifications that promote binding of the first Fc chain to the second Fc chain.

[0193] E127. The antibody of E126, comprising a first and a second arm, wherein:

[0194] a. The first arm comprises a first antigen binding site and a first Fc chain, wherein the first Fc chain comprises amino acid modifications at positions 221 and 409 (EU numbering) of human IgG1, and

[0195] b. The second arm comprises a second antigen binding site and a second Fc chain, wherein the second Fc chain comprises amino acid modifications at positions 221 and 368 (by EU numbering) of human IgG1.

[0196] E128. The antibody of E126, comprising a first and a second arm, wherein:

[0197] a. The first arm comprises a first antigen binding site and a first Fc chain, wherein the first Fc chain comprises amino acid modifications at positions 221 and 368 (EU numbering) of human IgG1, and

[0198] b. The second arm comprises a second antigen binding site and a second Fc chain, wherein the second Fc chain comprises amino acid modifications at positions 221 and 409 (by EU numbering) of human IgG1.

[0199] E129. The antibody of E126, comprising a first and a second arm, wherein:

[0200] a. The first arm comprises a first antigen binding site and a first Fc chain, wherein the first Fc chain comprises substitutions D221R and K409R of human IgG1 (according to EU numbering),

[0201] b. The second arm comprises a second antigen binding site and a second Fc chain, wherein the second Fc chain comprises substitutions D221 E and L368E of human IgG1 (according to EU numbering).

[0202] E130. The antibody of E126, comprising a first and a second arm, wherein:

[0203] a. The first arm comprises a first antigen binding site and a first Fc chain, wherein the first Fc chain comprises substitutions D221 E and L368E of human IgG1 (according to EU numbering).

[0204] b. The second arm comprises a second antigen binding site and a second Fc chain, wherein the second Fc chain comprises substitutions D221R and K409R of human IgG1 (according to EU numbering).

[0205] E131. An antibody that binds to both IL27RA and gp130, comprising a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO: 14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO: 34.

[0206] E132. The antibody of any one of E115 to E131, wherein the antibody has a higher binding affinity for IL27RA than for gp130 as measured by SPR.

[0207] E133. The antibody of any one of E115 to E132, wherein the antibody has a binding affinity for IL27RA that is at least 10-fold greater than its binding affinity for gpl30 as measured by SPR.

[0208] E134. The antibody of any one of E115 to E133, wherein the antibody has a binding affinity for IL27RA that is at least 100-fold greater than its binding affinity for gp130 as measured by SPR.

[0209] E135. The antibody of any one of E115 to E134, wherein the antibody has a binding affinity for IL27RA that is at least 1000-fold greater than its binding affinity for gp130 as measured by SPR.

[0210] E136. The antibody of any one of E115 to E135, wherein the antibody binds to human IL27RA with an affinity of less than 1 nM when measured by SPR

[0211] E137. The antibody of any one of E115 to E136, wherein the antibody binds to human gp130 with an affinity of less than 1000 nM when measured by SPR.

[0212] E138. The antibody of any one of E115 to E135, wherein the antibody binds to human IL27RA with an affinity of between 0.01 nm and 5 nM, between 0.05 nm and 1 nM, or between 0.1 and 1 nM, and binds to human gp130 with an affinity of between 10 nm and 1000 nM, between 50 nm and 1000 nM, between 100 nm and 1000 nM, between 10 nm and 500 nM, or between 10 nm and 250 nM, when measured by SPR.

[0213] E139. The antibody of any one of E115 to E135, wherein the antibody binds to human IL27RA with an affinity of between 0.1 and 5 nM and to human gpl30 with an affinity of between 50 nm and 1000 nM when measured by SPR.

[0214] E140. The antibody of any one of E115 to E139, wherein the antibody binds to human IL27RA with an affinity between 0.1 and 1 nM and to human gp130 with an affinity between 100 nM and 500 nM when measured by SPR.

[0215] E141. The antibody of any one of E115 to E140, wherein the antibody is characterized by an EC50 of less than 10 nm in a phosphorylated STAT1 CD3+ T cell fluorescence flow cytometric assay.

[0216] E142. The antibody of any one of E115 to E141, wherein the antibody is characterized by an EC50 of less than 5 nm in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells.

[0217] E143. The antibody of any one of E115 to E142, wherein the antibody is characterized by an EC50 of less than 1 nm in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells.

[0218] E144. The antibody of any one of E115 to E143, wherein the antibody is characterized by an EC50 of less than 0.5 nm in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells.

[0219] E145. The antibody of any one of E115 to E144, wherein the antibody is characterized by an EC50 of between 10 nm and 0.01 nm, between 10 nm and 0.1 nm, between 1 nm and 0.01 nm, or between 1 nm and 0.1 nm in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells.

[0220] E146. The antibody of any one of E115 to E145, wherein the antibody is characterized by an EC50 between 1 nm and 0.1 nm in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells.

[0221] E147. The antibody of any one of E115 to E146, wherein the antibody is characterized by an EC50 of less than 1 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0222] E148. The antibody of any one of E115 to E147, wherein the antibody is characterized by an EC50 of less than 0.5 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0223] E149. The antibody of any one of E115 to E148, wherein the antibody is characterized by an EC50 of less than 10 nm, less than 1 nm, less than 0.5 nm, less than 0.3 nm, less than 0.1 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0224] E150. The antibody of any one of E115 to E149, wherein the antibody is characterized by an EC50 of less than 0.3 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0225] E151. The antibody of any one of E115 to E150, wherein the antibody is characterized by an EC50 of between 10 nm and 0.01 nm, between 10 nm and 0.1 nm, between 1 nm and 0.01 nm, or between 1 nm and 0.1 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0226] E152. The antibody of any one of E115 to E151, wherein the antibody is characterized by an EC50 of between 1 nm and 0.1 nm in a flow cytometric analysis of phosphorylated STAT3 in CD3+ T cells.

[0227] E153. The antibody of any one of E115 to E152, wherein the antibody is characterized by activation of phosphorylated STAT 1 and STAT 3 in CD3+ T cells.

[0228] E154. The antibody of any one of E115 to E153, wherein the antibody binds to cynomolgus monkey IL27RA and cynomolgus monkey gp130.

[0229] E155. The antibody of any one of E115 to E154, wherein the antibody is capable of downregulating pathogenic cytokine production.

[0230] E156. The antibody of E155, wherein the antibody is capable of downregulating Il-17 production in T helper cells.

[0231] E157. The antibody of any one of E115 to E156, wherein the antibody is characterized by an IC50 of less than 0.05 nm as measured in an 11-17 immunoassay.

[0232] E158. The antibody of any one of E115 to E157, wherein the antibody is characterized by an IC50 of less than 0.01 nm as measured in an 11-17 immunoassay.

[0233] E159. The antibody of any one of E115 to E158, wherein the antibody is characterized by an IC50 of between 1 nm and 0.0001 nm, between 1 nm and 0.01 nm, between 0.1 nm and 0.0001 nm, between 0.1 nm and 0.001 nm, between 0.01 nm and 0.0001 nm, or between 0.01 nm and 0.001 nm, as measured by the 11-17 immunoassay.

[0234] E160. The antibody of any one of E115 to E159, wherein the antibody is characterized by an IC50 of between 0.01 nm and 0.001 nm as measured in an 11-17 immunoassay.

[0235] E161. The antibody of any one of E115 to E160, wherein the antibody is capable of promoting regulatory T cell differentiation.

[0236] E162. The antibody of E161, wherein the regulatory T cells are natural Treg (nTreg) and inducible Treg (iTreg).

[0237] E163. The antibody of any one of E115 to E162, wherein the antibody is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression

[0238] E164. The antibody of any one of E115 to E163, wherein the antibody is capable of upregulating the expression of indoleamine-pyrrole 2,3-dioxygenase (IDO1) in CD14+ human monocytes and / or human colonocytes.

[0239] E165. The antibody of any one of E115 to E164, wherein acid production of kynurenine is determined by LC-MS analysis and the antibody is characterized by an EC50 of less than 100 nM.

[0240] E166. The antibody of any one of E115 to E165, wherein acid production of kynurenine is determined by LC-MS analysis and the antibody is characterized by an EC50 of less than 10 nM.

[0241] E167. The antibody of any one of E115 to E166, wherein the antibody is characterized by an EC50 of between 100 nm and 0.1 nm, between 100 nm and 1 nm, between 10 nm and 0.1 nm, or between 10 nm and 1 nm as determined by LC-MS analysis of acid produced kynurenine.

[0242] E168. The antibody of any one of E115 to E167, wherein the antibody is characterized by an EC50 of between 10 nm and 1 nm as determined by LC-MS analysis of acid produced kynurenine.

[0243] E169. A pharmaceutical composition comprising a therapeutically effective amount of the antibody of any one of E115 to E168 and a pharmaceutically acceptable carrier.

[0244] E170. A vector comprising the polynucleotide of E37 or E39.

[0245] E171. A vector comprising the polynucleotide of E94 or E96.

[0246] E172. An isolated host cell comprising the polynucleotide of E37 or E39 or the vector of E170.

[0247] E173. An isolated host cell comprising the polynucleotide of E94 or E96 or the vector of E171.

[0248] E174. An isolated host cell comprising:

[0249] i) the polynucleotide of E94 or E96 or the vector of E170, and

[0250] ii) the polynucleotide of E94 or E96 or the vector of E171.

[0251] E175. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169, for use in treating an inflammatory disease.

[0252] E176. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169, for use in the treatment of one or more selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0253] E177. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169, for use in treating inflammatory bowel disease (IBD).

[0254] E178. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169, for use according to E46, wherein the use is for treating Crohn's disease (CD) or ulcerative colitis (UC).

[0255] E179. A method of treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody as defined in any one of E115 to E168 or a pharmaceutical composition as defined in E169.

[0256] E180. The method of E179, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0257] E181. The method of E179, wherein the condition is an inflammatory disease.

[0258] E182. The method of E180 or E181, wherein the condition is inflammatory bowel disease (IBD).

[0259] E183. The method of any one of E179 to E182 or the use of E175 to E178, comprising administering the antibody or pharmaceutical composition subcutaneously.

[0260] E184. The method or use of any one of E175 to E183, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0261] E185. Use of the antibody of any one of E115 to E168 for the manufacture of a medicament for the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

[0262] E186. Use of the antibody of any one of E115 to E168 for the manufacture of a medicament for the treatment of an inflammatory disease.

[0263] E187. Use of the antibody of E185 or E186, wherein the condition is inflammatory bowel disease (IBD).

[0264] E188. Use of the antibody of E187, wherein the condition is Crohn's disease (CD) and ulcerative colitis (UC).

[0265] E189. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein the binding affinity of the antibody for human IL27RA is at least two orders of magnitude lower than the binding affinity of the antibody for human gp130.

[0266] E190. The antibody of any one of E1 to E189, comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein the binding affinity of the antibody for human IL27RA is at least two orders of magnitude lower than the binding affinity of the antibody for human gp130.

[0267] E191. The antibody of any one of E189 to E190, wherein the binding affinity of the antibody to human IL27RA is at least three orders of magnitude lower than the binding affinity of the antibody to human gpl30.

[0268] E192 is the antibody of E189 to E191, wherein the antibody binds to human IL27RA with an affinity of less than 1 nM when measured by SPR.

[0269] E193. The antibody of E189 to E192, wherein the antibody binds to human gp130 with an affinity greater than 100 nM when measured by SPR.

[0270] Without wishing to be bound by any particular theory, the antibody acts to antagonize the IL27 receptor by binding to the IL27R subunit IL27RA without engaging the gpl30 subunit of IL27R.

[0271] E194. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622.

[0272] E195. An isolated antibody that specifically binds to IL27RA, comprising a light chain variable region (IL27RA-VL) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0273] E196. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0274] E197. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA127626.

[0275] E198. An isolated antibody that specifically binds to IL27RA, comprising a light chain (IL27RA-LC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0276] E199. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0277] E200. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624.

[0278] E201. An isolated antibody that specifically binds to gp130, comprising a light chain variable region (gp130-VL) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0279] E202. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624.

[0280] E203. An isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628.

[0281] E204. An isolated antibody that specifically binds to gp130, comprising a light chain (gp130-LC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0282] E205. An isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0283] E206. An isolated antibody that specifically binds to IL27RA and gp130, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623, and further comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0284] E207. An isolated antibody that specifically binds to IL27R and gp130, comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627, and further comprising a heavy chain (gp130-VH) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA127629.

[0285] E208. The isolated antibody of any one of E194 to E207, further comprising an antibody of any one of E1 to E30, E43 to E47, E57 to E85, E100 to E104, E115 to E168, E175 to E178, E189 to E193

[0286] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0287] All references, including patent applications, patent publications, and UniProtKB accession numbers, cited herein are hereby incorporated by reference to the same extent as if each individual reference were specifically and individually indicated to be incorporated by reference in its entirety.

[0288] The techniques and procedures described or referred to herein are generally well understood by those skilled in the art and are commonly employed using conventional methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd ed. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel, et al., eds., (2003)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APROACH (MJ MacPherson, BD Hames and GR Taylor, eds. (1995)); Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL and ANIMAL CELL CULTURE (RI Freshney, ed. (1987)); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney), ed., 1987); Introduction to Cell and Tissue Culture (JPMather and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture Laboratory Procedures (A.Doyle, JBGriffiths and DG Newell, eds., 1993-8) J.Wiley and Sons; Handbook of Experimental Immunology (DMWeir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (JEColigan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., editors, IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, editors, Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999)); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995); and updated editions.

[0289] definition

[0290] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention have the same meanings as commonly understood by one of ordinary skill in the art.

[0291] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise specified. For example, reference to an antibody includes one or more antibodies.

[0292] When aspects or embodiments of the invention are described in terms of Markush groups or other alternative groups, the invention encompasses not only the entire group listed as a whole, but also each member of the individual groups and all possible subgroups of the main group, and also encompasses the main group lacking one or more of the group members. The invention also contemplates the explicit exclusion of one or more of any group members from the claimed invention.

[0293] Any examples following the term "eg" or "for example" are not intended to be exhaustive or limiting.

[0294] As used herein, when used to modify a numerically defined parameter (e.g., a dosage), the term "about" means that the parameter may vary by up to 10% below or above the stated value of the parameter. For example, a dosage of about 5 mg means 5% ± 10%, i.e., it may vary between 4.5 mg and 5.5 mg.

[0295] Antibody

[0296] "Antibody" refers to an immunoglobulin molecule that is capable of specifically binding to a target, such as a polypeptide, carbohydrate, polynucleotide, lipid, etc., through at least one antigen-binding site located in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" can encompass any type of antibody (e.g., monospecific, bispecific), and includes portions of intact antibodies that retain the ability to bind to a given antigen (e.g., "antigen-binding fragments") and any other modified configurations of immunoglobulin molecules that contain an antigen-binding site.

[0297] Antibodies include antibodies of any class, such as IgG, IgA, or IgM (or subclasses thereof), and antibodies need not be of any particular class. Immunoglobulins can be classified into different classes based on the antibody amino acid sequence of the constant region of their heavy chains (HC). There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0298] Examples of antibody antigen-binding fragments and modified configurations include (i) Fab fragments (monovalent fragments consisting of the VL, VH, CL, and CH1 domains); (ii) F(ab')2 fragments (bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region); and (iii) Fv fragments consisting of the VL and VH domains of a single arm of an antibody. In addition, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be joined using recombinant methods by synthetic linkers, enabling them to become a single protein chain in which the VL and VH regions pair to form a monovalent molecule (referred to as single-chain Fv (scFv)); see, for example, Bird et al., Science 1988; 242: 423-426 and Huston et al., Proc. Natl. Acad. Sci. 1988 USA 85: 5879-5883. Other forms of single-chain antibodies, such as diabodies, are also contemplated.

[0299] In addition, antibodies are further encompassed that lack a C-terminal lysine (K) amino acid residue on the heavy chain polypeptide (e.g., human IgG1 heavy chains contain a terminal lysine). As is known in the art, the C-terminal lysine is sometimes removed during antibody production, thereby generating antibodies whose heavy chains lack the C-terminal lysine. Alternatively, the antibody heavy chain can be generated using a nucleic acid that does not include a C-terminal lysine.

[0300] variable region

[0301] The "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, alone or in combination. As is known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three complementarity determining regions (CDRs), also known as hypervariable regions, and contribute to the formation of the antibody's antigen-binding site. If variants of an individual variable region are desired, particularly in the case of amino acid residue substitutions outside the CDR regions (i.e., within the framework regions), appropriate amino acid substitutions, preferably conservative amino acid substitutions, can be identified by comparing the individual variable region with variable regions of other antibodies containing CDR1 and CDR2 sequences of the same canonical class as the individual variable region (Chothia and Lesk, J. Mol. Biol. 196(4):901-917, 1987).

[0302] In certain embodiments, the deterministic depiction of the CDRs and the identification of the residues comprising the binding site of the antibody are achieved by solving the structure of the antibody or solving the structure of the antibody-ligand complex. In certain embodiments, it can be achieved by any of the various techniques known to those skilled in the art, such as X-ray crystallography. In certain embodiments, various analytical methods can be used to identify or estimate CDR regions. In certain embodiments, various analytical methods can be used to identify or estimate CDR regions. Examples of such methods include, but are not limited to, Kabat definitions, Chothia definitions, AbM definitions, contact definitions, extended definitions, and conformational definitions.

[0303] The Kabat definition is a standard for numbering residues in antibodies and is often used to identify CDR regions. See, e.g., Johnson and Wu, 2000, Nucleic Acids Res., 28:214-8. The Chothia definition is similar to the Kabat definition, but the Chothia definition takes into account the positions of certain structural loop regions. See, e.g., Chothia et al., 1986, J. Mol. Biol., 196:901-17; Chothia et al., 1989, Nature, 342:877-83. The extended definition is a combination of the Kabat definition and the Chothia definition. The AbM definition uses an integrated suite of computer programs produced by the Oxford Molecular Group that model antibody structure. See, e.g., Martin et al., 1989, Proc Natl Acad Sci (USA), 86:9268-9272; "AbM TM, A Computer Program for Modeling Variable Regions of Antibodies," Oxford, UK; Oxford Molecular, Ltd. The AbM definition models the tertiary structure of an antibody from the primary sequence using a combination of a knowledge database and an innate algorithm, such as those described by Samudrala et al., 1999, "AbInitio Protein Structure Prediction Using a Combined Hierarchical Approach", PROTEINS, Structure, Function and Genetics Suppl., 3:194-198. The contact definition is based on analysis of available complex crystal structures. See, e.g., MacCallum et al., 1996, J. Mol. Biol., 5:732-45. In another approach, referred to herein as "conformational definition" of the CDRs, the positions of the CDRs can be identified as residues that contribute enthalpy to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283: 1156-1166. Although other CDR boundary definitions may not strictly follow one of the above methods, they will still overlap with at least a portion of the Kabat CDRs, but they may be shortened or lengthened based on the following predictions or experimental findings: a particular residue or residue group does not significantly affect antigen binding. As used herein, CDRs can refer to CDRs defined by any method known in the art, including a combination of methods. The methods used herein can utilize CDRs defined according to any of these methods. For any given embodiment containing more than one CDR, the CDRs can be defined according to any one or more of the Kabat definition, the Chothia definition, the extended definition, the AbM definition, the contact definition, or the conformational definition.

[0304] Pfabat numbering method developed for consistent antibody numbering

[0305] The Pfabat numbering method is a defined algorithm for consistent antibody numbering based on the Kabat numbering system (Sequences of Proteins of Immunological Interest, Fifth Edition, Kabat et al., NIH Publication No.: 91-3242, 1991). Unlike many other computational implementations of Kabat numbering, Pfabat numbers the entire human IgG1 heavy and light chains, including the constant (C) region and heavy chain hinge. Unless otherwise indicated, the numbering system used herein is the Pfabat system.

[0306] constant region

[0307] The "constant region" of an antibody refers to the constant region of an antibody light chain or the constant region of an antibody heavy chain, alone or in combination. The IgG heavy chain constant region contains three sequential immunoglobulin domains (CH1, CH2, and CH3), with a hinge region located between the CH1 and CH2 domains. The IgG light chain constant region contains a single immunoglobulin domain (CL).

[0308] Fc domain and Fc chain

[0309] "Fc domain" refers to the portion of an immunoglobulin (Ig) molecule associated with the crystallizable fragment obtained by papain digestion of the Ig molecule. As used herein, the term refers to the 2-chain constant region of an antibody, each chain excluding the first constant region immunoglobulin domain. Within the Fc domain, there are two "Fc chains" (e.g., a "first Fc chain" and a "second Fc chain"). "Fc chain" generally refers to the C-terminal portion of an antibody heavy chain. Thus, the Fc chain refers to the last two constant region immunoglobulin domains (CH2 and CH3) of IgA, IgD, and IgG heavy chains, and the last three constant region immunoglobulin domains of IgE and IgM heavy chains, and optionally the flexible hinge at the N-terminus of these domains.

[0310] Although the boundaries of the Fc chain can vary, a human IgG heavy chain Fc chain is generally defined to comprise residues C226 or P230 to its carboxyl terminus, where numbering is according to the EU index of Edelman et al., Proc. Natl. Acad. Sci. USA 1969; 63(1):78-85 and as described in Kabat et al., 1991. Typically, an Fc chain comprises about amino acid residues 236 to about 447 of the human IgG1 heavy chain constant region. "Fc chain" can refer to this polypeptide in isolation or in the context of a larger molecule, such as an antibody heavy chain or an Fc fusion protein.

[0311] A "functional" Fc domain refers to an Fc domain that possesses at least one effector function of a native sequence Fc domain. Exemplary "effector functions" include C1q binding; complement-dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation, among others. Such effector functions generally require an Fc domain in combination with a binding domain (e.g., an antibody variable region) and can be assessed using various assays known in the art for evaluating such antibody effector functions.

[0312] A "native sequence" Fc chain refers to an Fc chain comprising an amino acid sequence identical to the amino acid sequence of an Fc chain found in nature. A "variant" Fc chain comprises an amino acid sequence that differs from the amino acid sequence of a native sequence Fc chain by at least one amino acid modification.

[0313] Monoclonal antibodies

[0314] "Monoclonal antibody" (mAb) refers to an antibody derived from a single copy or clone (including, for example, any eukaryotic, prokaryotic, or phage clone). Monoclonal antibodies are highly specific, being directed against a single antigenic site. In addition, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates that the characteristic of the antibody is obtained from a substantially homogeneous antibody population and should not be interpreted as requiring the antibody to be produced by any particular method. For example, the monoclonal antibodies used in accordance with the present invention can be manufactured by the hybridoma method first described by Kohler and Milstein, 1975, Nature 256:495, or can be manufactured by recombinant DNA methods such as those described in U.S. Patent No. 4,816,567. In another example, monoclonal antibodies can also be isolated from a phage library generated using the technology described in McCafferty et al., 1990, Nature 348:552-554.

[0315] human antibodies

[0316] A "human antibody" refers to an antibody whose amino acid sequence corresponds to the amino acid sequence of an antibody produced by a human or that has been prepared using any technique for preparing fully human antibodies. For example, fully human antibodies can be obtained by using commercially available mice that have been engineered to express specific human immunoglobulins or by library (e.g., phage, yeast, or ribosome) display technology that prepares fully human antibodies. This definition of a human antibody specifically excludes humanized antibodies that comprise non-human antigen-binding residues.

[0317] chimeric antibodies

[0318] A "chimeric antibody" refers to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.

[0319] Humanized antibodies

[0320] "Humanized" antibodies refer to non-human (e.g., murine) antibodies that are chimeric antibodies containing minimal sequence derived from non-human immunoglobulins. Preferably, humanized antibodies are human immunoglobulins (recipient antibody) having the desired specificity, affinity, and capacity in which residues from the CDRs of the recipient are replaced with residues from a CDR of a non-human species such as mouse, rat, or rabbit (donor antibody). Humanized antibodies may include residues that are not found in the recipient antibody nor in the imported CDR or framework sequences, but are included to further refine and optimize antibody performance.

[0321] antigen

[0322] "Antigen" refers to a molecular entity used to immunize an immunocompetent vertebrate to produce antibodies that recognize the antigen or to screen expression libraries (e.g., phage, yeast, or ribosome display libraries) for antibody selection. As used herein, antigen is a more general term and is generally intended to include target molecules specifically recognized by antibodies, and thus includes fragments or mimetics of molecules used in immunization procedures to produce antibodies or in library screening to select antibodies.

[0323] Epitope

[0324] "Epitope" refers to the region or region of the antigen to which an antibody specifically binds, such as a region or region comprising residues that interact with the antibody, as determined by any method known in the art. A variety of methods for locating and characterizing the position of epitopes on proteins are known in the art, including solving the crystal structure of the antibody-antigen complex, competitive analysis, gene fragment expression analysis, epitope mapping, and synthetic peptide-based analysis, such as described in Chapter 11 of Harlow and Lane, Using Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1999. Additionally or alternatively, during the exploratory process, the generation and characterization of antibodies can elucidate information about the desired epitope. Based on this information, antibodies that bind to the same epitope can then be competitively screened.

[0325] In addition, the epitope bound by the antibody can be determined in a systematic screening by using overlapping peptides derived from the antigen and measuring the binding of the antibody. According to gene fragment expression analysis, the open reading frame encoding the antigen can be fragmented randomly or by specific gene construction, and the reactivity of the expressed fragment of the antigen with the antibody to be tested is measured. The gene fragment can be generated, for example, by PCR and then transcribed and translated into protein in vitro in the presence of radioactive amino acids. The binding of the antibody to the radiolabeled antigen fragment is then measured by immunoprecipitation and gel electrophoresis.

[0326] Certain epitopes can also be identified by using large libraries of random peptide sequences displayed on the surface of phage particles (phage libraries) or yeast (yeast display). Alternatively, a defined library of overlapping peptide fragments can be tested for binding to a test antibody in a simple binding assay. In an additional example, mutagenesis of the antigen, domain swapping experiments, and alanine scanning mutagenesis can be performed to identify residues that are required, sufficient, or essential for epitope binding.

[0327] At its most detailed level, an epitope for the interaction between an antigen and an antibody can be defined by defining the spatial coordinates of the atomic contacts present in the antigen-antibody interaction and information about their relative contributions to the binding thermodynamics. At a less detailed level, an epitope can be characterized by defining the spatial coordinates of the atomic contacts between the antigen and the antibody. At an even less detailed level, an epitope can be characterized by the amino acid residues it comprises, as defined by specific criteria, such as by the distances between atoms (e.g., heavy atoms, i.e., non-hydrogen atoms) in the antibody and antigen. At an even less detailed level, an epitope can be characterized by function, such as by competitive binding with other antibodies. An epitope can also be defined more generally as comprising amino acid residues for which substitution with another amino acid alters the characteristics of the interaction between the antibody and the antigen (e.g., using alanine scanning).

[0328] From the fact that, depending on the epitope mapping method used, descriptions and definitions of epitopes are obtained at different levels of detail, it follows that the comparison of epitopes of different antibodies on the same antigen can be performed analogously at different levels of detail.

[0329] Epitopes described at the amino acid level, e.g., as determined by X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, or hydrogen / deuterium exchange mass spectrometry (H / D-MS), are said to be identical if they contain the same set of amino acid residues. Epitopes are said to overlap if they share at least one amino acid. Epitopes are said to be independent (unique) if they do not share amino acid residues.

[0330] Another method that can be used to characterize antibodies is to use competition assays with other antibodies known to bind to the same antigen to determine whether the antibody of interest binds to the same epitope as the other antibodies. Competition assays are well known to those skilled in the art. Epitopes characterized by competitive binding are said to be overlapping if the binding of the corresponding antibodies is mutually exclusive, that is, binding by one antibody excludes simultaneous or continuous binding by another antibody. If the antigen can accommodate binding by two corresponding antibodies simultaneously, the epitopes are said to be independent (unique).

[0331] Epitopes can be linear or conformational. In a linear epitope, all interaction points between a protein and an interacting molecule (such as an antibody) occur linearly along the primary amino acid sequence of the protein. A "non-linear epitope" or "conformational epitope" comprises a non-contiguous polypeptide (or amino acid) within the antigenic protein to which an antibody specific for the epitope binds.

[0332] Binding affinity

[0333] The term "binding affinity" refers to the total strength of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y can generally be expressed by the dissociation constant (K D ) represents. Affinity can be measured by common methods known in the art. Low-affinity antibodies generally bind antigen slowly and tend to dissociate easily, while high-affinity antibodies generally bind antigen faster and tend to remain bound longer. Specifically, the term "binding affinity" is intended to refer to the dissociation rate of a particular antigen-antibody interaction. D is the rate of dissociation, also known as the off-rate (k off )" or "k d ” relative to the association rate (or “on-rate (k on )”) or “k a ". Therefore, K D Equal to k off / k on (or k d / k a ) and is expressed as a molar concentration (M). Therefore, K D The smaller the K, the stronger the binding affinity. D , 1 μM K D Indicates weaker binding affinity. The K D The K value can be determined using methods well established in the art. D An exemplary method for determining the K of an antibody is by using surface plasmon resonance (SPR), typically using a biosensor system such as a BIACORE system. BIACORE kinetic analysis involves analyzing the binding and dissociation of an antigen to a chip having immobilized molecules (e.g., molecules comprising an epitope binding domain) on its surface. Another method for determining the K of an antibody is to use surface plasmon resonance (SPR), typically using a biosensor system such as a BIACORE system. DThe method is to use Bio-Layer Interferometry, which is usually used Technology (Octet QK e System, ForteBio). Alternatively or additionally, a Kinetic Exclusion Assay (KinExA assay) available from Sapidyne Instruments (Boise, ID) may also be used.

[0334] Monospecific antibodies

[0335] A "monospecific antibody" refers to an antibody that contains one or more antigen-binding sites per molecule such that any and all binding sites of the antibody specifically recognize the same epitope on the antigen. Thus, when a monospecific antibody has more than one antigen-binding site, the binding sites compete with each other for binding to a single antigen molecule.

[0336] Bispecific antibodies

[0337] "Bispecific antibodies" refer to molecules that have binding specificities for at least two different epitopes. In some embodiments, bispecific antibodies can bind to two different antigens simultaneously. In other embodiments, the two different epitopes can be present on the same antigen.

[0338] Half-maximal effective concentration (EC 50 )

[0339] The term "half-maximal effective concentration (EC 50 )” refers to the concentration of therapeutic agent that elicits a response halfway between baseline and maximum after a specified exposure time. Therapeutic agents can cause either inhibition or stimulation. EC 50 The value is commonly used and is used herein as a measure of performance.

[0340] agonists

[0341] "Agonist" refers to a substance that promotes (ie, induces, causes, enhances, or increases) the biological activity or action of another molecule. The term agonist encompasses substances (such as antibodies) that bind to a molecule to promote the activity of that molecule.

[0342] antagonists

[0343] "Antagonist" refers to a substance that prevents, blocks, inhibits, neutralizes, or reduces the biological activity or effect of another molecule, such as a receptor. The term antagonist encompasses substances (such as antibodies) that bind to a molecule to prevent or reduce the activity of that molecule.

[0344] compete

[0345] As used herein, the term "competition" with respect to antibodies means that the first antibody binds to the epitope in a manner sufficiently similar to the binding of the second antibody so that the binding of the second antibody to its cognate epitope in the presence of the first antibody is detectably reduced compared to the binding of the second antibody in the absence of the first antibody. An alternative is possible, but not necessarily so: the binding of the first antibody to its epitope in the presence of the second antibody can also be detectably reduced. That is, the first antibody can inhibit the binding of the second antibody to its epitope without the second antibody inhibiting the binding of the first antibody to its respective epitope. However, when each antibody detectably inhibits the binding of another antibody to its cognate epitope or ligand to the same, greater, or lesser extent, the antibodies are said to "cross-compete" with each other for binding to their respective epitopes. The present invention encompasses both competing and cross-competing antibodies. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or portion thereof), a skilled artisan will understand, based on the teachings provided herein, that such competing or cross-competing antibodies are encompassed and applicable to the methods disclosed herein.

[0346] Fc receptors

[0347] "Fc receptor" (FcR) refers to a receptor that binds to the Fc region of an antibody. In some embodiments, the FcR is a native human FcR. In some embodiments, the FcR is an FcR that binds to an IgG antibody (gamma receptor) and includes receptors of the FcgRI, FcgRII, and FcgRIII subclasses, including allelic variants and alternative splicing forms of those receptors. FcgRII receptors include FcgRIIA ("activating receptor") and FcgRIIB ("inhibiting receptor"), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. The activating receptor FcgRIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. The inhibitory receptor FcgRIIB contains an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain (see, e.g., Daeron, Annu. Rev. Immunol. 1997; 15: 203-234). FcRs are reviewed in, for example, Ravetch and Kinet, Annu. Rev. Immunol 1991;9:457-92; Capel et al., Immunomethods 1994;4:25-34; and de Haas et al., J. Lab. Clin. Med. 1995;126:330-41. Other FcRs, including those to be identified in the future, are encompassed by the term "FcR receptor" herein. The term "Fc receptor" also includes the neonatal receptor FcRn, which is responsible for the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol. 1976;117:587 and Kim et al., J. Immunol. 1994;24:249) and for regulating immunoglobulin homeostasis. Methods for measuring binding to FcRn are known (see, e.g., Ghetie and Ward., Immunol. Today 1997; 18(12): 592-598; Ghetie et al., Nature Biotechnology, 1997; 15(7): 637-640; Hinton et al., J. Biol. Chem. 2004; 279(8): 6213-6216; WO 2004 / 92219).

[0348] Effector cells

[0349] "Effecter cells" refer to leukocytes that express one or more FcRs and perform effector functions. In certain embodiments, effector cells express at least FcgRIII and perform ADCC effector functions. Examples of leukocytes that mediate ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, macrophages, cytotoxic T cells, and neutrophils. Effector cells can be isolated from natural sources, such as blood.

[0350] Antibody-dependent cell-mediated cytotoxicity (ADCC)

[0351] The term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig binds to Fc receptors (FcRs) present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages), enabling these cytotoxic effector cells to specifically bind to target cells bearing the antigen and subsequently kill the target cells with cytotoxins. NK cells, the primary cells used to mediate ADCC, express only FcgRIII, while monocytes express FcgRI, FcgRII, and FcgRIII. To assess the ADCC activity of a molecule of interest, an in vitro ADCC assay, such as that described in U.S. Patent Nos. 5,500,362, 5,821,337, or 6,737,056, can be performed. Useful effector cells for such assays include PBMCs and NK cells. Alternatively or additionally, ADCC activity of the molecule of interest can be assessed in vivo (e.g., in an animal model such as that disclosed in Clynes et al., Proc. Natl. Acad. Sci. (USA) 1998; 95: 652-656). Additional antibodies with altered Fc region amino acid sequences and increased or decreased ADCC activity are described, for example, in U.S. Pat. Nos. 7,923,538 and 7,994,290.

[0352] Enhanced ADCC activity

[0353] The term "enhanced ADCC activity" refers to an antibody that mediates ADCC more effectively in vitro or in vivo compared to a parent antibody, wherein the antibody differs from the parent antibody in at least one structural aspect and, when used in an assay, the antibody and the parent antibody are present in substantially the same amount. In some embodiments, the antibody and the parent antibody have the same amino acid sequence, but the antibody is defucosylated and the parent antibody is fucosylated. In some embodiments, ADCC activity is determined using an in vitro ADCC assay, but other assays or methods for determining ADCC activity are contemplated, such as in animal models. In some embodiments, an antibody with enhanced ADCC activity has enhanced affinity for FcgRIIIA.

[0354] Altered FcR binding or ADCC activity

[0355] The term "altered" FcR binding affinity or ADCC activity refers to an antibody that has enhanced or diminished activity for one or more of FcR binding activity or ADCC activity compared to a parent antibody, wherein the antibody differs from the parent antibody in at least one structural aspect. An antibody that "exhibits" "improved binding" to an FcR binds to at least one FcR with a higher affinity than the parent antibody. An antibody that "exhibits" "decreased binding" to an FcR binds to at least one FcR with a lower affinity than the parent antibody. Such antibodies that exhibit decreased binding to an FcR may have little or no appreciable binding to an FcR, e.g., 0-20 percent binding to the FcR, compared to a native sequence IgG Fc region.

[0356] Complement-dependent cytotoxicity (CDC)

[0357] The term "complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (Clq) to antibodies (of the appropriate subclass) bound to their cognate antigen. To assess complement activation, a CDC assay, such as that described in Gazzano-Santoro et al., J. Immunol. Methods 1996;202:163, can be performed. Antibodies with altered Fc region amino acid sequences and increased or decreased Clq binding capacity are described, for example, in U.S. Patent No. 6,194,551, U.S. Patent No. 7,923,538, U.S. Patent No. 7,994,290, and WO 1999 / 51642.

[0358] host cells

[0359] "Host cell" refers to an individual cell or cell culture that can be or has been a recipient of a vector for the incorporation of a polynucleotide insert. Host cells include the progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. Host cells include cells transfected in vivo with a polynucleotide of the invention.

[0360] carrier

[0361] "Vector" refers to a construct that can deliver and preferably express one or more genes or sequences of interest (e.g., antibody encoding genes) in a host cell. Examples of vectors include, but are not limited to, plasmids and viral vectors, and may include naked nucleic acids, or may include nucleic acids associated with delivery auxiliary materials (e.g., cationic condensing agents, liposomes, etc.). A vector may include DNA or RNA. As used herein, an "expression vector" refers to a vector comprising at least one polypeptide encoding gene, at least one regulatory component (e.g., a promoter sequence, a polyadenylic acid sequence) associated with the transcription or translation of a gene. Typically, the vector used herein contains at least one antibody encoding gene, and one or more regulatory components or selectable markers. Vector components may include, for example, one or more of the following: a signal sequence; an origin of replication; one or more marker genes; suitable transcription control components (such as promoters, enhancers, and terminators). For translation, one or more translation control components may also be included, such as a ribosome binding site, a translation initiation site, and a stop codon.

[0362] Separation

[0363] An "isolated" molecule (e.g., an antibody) is one that, by virtue of its source or derivation, (1) is not associated with naturally associated components with which it is naturally present; (2) is substantially free of other molecules from the same source (e.g., species, cell expressing it, library, etc.); (3) is expressed by cells from a different species; or (4) does not occur in nature. Thus, a molecule that has been chemically synthesized or expressed in a cellular system different from that in which it is naturally derived would be "isolated" from its naturally associated components. A molecule can also be rendered substantially free of naturally associated components by isolation using purification techniques well known in the art.

[0364] Peptides / Proteins

[0365] "Polypeptide" or "protein" (used interchangeably herein) refers to an amino acid chain of any length. The chain may be straight or branched. The chain may comprise one or more modified amino acids. These terms also encompass amino acid chains that have been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification such as conjugation to a labeling component. The definition also includes, for example, polypeptides containing one or more amino acid analogs (including, for example, unnatural amino acids), as well as other modifications known in the art. It should be understood that a polypeptide may appear as a single chain or as a concatenated chain.

[0366] Polynucleotides / Nucleic Acids

[0367] "Polynucleotide" or "nucleic acid" (used interchangeably herein) refers to a chain of nucleotides of any length and includes DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, or analogs thereof, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and their analogs. If present, the nucleotide structure may be modified before or after chain assembly. The nucleotide sequence may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, such as by conjugation to a labeling component. Other types of modifications include, for example, "caps," substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications, such as, for example: those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.); those containing side moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.); those with intercalators (e.g., acridine, psoralen, etc.); those containing chelators (e.g., metals, radioactive metals, boron, oxidized metals, etc.); those containing alkylating agents; those with modified linkages (e.g., alpha mutarotomers, etc.); and unmodified forms of polynucleotides. In addition, any hydroxyl group typically present in the sugar can be replaced, for example, by a phosphonate group, a phosphate group, protected by a standard protecting group, or activated to prepare additional linkages to additional nucleotides, or can be bound to a solid support. The 5' and 3' terminal OH groups can be phosphorylated or substituted with an amine or an organic capping group of 1 to 20 carbon atoms. Other hydroxyl groups can also be derivatized with standard protecting groups. Polynucleotides can also contain similar forms of ribose or deoxyribose generally known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, α- or β-mutanosaccharides, epimeric sugars (such as arabinose, xylose or lyxose); pyranose, furanose, sedoheptulose, acyclic analogs and abasic nucleoside analogs (such as methyl riboside).

[0368] Conservative substitution

[0369] "Conservative substitution" refers to the replacement of an amino acid with a biologically, chemically, or structurally similar residue. Biologically similar means that the substituent does not destroy biological activity. Structurally similar means that the amino acids have side chains of similar length (such as alanine, glycine, and serine) or similar size. Chemical similarity means that the residues have the same charge or are both hydrophilic or hydrophobic. Specific examples include the substitution of one hydrophobic residue (such as isoleucine, valine, leucine, or methionine) for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, serine for threonine, and the like. Specific examples of conservative substitutions include the substitution of one hydrophobic residue (such as isoleucine, valine, leucine, or methionine) for another, the substitution of one polar residue for another, such as arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like. Conservative amino acid substitutions generally include, for example, substitutions within the following groups: glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0370] consistency

[0371] The term "identity" or "identical to" refers to the overall relatedness between polymeric molecules, such as nucleic acid molecules (e.g., DNA molecules or RNA molecules) or polypeptide molecules. "Identity" measures the percentage of identical matches between two or more sequences addressed by a specific mathematical model (e.g., an "algorithm") of a computer program whose gap alignment is well known in the art. The percent identity between two polymeric molecules can be calculated from such an alignment as NN / T*100, where N is the number of positions at which the sequences share identical residues, and T is the total number of positions compared, including gaps and including or excluding overhanging sequences. In one embodiment, overhanging sequences are included in the calculation.

[0372] The terms "increase," "enhance," "decrease," or "reduction" refer to values ​​relative to a baseline measurement, such as a measurement of the same individual before starting a treatment described herein, or a measurement of a control individual (or subject) in the absence of a treatment described herein. In some embodiments, a "control individual" is an individual suffering from the same form of disease or injury as the individual being treated. In some embodiments, a "control individual" is an individual who does not suffer from the same form of disease or injury as the individual being treated.

[0373] excipient

[0374] The term "excipient" refers to any material that allows the active ingredient to retain biological activity in combination with the active ingredient (e.g., antibody) of interest. The selection of excipient will depend to a large extent on factors such as mode of administration, the impact of the excipient on solubility and stability, and the properties of the dosage form. As used herein, "excipient" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delaying agents, carriers, diluents, and the like that are physiologically compatible. Examples of excipients include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, and combinations thereof, and may include isotonic agents, such as sugar, sodium chloride, or polyols (such as mannitol or sorbitol) in the composition.

[0375] treat

[0376] The terms "treating," "treat," or "treatment" refer to any type of therapy, such as to alleviate, lessen, or slow the progression of a disease, disorder, or condition, or any tissue damage associated with a disease, in a patient. In some embodiments, the disease, disorder, or condition is inflammatory bowel disease (IBD). In some embodiments, the disease, disorder, or condition is Crohn's disease (CD). In some embodiments, the disease, disorder, or condition is ulcerative colitis (UC).

[0377] prevention

[0378] The term "prevent" or "prevention" refers to one or more of delaying the onset, reducing the frequency, or reducing the severity of at least one sign or symptom of a particular disease, disorder, or condition, such as inflammatory bowel disease (IBD). In some embodiments, prevention is assessed on a population basis such that an agent is considered to "prevent" a particular disease, disorder, or condition if a statistically significant reduction in the development, frequency, or intensity of one or more symptoms of the disease, disorder, or condition is observed in a population susceptible to the disease, disorder, or condition. Prevention can be considered accomplished when the onset of the disease, disorder, or condition has been delayed for a predetermined period of time.

[0379] individual

[0380] The terms "subject," "individual," or "patient" (used interchangeably herein) refer to any animal, including mammals. Mammals according to the present invention include dogs, cats, cows, goats, horses, sheep, pigs, rodents, lagomorphs, primates, humans, and the like, and encompass unborn mammals. In one embodiment, humans are suitable subjects. Human subjects can be of any sex and at any stage of development. In some embodiments, the subject is a patient suffering from inflammatory bowel disease (IBD).

[0381] Therapeutically effective dose

[0382] The term "therapeutically effective amount" refers to that amount of an active ingredient that will elicit in a tissue, system, animal, individual, or human the biological or medical response that is being sought by the researcher, veterinarian, medical doctor, or other clinician, which response may include one or more of the following:

[0383] (1) preventing a disease; for example, preventing a disease, condition, or disorder in an individual who may be susceptible to the disease, condition, or disorder but who does not yet experience or display the pathology or symptomatology of the disease;

[0384] (2) inhibiting a disease; for example, inhibiting a disease, condition, or disorder in an individual who is experiencing or displaying the pathology or symptomology of the disease, condition, or disorder (i.e., arresting or slowing the further development of the pathology or symptomology); and

[0385] (3) Amelioration of the disease; for example, ameliorating the disease, condition, or disorder in an individual who is experiencing or displaying the pathology or symptomology of the disease, condition, or disorder (i.e., reversing the pathology or symptomology).

[0386] Antibodies to IL27RA

[0387] The present invention provides antibodies that bind to interleukin 27 receptor subunit alpha (IL27RA), also known as cytokine receptor-like 1, cytokine receptor WSX-1, Zcytor1, T cell and type 1 cytokine receptor.

[0388] As used herein, the term IL27RA includes variants, isoforms, homologs, orthologs, and paralogs of IL27RA. In some embodiments, the antibodies disclosed herein cross-react with IL27RA from species other than human (such as cynomolgus macaque IL27RA), as well as different forms of IL27RA. In some embodiments, the antibodies may be completely specific for human IL27RA and may not exhibit species cross-reactivity (e.g., not binding to mouse IL27RA) or other types of cross-reactivity. As used herein, unless the context dictates otherwise, the term IL27RA refers to naturally occurring human IL27RA. Thus, "IL27RA antibody," "anti-IL27RA antibody," or other similar designations means any antibody that binds or reacts with IL27RA, its isoforms, fragments, or derivatives (as defined herein). The full-length, mature form of IL27RA, as represented by UniProtKB / Swiss-Prot Accession No. Q6UWB1, is provided herein as SEQ ID NO: 41. The full-length, mature form of mouse IL27RA, as represented by UniProtKB / Swiss-Prot Accession No. 070394, is provided herein as SEQ ID NO: 44. The full-length, mature form of cynomolgus monkey IL27RA, as represented by UniProtKB / Swiss-Prot Accession No. A0A2K5WKA4, is provided herein as SEQ ID NO: 42.

[0389] Without wishing to be bound by any particular theory, the antibody acts to antagonize the IL27 receptor by binding to the IL27R subunit IL27RA without engaging the gpl30 subunit of IL27R.

[0390] The "biological function" or "biological activity" of IL27RA is intended to improve inflammation and improve regulatory function in innate immunity and T cells. The biological function or biological activity of IL27RA may, but is not necessarily, mediated by the interaction between IL27 and its ligand.

[0391] In some embodiments, the anti-IL27RA antibodies of the present invention encompass antibodies that either or both: i) compete for binding to human IL27RA, or ii) bind to the same epitope as an antibody having the amino acid sequence of a heavy chain variable region set forth in SEQ ID NO:31 and the amino acid sequence of a light chain variable region set forth in SEQ ID NO:32.

[0392] The anti-IL27RA antibodies of the present invention may encompass monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heterojunction antibodies, single chain (ScFv), mutants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and any other modified configuration of an immunoglobulin molecule comprising an antigen-binding site of desired specificity, including glycosylation variants of the antibodies, amino acid sequence variants of the antibodies, and covalently modified antibodies. The antibodies may be of murine, rat, human, or any other origin (including chimeric or humanized antibodies). In some embodiments, the anti-IL27RA antibodies are monoclonal antibodies. In some embodiments, the anti-IL27RA antibodies are human or humanized antibodies. In some embodiments, the anti-IL27RA antibodies are chimeric antibodies.

[0393] In some embodiments, the invention provides an antibody having a light chain variable region (VL) sequence and a heavy chain variable region (VH) sequence as found in Table 13, or a variant thereof.

[0394] The present invention also provides CDR portions of antibodies to IL27RA. Determination of CDR regions is well within the skill of the art. It will be appreciated that in some embodiments, CDRs may be a combination of Kabat and Chothia CDRs (also referred to as "combined CDRs" or "extended CDRs"). In another approach, referred to herein as "conformational definition" of CDRs, positions of CDRs can be identified as residues that contribute enthalpy to antigen binding. See, for example, Makabe et al., 2008, Journal of Biological Chemistry, 283: 1156-1166. In general, "conformational CDRs" include residue positions in the Kabat CDRs and the Vernier zone, which are constrained to maintain the appropriate loop structure for the antibody to bind to a specific antigen. Determination of conformational CDRs is well within the skill of the art. In some embodiments, CDRs are Kabat CDRs. In other embodiments, CDRs are Chothia CDRs. In other embodiments, CDRs are extended, AbM, conformational, or contact CDRs. In other words, in embodiments with more than one CDR, the CDRs can be any one of the Kabat, Chothia, extended, AbM, conformational, contact CDRs, or a combination thereof.

[0395] In some embodiments, the antibody comprises three CDRs of any one of the heavy chain variable regions shown in Table 13. In some embodiments, the antibody comprises three CDRs of any one of the light chain variable regions shown in Table 13. In some embodiments, the antibody comprises three CDRs of any one of the heavy chain variable regions shown in Table 13 and three CDRs of any one of the light chain variable regions shown in Table 13.

[0396] In some embodiments, the antibody comprises three light chain CDRs and three heavy chain CDRs from Table 13.

[0397] In some embodiments, the antibody comprises one or both of the following: i) a full-length heavy chain with or without a C-terminal lysine, or ii) a full-length light chain of an anti-IL27RA antibody, anti-Il27RA-4701 or anti-Il27RA 4880EE. The amino acid sequences of the full-length heavy and light chains of the antibodies are shown in Table 13 below.

[0398] Table 13 also provides the heavy and light chain sequences of the mAbs of the invention.

[0399] In some embodiments, the antibody can comprise a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO:7, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO:8.

[0400] In some embodiments, the antibody may comprise a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0401] In some embodiments, the antibody comprises an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and comprises an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0402] In some embodiments, the antibody comprises an IL27RA-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77. In some embodiments, the IL27RA-VH framework sequence may be derived from the human germline DP54 sequence.

[0403] In some embodiments, the antibody comprises an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9. In some embodiments, the antibody comprises an IL27RA-VL framework sequence derivable from a human germline DPK9 sequence.

[0404] In some embodiments, the IL27RA-VL and IL27RA-VH framework sequences may comprise one or more amino acid substitutions, additions, or deletions while still maintaining functional and structural similarity to the germline sequences from which they are derived. In some embodiments, one or both of the IL27RA-VL and IL27RA-VH framework sequences may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the human germline sequences from which they are derived. In some embodiments, one or both of the IL27RA-VL and IL27RA-VH framework sequences may be identical to the human germline sequences from which they are derived.

[0405] In some embodiments, the IL27RA-VH sequence may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7, and the IL27RA-VL sequence may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:8.

[0406] In some embodiments, the IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 27. In some embodiments, the IL27RA antibody comprises a light chain having the amino acid sequence of SEQ ID NO: 14.

[0407] In some embodiments, the IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14. In some embodiments, the IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14.

[0408] Antibodies to gp130

[0409] The present invention provides antibodies that bind to glycoprotein 130 (gp130), also known as interleukin-6 receptor subunit beta, CD130, and interleukin-6 cytokine family signal transducer.

[0410] As used herein, the term gp130 includes variants, isoforms, homologs, orthologs, and paralogs of gp130. In some embodiments, the antibodies disclosed herein cross-react with gp130 from species other than humans (such as gp130 from cynomolgus macaques), as well as different forms of gp130. In some embodiments, the antibodies may be completely specific for human gp130 and may not exhibit species cross-reactivity (e.g., no binding to mouse gp130) or other types of cross-reactivity. As used herein, unless the context dictates otherwise, the term gp130 refers to naturally occurring human gp130. Thus, "gp130 antibody," "anti-gp130 antibody," or other similar designations means any antibody (as defined herein) that binds or reacts with gp130, its isoforms, fragments, or derivatives. The full-length, mature form of gp130, as represented by UniProtKB / Swiss-Prot Accession No. P40189, is provided herein as SEQ ID NO: 45. The full-length, mature form of mouse gp130, as represented by UniProtKB / Swiss-Prot Accession No. Q00560, is provided herein as SEQ ID NO: 48. The full-length, mature form of cynomolgus macaque gp130, as represented by Gene ID No. 3572, is provided herein as SEQ ID NO: 46.

[0411] The biological function or biological activity of IL27RA may, but is not necessarily, mediated by the interaction between gp130 and its ligand.

[0412] In some embodiments, the anti-gp130 antibodies of the invention encompass antibodies that either or both: i) compete for binding to human gp130, or ii) bind to the same epitope as an antibody having the amino acid sequence of a heavy chain variable region set forth in SEQ ID NO: 20 and the amino acid sequence of a light chain variable region set forth in SEQ ID NO: 21.

[0413] The anti-gp130 antibodies of the present invention may include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heterobinding antibodies, single chain antibodies (ScFv), mutants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and any other modified configuration of an immunoglobulin molecule comprising an antigen-binding site of desired specificity, including glycosylation variants of the antibodies, amino acid sequence variants of the antibodies, and covalently modified antibodies. The antibodies may be of murine, rat, human, or any other origin (including chimeric or humanized antibodies). In some embodiments, the anti-gp130 antibodies are monoclonal antibodies. In some embodiments, the anti-gp130 antibodies are human or humanized antibodies. In some embodiments, the anti-gp130 antibodies are chimeric antibodies.

[0414] In some embodiments, the invention provides an antibody having a light chain variable region (VL) sequence and a heavy chain variable region (VH) sequence as found in Table 13, or a variant thereof.

[0415] The present invention also provides CDR portions of antibodies to gp130. The determination of CDR regions is well within the skill of the art. It should be understood that in some embodiments, the CDRs may be a combination of Kabat and Chothia CDRs (also referred to as "combined CDRs" or "extended CDRs"). In another approach (referred to herein as "conformational definition" of CDRs), the positions of the CDRs can be identified as residues that contribute enthalpy to antigen binding. See, for example, Makabe et al., 2008, Journal of Biological Chemistry, 283: 1156-1166. In general, "conformational CDRs" include residue positions in the Kabat CDRs and cursor regions that are constrained to maintain the appropriate loop structure for the antibody to bind to a specific antigen. The determination of conformational CDRs is well within the skill of the art. In some embodiments, the CDRs are Kabat CDRs. In other embodiments, the CDRs are Chothia CDRs. In other embodiments, the CDRs are extended, AbM, conformational, or contact CDRs. In other words, in embodiments with more than one CDR, the CDRs can be any one of the Kabat, Chothia, extended, AbM, conformational, contact CDRs, or a combination thereof.

[0416] In some embodiments, the antibody comprises three CDRs of any one of the heavy chain variable regions shown in Table 13. In some embodiments, the antibody comprises three CDRs of any one of the light chain variable regions shown in Table 13. In some embodiments, the antibody comprises three CDRs of any one of the heavy chain variable regions shown in Table 13 and three CDRs of any one of the light chain variable regions shown in Table 13.

[0417] Table 13 provides examples of CDR sequences for anti-gp130 antibodies provided herein.In some embodiments, the antibody comprises three light chain CDRs and three heavy chain CDRs from Table 13.

[0418] In some embodiments, the antibody comprises one or both of the following: i) a full-length heavy chain with or without a C-terminal lysine, or ii) a full-length light chain of an anti-gp130 antibody, anti-gp130 4574, or anti-gp130-4875 RR. The amino acid sequences of the full-length heavy and light chains of the antibodies, anti-gp130 4574, or anti-gp130-4875 RR are shown below in Table 13.

[0419] In some embodiments, an antibody that specifically binds to glycoprotein 130 (gp130) comprises a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22.

[0420] In some embodiments, the antibody comprises a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20.

[0421] In some embodiments, the antibody comprises a gp130-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77. In some embodiments, the antibody comprises a gp130-VH framework sequence derived from a human germline DP10 sequence.

[0422] In some embodiments, the antibody comprises an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9. In some embodiments, the antibody comprises a gp130-VL framework sequence derived from a human germline DPK9 sequence.

[0423] In some embodiments, the gp130-VL framework sequence and the gp130-VH framework sequence may comprise one or more amino acid substitutions, additions, or deletions while still maintaining functional and structural similarity to the germline from which they are derived. In some embodiments, one or both of the gp130-VL framework sequence and the IL27RA-VH framework sequence may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the human germline sequence from which they are derived. In some embodiments, one or both of the gp130-VL framework sequence or the gp130-VH framework sequence may be identical to the human germline sequence from which they are derived.

[0424] In some embodiments, the antibody comprises a gp130-VH sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21 and a gp130-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0425] In some embodiments, the antibody comprises the gp130-VH sequence of SEQ ID NO:21 and comprises the gp130-VL sequence of SEQ ID NO:22.

[0426] In some embodiments, the antibody comprises a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35. In some embodiments, the antibody comprises a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36. In some embodiments, the antibody comprises a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36.

[0427] In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 30. In some embodiments, the antibody comprises a light chain having the amino acid sequence of SEQ ID NO: 24. In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24. In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 30 and a light chain having the amino acid sequence of SEQ ID NO: 24.

[0428] Antibodies to IL27RA and gp130

[0429] IL-27 has been shown to play a key role in autoimmune and inflammatory diseases, and receptor agonism provides a means to downregulate pathogenic immune responses associated with autoimmune and inflammatory diseases. Thus, without wishing to be bound by any particular theory, the bispecific IL27RA / gp130 antibodies disclosed herein, such as mAb-4894, act as agonists of IL27R and bind to the IL27 receptor subunits IL27RA and gp130 to induce immunomodulatory effects. Examples of immunomodulatory effects of bispecific IL27RA / gp130 antibodies include inhibition of intestinal inflammation and promotion of intestinal barrier integrity.

[0430] IL-27 acts through a heterodimeric receptor composed of IL27RA and gp130 chains, mediating signaling through signal transducer and activator of transcription (STAT) 1 and STAT 3. Thus, as shown in Example 8, the bispecific antibodies disclosed herein that bind to both IL27RA and gp130 are able to bind to both subunits of the IL27RA / gp130 heterodimer and induce phosphorylation of STAT 1 and 3 signaling, in a manner similar to the natural IL27R ligand IL27.

[0431] Without wishing to be bound by any particular theory, the immunosuppressive effects of the IL27RA / gpl30 antibodies may be attributed to multiple actions of the antibodies resulting from activation of the IL27 receptor, including the following.

[0432] IL27RA / gp130 antibodies can reduce Th17 and Th2 responses, such that the antibodies downregulate GATA-3 and IL13 expression during Th2 cell differentiation and downregulate IL-17A expression during Th17 cell differentiation, as shown in Example 9. CD4+ T helper cells play a variety of important roles in the development and maintenance of various autoimmune diseases, including IBD. CD4+ T helper cells can be characterized into different subtypes: Th1, Th2, and Th17 cells, based on the different panels of cytokines secreted, which in turn mediate unique cellular activities.

[0433] IL27RA / gp130 antibodies can upregulate IDO1 expression in the cytoplasm of CD14+ monocytes and human colonic epithelial cells, thereby providing immunoprotection and immunosuppressive effects, as shown in Example 8. IDO1 is a cytosolic enzyme with a hematopoietic (Fe2+) prosthetic group that catalyzes the metabolism of tryptophan (Trp) and converts it to kynurenine (Kyn). The IDO1 pathway was originally described as an innate immune mechanism that protects host organisms from infection. Elevated IDO1 levels largely inhibit the proliferation of effector T cells and induce apoptosis of effector T cells, and accumulated Trp metabolites induce the differentiation of Tregs, collectively leading to immunosuppression. The immunoprotective and immunosuppressive effects of IDO1 and Trp metabolites are strictly controlled by the stoichiometry of available local factors. The resulting effects of these local activities regulate IDO1 expression and help maintain overall immune homeostasis and peripheral immune tolerance.

[0434] IL27RA / gp130 antibodies can induce PD-L1 expression, as shown in Example 8. PD-L1 (CD274) is the primary inhibitory ligand for PD-1 (programmed cell death protein 1, also known as CD279). Engagement of PD-1 with PD-L1 alters T cell activity in various ways, such as inhibiting T cell proliferation, survival, cytokine production, and other effector functions.

[0435] IL27RA / gp130 antibodies can upregulate IL-10 gene expression and LAG3 expression, which deliver negative immunoregulatory signals when engaged with T cell activation. Regulatory T (Treg) cells are necessary for maintaining peripheral tolerance, preventing autoimmune diseases, and limiting chronic inflammatory diseases. There are two types of Treg: natural Treg (nTreg) and inducible Treg (iTreg). Compared to control antibodies, IL27RA / gp130 antibodies induce more Tregs from untreated cells. CD4+CD25+FOXP3+iTreg of CD4+T cells also upregulates the LAG3+ population, upregulates Tim-3 expression and increases the Tim-3+ cell population.

[0436] IL27RA / gp130 antibodies can induce an inhibitory effect on allogeneic T cell proliferation mediated by three types of DCs (immature DCs, immunogenic DCs, and tolerogenic DCs), thereby significantly downregulating cell surface CD83 expression and upregulating ILT4 expression.

[0437] In one embodiment, the IL27RA / gp130 antibody does induce an anti-inflammatory response. In one embodiment, the IL27RA / gp130 antibody does not induce a pro-inflammatory response. In one embodiment, the gp130 antibody does not induce IFNγ expression in Th1 cells.

[0438] The gp130 subunit is widely distributed and present on other gp130-containing receptors such as interleukin-6 receptor (IL-6R), interleukin-11 receptor (IL-11R), oncostatin M receptor (OSMR), and LIF receptor subunit α (LIFR), potentially leading to off-target effects associated with binding to non-target gp130 subunits containing receptors.

[0439] Thus, in one embodiment, and as shown in Example 6, the binding affinities of the two arms of the IL27RA / gp130 antibody have been tuned such that the antibody has a higher affinity for the IL27RA subunit when compared to the more widely distributed gp130 subunit. This differential affinity achieves sufficient potency for agonist activity in IL27R while minimizing binding to other gp130-containing receptors. In some embodiments, the binding affinity of the IL27RA / gp130 antibody for IL27RA is at least 10-fold greater than the binding affinity for gp130 as measured by SPR. In some embodiments, the binding affinity of the IL27RA / gp130 antibody for IL27RA is at least 100-fold greater than the binding affinity for gp130 as measured by SPR. In some embodiments, the binding affinity of the IL27RA / gp130 antibody for IL27RA is at least 1000-fold greater than the binding affinity for gp130 as measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human IL27RA with an affinity of less than 1 nM when measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human gp130 with an affinity of less than 1000 nM when measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human IL27RA with an affinity of between 0.01 nm and 5 nM, between 0.05 nm and 1 nM, or between 0.1 and 1 nM, and binds to human gp130 with an affinity of between 10 nm and 1000 nM, between 50 nm and 1000 nM, between 100 nm and 1000 nM, between 10 nm and 500 nM, or between 10 nm and 250 nM when measured by SPR. In some embodiments, the IL27RA / gp130 antibodies bind to human IL27RA with an affinity of between 0.1 and 5 nM and to human gp130 with an affinity of between 50 nm and 1000 nM, as measured by SPR. In some embodiments, the IL27RA / gp130 antibodies bind to human IL27RA with an affinity of between 0.1 and 1 nM and to human gp130 with an affinity of between 100 nm and 500 nM, as measured by SPR.

[0440] The present invention provides antibodies that bind to IL27RA and gp130. As used herein, the terms IL27RA and gp130 include variants, isoforms, homologs, orthologs, and paralogs of IL27RA and gp130, respectively. In some embodiments, the antibodies disclosed herein cross-react with one or more of IL27RA and gp130 from species other than humans, such as IL27RA and gp130 from cynomolgus macaques. In some embodiments, the antibodies may be completely specific for IL27RA and gp130 and may not exhibit species cross-reactivity or other types of cross-reactivity. As used herein, unless the context dictates otherwise, the terms IL27RA and gp130 refer to naturally occurring human IL27RA and gp130. "IL27RA / gpl30 antibody," "anti-IL27RA / gpl30 antibody," or other similar designations means any antibody that binds or reacts with IL27RA and gpl30, isoforms, fragments, or derivatives thereof (as defined herein).

[0441] In some embodiments, the present invention provides IL27RA / gpl30 antibodies having a light chain variable region (VL) sequence and a heavy chain variable region (VH) sequence as found in Table 13 or 14, or variants thereof.

[0442] The present invention also provides CDR portions of IL27RA / gp130 antibodies. Determination of Defining CDR Regions. In some embodiments, an IL27RA / gp130 antibody comprises three CDRs of an IL27RA antibody of Table 13 and three CDRs of a gp130 antibody of Tables 13 or 14.

[0443] In some embodiments, the present invention provides anti-IL27RA / gp130 antibodies containing variations of the CDR, VH, VL, HC, and LC regions shown in Tables 13 and 14, wherein such variant polypeptides have at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to any of the amino acid sequences disclosed in one or more of Tables 13 and 14. These equivalent amounts are not intended to be limiting, and increments between the recited percentages are specifically contemplated as part of the present invention.

[0444] In certain embodiments, the antibodies described herein comprise an Fc domain. The Fc domain can be derived from IgA (e.g., IgA1 or IgA2), IgG, IgE, or IgG (e.g., IgG1, IgG2, IgG3, or IgG4). In some embodiments, the anti-IL27RA antibody is an IgG2 antibody. In some embodiments, the anti-IL27RA antibody is an IgG1 antibody.

[0445] The present invention encompasses modifications to the variable regions, CDRs, and heavy and light chain sequences shown in Tables 13 or 14. For example, the present invention includes antibodies comprising functionally equivalent variable regions and CDRs that do not significantly affect their properties, as well as variants with enhanced or decreased activity or affinity. For example, the amino acid sequence can be mutated to obtain antibodies with the desired binding affinity for IL27RA and gp130. Polypeptide modifications are routine practice in the art and need not be described in detail herein. Examples of modified polypeptides include polypeptides with conservative substitutions of amino acid residues, one or more deletions or additions of amino acids that do not significantly deleteriously alter functional activity, or to mature (enhance) the affinity of the polypeptide for its ligand or the use of chemical analogs.

[0446] Modification or mutation can also be carried out in the framework region or constant region to increase the half-life of the antibody provided herein.See, for example, PCT Publication No. WO 00 / 09560. Mutation can also be carried out in the framework region or constant region to change the immunogenicity of the antibody, provide a site for covalent or non-covalent binding to another molecule, or change the characteristics of cytotoxicity such as complement fixation, FcR binding and antibody-dependent cell-mediated. In some embodiments, no more than one to five conservative amino acid substitutions are carried out in the framework region or constant region. In other embodiments, no more than one to three conservative amino acid substitutions are carried out in the framework region or constant region. According to the present invention, a single antibody can have a mutation in any one or more CDRs or framework regions of the variable domain or in the constant region.

[0447] In some embodiments, the antibody comprises a modified constant region that has increased or decreased binding affinity for human Fcγ receptors, is immunologically inert or partially inert, for example, does not trigger complement-mediated lysis, does not stimulate antibody-dependent cell-mediated cytotoxicity (ADCC), or does not activate microglia; or has reduced activity (compared to the unmodified antibody) in any one or more of the following: triggering complement-mediated lysis, stimulating ADCC, or activating microglia. Different modifications of the constant region can be used to achieve the optimal level or combination of effector functions. See, e.g., Morgan et al., Immunology 86:319-324, 1995; Lund et al., J. Immunology 157:4963-4969, 1996; Idusogie et al., J. Immunology 164:4178-4184, 2000; Tao et al., J. Immunology 143:2595-2601, 1989; and Jefferis et al., Immunological Reviews 163:59-76, 1998. In some embodiments, the constant region is modified as described in Eur. J. Immunol., 1999, 29:2613-2624; PCT Publication No. WO99 / 058572.

[0448] In some embodiments, the antibody may comprise an amino acid modification at one or more positions L234, L235, and G237 (by EU numbering) or L247, L248, and G250 (by Kabat numbering) in the human isotype IgGl.

[0449] In some embodiments, the antibody may comprise amino acid modifications at positions L234, L235, and G237 (by EU numbering) or L247, L248, and G250 (by Kabat numbering) in human IgG1.

[0450] In some embodiments, the antibody may comprise amino acid modifications of one or more of L234A, L235A, and G237A (by EU numbering) or L247A, L248A, and G250A (by Kabat numbering) in human IgG1.

[0451] In some embodiments, the antibody may comprise amino acid modifications of one or more of L234A, L235A, and G237A (by EU numbering) or L247A, L248A, and G250A (by Kabat numbering) in human IgG2.

[0452] In some embodiments, the antibody may comprise amino acid modifications of one or more of L234A, L235A, and G237A (by EU numbering) or L247A, L248A, and G250A (by Kabat numbering) in human IgG3.

[0453] In some embodiments, the antibody may comprise amino acid modifications of one or more of L234A, L235A, and G237A (by EU numbering) or L247A, L248A, and G250A (by Kabat numbering) in human IgG4.

[0454] Modifications also include glycosylated and non-glycosylated polypeptides, as well as polypeptides with other post-translational modifications such as glycosylation using different sugars, acetylation, and phosphorylation. Antibodies are glycosylated at conserved positions in their constant regions (Jefferis and Lund, 1997, Chem. Immunol. 65: 111-128; Wright and Morrison, 1997, TibTECH 15: 26-32). The oligosaccharide side chains of immunoglobulins influence protein function (Boyd et al., 1996, Mol. Immunol. 32: 1311-1318; Wittwe and Howard, 1990, Biochem. 29: 4175-4180) and intramolecular interactions between the various parts of the glycoprotein, which can affect the conformation and three-dimensional surface presented by the glycoprotein (Jefferis and Lund, supra; Wyss and Wagner, 1996, Current Opin. Biotech. 7: 409-416). Oligosaccharides can also be used to target specific glycoproteins to certain molecules based on specific recognition structures. Glycosylation of antibodies has also been reported to affect antibody-dependent cellular cytotoxicity (ADCC). Specifically, antibodies produced by CHO cells were reported to have enhanced ADCC activity in the presence of tetracycline-regulated expression of β(1,4)-N-acetylglucosaminyltransferase III (GnTIII), a glycosyltransferase that catalyzes the formation of bisecting GlcNAc (Umana et al., 1999, Nature Biotech. 17:176-180).

[0455] In some embodiments, the present invention provides anti-antibodies containing variations of the variable region, CDR, or heavy and light chain sequences shown in Table 13, wherein such variant polypeptides have at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to any of the amino acid sequences disclosed in Table 13. These equivalent amounts are not intended to be limiting, and increments between the recited percentages are specifically contemplated as part of the present invention.

[0456] The present invention also encompasses fusion proteins comprising one or more components of the antibodies disclosed herein. In some embodiments, a fusion protein can be made comprising all or a portion of an antibody of the present invention linked to another polypeptide. In another embodiment, only the variable domain of the antibody is linked to the polypeptide. In another embodiment, the VH domain of the antibody is linked to a first polypeptide, while the VL domain of the antibody is linked to a second polypeptide, which associates with the first polypeptide in a manner such that the VH domain and the VL domain can interact with each other to form an antigen binding site. In another embodiment, the VH domain and the VL domain are separated by a connector, thereby allowing the VH domain and the VL domain to interact with each other. The VH-connector-VL antibody is then linked to the polypeptide of interest. In addition, fusion antibodies can be produced in which two (or more) single-chain antibodies are linked to each other. This is useful if one wants to produce a bivalent or multivalent antibody on a single polypeptide chain or if one wants to produce a bispecific antibody.

[0457] In addition to binding to epitopes on IL27RA and gp130, the anti-IL27RA / gp130 antibodies of the present invention can also mediate biological activity against the bispecific anti-IL27RA / gp130 antibody mAb-4894, as shown in the Examples.

[0458] That is, the present invention includes isolated antibodies that specifically bind IL27RA and gp130 and mediate at least one detectable activity selected from:

[0459] i) Downregulation of pathogenic cytokine production. In some embodiments, anti-IL27RA / gp130 antibodies downregulate pathogenic cytokine production by reducing interleukin 17 production in, for example, type 17 (Th17) T helper cells, which can be measured by immunoassays and described in Example 9. Thus, in some embodiments, anti-IL27RA / gp130 antibodies have an IC50 of less than 0.05 nm as measured by the 11-17 immunoassay. In some embodiments, anti-IL27RA / gp130 antibodies have an IC50 of less than 0.01 nm as measured by the 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody has an IC50 of between 1 nm and 0.0001 nm, between 1 nm and 0.01 nm, between 0.1 nm and 0.0001 nm, between 0.1 nm and 0.001 nm, between 0.01 nm and 0.0001 nm, or between 0.01 nm and 0.001 nm, as measured by an 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody has an IC50 of between 0.01 nm and 0.001 nm, as measured by an 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody can downregulate pathogenic cytokine production by inhibiting T helper cell type 2 (Th2) responses, such as reducing interleukin 13 (IL-13) production and GATA-3 expression.

[0460] ii) promoting regulatory T cell differentiation, such as promoting the differentiation of natural Treg (nTreg) and inducible Treg (iTreg), as shown in Example 8. In some embodiments, iTreg is characterized by the expression of CD4+CD25+FOXP3+.

[0461] iii) Upregulating the expression of immune checkpoint molecules such as Tim-3, LAG-3, and IL-10. In some embodiments, the expression of IL-10, Tim-3, and LAG-3 can be measured both at transcript levels and protein levels, for example, by flow cytometry as described in Example 9.

[0462] iv) suppressing T cell proliferation;

[0463] v) induces programmed death-ligand 1 (PD-L1) expression in monocytes, which can be measured by flow cytometry and is described in Example 8; and

[0464] vii) upregulates indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression in colonic epithelial cells and / or mononuclear cells, which can be measured by measuring kynurenine (Kyn) production as a reflection of IDO1 activity by liquid chromatography-mass spectrometry (LC-MS) analysis, as described in Example 8. Thus, in some embodiments, the anti-IL27RA / gp130 antibodies have an EC50 of less than 100 nm for kynurenine acid production as measured by LC-MS analysis. In some embodiments, the anti-IL27RA / gp130 antibodies have an EC50 of less than 10 nm for kynurenine acid production as measured by LC-MS analysis. In some embodiments, the anti-IL27RA / gp130 antibodies have an EC50 of between 100 nm and 0.1 nm, between 100 nm and 1 nm, between 10 nm and 0.1 nm, or between 10 nm and 1 nm for kynurenine acid production as measured by LC-MS analysis. In some embodiments, the anti-IL27RA / gp130 antibody has an EC50 of between 10 nm and 1 nm as measured by LC-MS analysis of kynurenine acid production.

[0465] Thus, the bispecific antibodies disclosed herein, designated mAb-4894 in the examples, have the potential to downregulate pathogenic T helper 17 cells (Th17) while simultaneously upregulating cell surface markers associated with regulatory T cells (Tregs), and more specifically, upregulating both natural Tregs (nTregs) and inducible Tregs (iTregs). Furthermore, targeting both IL27RA and gp130 enables the reduction of type 2 cytokines and the upregulation of negative regulators on monocytes and dendritic cells. The bispecific IL27R agonist has a direct effect on primary human colonic epithelial cells, as evident by the upregulation of indoleamine-pyrrole 2,3-dioxygenase (IDO1), which is known to be associated with immunosuppression and mucosal healing.

[0466] In some embodiments, the bispecific antibody comprises a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0467] a. the first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3; and

[0468] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6.

[0469] In some embodiments, the bispecific antibody comprises a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein one or both of the following:

[0470] a. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0471] b. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0472] In some embodiments, the bispecific antibody comprises a first antigen binding site that binds to IL27RA and a second antigen binding site that binds to gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein:

[0473] a. The first antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 3;

[0474] b. The first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 6;

[0475] c. the second antigen-binding site VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VHCDR3 comprising the amino acid sequence of SEQ ID NO: 17; and

[0476] d. The second antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VLCDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0477] In some embodiments, the bispecific antibody comprises a first antigen-binding site that binds IL27RA and a second antigen-binding site that binds gp130, wherein the antibody comprises a first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:7, a first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:8, a second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:21, and a second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:22.

[0478] In some embodiments, the bispecific antibody comprises a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO:27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO:14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO:30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO:34.

[0479] Polynucleotides encoding the antibodies of the present invention

[0480] The present invention also provides polynucleotides encoding any of the antibodies of the present invention, including antibody portions and modified antibodies described herein. The present invention also provides methods for making any of the antibodies and polynucleotides described herein. Polynucleotides can be made and proteins expressed by procedures known in the art.

[0481] If necessary, the antibody of interest (monoclonal or polyclonal) can be sequenced and the polynucleotide sequence can then be cloned into a vector for expression or propagation. The sequence encoding the antibody of interest can be maintained in a vector in a host cell, and the host cells can then be amplified and frozen for future use. The production of recombinant monoclonal antibodies in cell culture can be carried out by cloning antibody genes from B cells using means known in the art. See, for example, Tiller et al., 2008, J. Immunol. Methods 329,112; U.S. Patent No. 7,314,622.

[0482] In some embodiments, a polynucleotide is provided herein that comprises a sequence encoding one or both of the heavy chain or light chain variable regions of an antibody provided herein. The sequence encoding the antibody of interest can be maintained in a vector in a host cell, and the host cell can be subsequently amplified and frozen for future use. Vectors (including expression vectors) and host cells are further described herein.

[0483] In some embodiments, the present invention provides a polynucleotide that encodes the amino acid sequence of any one of the antibodies listed in Table 13 or 14.

[0484] In one embodiment, the present invention provides a polynucleotide encoding the amino acid sequence of an anti-IL27RA antibody.

[0485] In some embodiments, the present invention provides a polynucleotide encoding one or more anti-IL27RA antibody heavy chain polypeptides comprising an amino acid sequence selected from SEQ ID NO: 13 or 27. In some embodiments, the present invention provides a polynucleotide encoding one or more anti-IL27RA antibody light chain polypeptides comprising an amino acid sequence of SEQ ID NO: 14.

[0486] In some embodiments, the present invention provides a polynucleotide encoding one or more anti-IL27RA antibody VH polypeptides comprising the amino acid sequence of SEQ ID NO: 7. In some embodiments, the present invention provides a polynucleotide encoding one or more anti-IL27RA antibody VL polypeptides comprising the amino acid sequence of SEQ ID NO: 8.

[0487] In some embodiments, the present invention provides a polynucleotide encoding one or more anti-gp130 antibody heavy chain polypeptides comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 23 or 30. In some embodiments, the present invention provides a polynucleotide encoding one or more anti-gp130 antibody light chain polypeptides comprising the amino acid sequence of SEQ ID NO: 24. In some embodiments, the present invention provides a polynucleotide encoding one or more anti-gp130 antibody VH polypeptides comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the present invention provides a polynucleotide encoding one or more anti-gp130 antibody VL polypeptides comprising the amino acid sequence of SEQ ID NO: 21.

[0488] In some embodiments, a polynucleotide encoding an anti-IL27RA antibody HC comprises the nucleic acid sequence of SEQ ID NO: 33. In some embodiments, a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 34. In some embodiments, the present invention provides polynucleotides encoding an anti-IL27RA antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 33 and an anti-IL27RA antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 34.

[0489] In some embodiments, a polynucleotide encoding an anti-IL27RA antibody HC comprises the nucleic acid sequence of SEQ ID NO: 39. In some embodiments, a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 34. In some embodiments, the present invention provides polynucleotides encoding an anti-IL27RA antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 39 and an anti-IL27RA antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 34.

[0490] In some embodiments, a polynucleotide encoding an anti-gp130 antibody HC comprises the nucleic acid sequence of SEQ ID NO: 37. In some embodiments, a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 38. In some embodiments, the present invention provides polynucleotides encoding an anti-gp130 antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 37 and an anti-gp130 antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 38.

[0491] In some embodiments, a polynucleotide encoding an anti-gp130 antibody HC comprises the nucleic acid sequence of SEQ ID NO: 40. In some embodiments, a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 38. In some embodiments, the present invention provides polynucleotides encoding an anti-gp130 antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 40 and an anti-gp130 antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 38.

[0492] In some embodiments, the present invention provides a polynucleotide encoding a heavy chain, a light chain, or both of an antibody that binds gp130, and wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both. In some embodiments, the present invention provides a polynucleotide encoding a heavy chain, a light chain, or both of an antibody that binds gp130, and wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0493] Those skilled in the art will appreciate that, due to the degeneracy of the genetic code, there are many nucleotide sequences encoding polypeptides as described herein. Some of these polynucleotides carry minimal homology to the nucleotide sequence of any natural gene. Nevertheless, the present invention particularly encompasses polynucleotides that vary due to differences in codon usage. In addition, alleles of genes comprising the polynucleotide sequences provided herein are within the scope of the present invention. Alleles are endogenous genes that vary due to one or more mutations (such as deletions, additions, or substitutions) of nucleotides. The resulting mRNA and protein may, but may not, have altered structures or functions. Alleles can be identified using standard techniques (such as hybridization, amplification, or database sequence comparisons).

[0494] In one embodiment, the VH and VL domains or full-length HC or LC are encoded by separate polynucleotides. Alternatively, the VH and VL or HC and LC are each encoded by a single polynucleotide.

[0495] The present invention also encompasses polynucleotides that are complementary to any such sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded and may be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include HnRNA molecules, which contain introns and correspond to DNA molecules in a one-to-one manner; and mRNA molecules, which do not contain introns. Other coding or non-coding sequences may, but need not, be present within the polynucleotides of the present invention, and polynucleotides may, but need not, be linked to other molecules or support materials.

[0496] Manufacturing method

[0497] Various techniques have been described for producing antibodies, including the traditional hybridoma method for making monoclonal antibodies, recombinant techniques for making antibodies (including chimeric, e.g., humanized, antibodies), antibody production in transgenic animals, and the more recently described phage display technology for making "fully human" antibodies.

[0498] Provided herein are methods for making any of the antibodies provided herein. The antibodies of the present invention can be made by procedures known in the art. The polypeptides can be produced by proteolysis or other degradation of the antibody, by recombinant methods as described above (i.e., single or fusion polypeptides), or by chemical synthesis. The polypeptides of the antibody (especially shorter polypeptides of up to about 50 amino acids) are preferably made by chemical synthesis. Methods for chemical synthesis are known in the art and are commercially available. For example, the antibody can be produced by an automated polypeptide synthesizer using a solid phase method. See also U.S. Patent Nos. 5,807,715; 4,816,567; and 6,331,415.

[0499] Any suitable method for making multispecific antibodies can be used to make the multispecific antibodies provided herein (eg, depending on the characteristics of the antibody and the choice of components).

[0500] According to a method for making a multispecific antibody, an antibody variable domain with the desired binding specificity is fused to an immunoglobulin constant region sequence. Preferably, the immunoglobulin heavy chain constant region comprising at least part of the hinge, CH2 and CH3 regions is fused. In some embodiments, the first heavy chain constant region (CH1) containing the light chain binding site may be present in at least one of the fusions. In some embodiments, polynucleotides encoding immunoglobulin heavy chain fusions and (if necessary) immunoglobulin light chains can be inserted into individual expression vectors and can be co-transfected into a suitable host organism. In other embodiments, when the expression of at least two polypeptide chains of equal ratios produces a high yield or when the ratio does not have a specific significance, the coding sequences of two or all three polypeptide chains can be inserted into one expression vector.

[0501] In one approach, multispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. This asymmetric structure, in which the immunoglobulin light chain is present in only half of the multispecific molecule, facilitates separation of desired multispecific compounds from undesirable immunoglobulin chain combinations. This approach is described in PCT Publication No. WO 94 / 04690.

[0502] In another approach, multispecific antibodies are constructed by modifying the amino acids in the first hinge region of one arm, where the substituted amino acids in the first hinge region have opposite charges to the corresponding amino acids in the second hinge region of the other arm. This approach is described in International Patent Application No. PCT / US2011 / 036419 (WO2011 / 143545).

[0503] In another approach, the formation of desired heteromultimeric or heterodimeric proteins (e.g., bispecific antibodies) is enhanced by altering or engineering the interface between a first Fc chain and a second Fc chain. In this approach, the multispecific antibody can be composed of a CH3 region, wherein the CH3 region comprises a first CH3 polypeptide and a second CH3 polypeptide, which interact together to form a CH3 interface, wherein one or more amino acids within the CH3 interface destabilize and electrostatically disfavor homodimer formation. This approach is described in International Patent Application No. PCT / US2011 / 036419 (WO2011 / 143545). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., (D221E or D221R)) and at position 409 in the CH3 region of human IgG1 (e.g., K409R (EU numbering scheme)), and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., D221 E or D221R) and at position 368 in the CH3 region of human IgG1 (e.g., L368E (EU numbering scheme)). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., (D221E or D221R)) and at position 409 in the CH3 region of human IgG2 (e.g., K409R (EU numbering scheme)), and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., (D221E or D221R) and at position 368 in the CH3 region of human IgG2 (e.g., L368E (EU numbering scheme)). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 (e.g., (D221E or D221R)) in the hinge region and at position 409 (e.g., K409R (EU numbering scheme)) in the CH3 region of human IgG4, and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 (e.g., D221E or D221R) in the hinge region and at position 368 (e.g., L368E (EU numbering scheme)) in the CH3 region of human IgG4.

[0504] In some embodiments, a multispecific antibody may have a knob-hole mutation in the Fc chain. For example, in some embodiments, in a bispecific antibody having a knob-hole mutation, the first Fc chain of the antibody Fc domain has one or more mutations to form a "knob," and the second Fc chain of the antibody Fc domain has one or more mutations to form a "hole" (or vice versa). Exemplary knob-hole engineering of antibodies is described in U.S. Patent No. 5,731,168, PCT Publication No. WO2009089004, U.S. Publication No. 20090182127, Marvin and Zhu, Acta Pharmacologica Sincia (2005) 26(6):649-658, and Kontermann (2005) Acta Pharacol. Sin., 26:1-9.

[0505] A "knob" refers to at least one amino acid side chain that protrudes from the interface of a first polypeptide (e.g., a first Fc chain) and can therefore be positioned in a compensatory hole in a neighboring second polypeptide (e.g., a second Fc chain) to stabilize the heterodimer and thereby promote heterodimer formation rather than homodimer formation. The knob may be present in the native interface or may be introduced synthetically (e.g., by altering the nucleic acid encoding the interface). Typically, the nucleic acid encoding the interface of the first polypeptide is altered to encode the knob. To achieve this, the nucleic acid encoding at least one native amino acid residue in the first polypeptide is replaced with a nucleic acid encoding at least one "import" amino acid residue having a larger side chain volume than the native amino acid residue. Certain import residues used to form the knob are typically naturally occurring amino acid residues and are preferably selected from arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W).

[0506] A "hole" refers to at least one amino acid side chain that is recessed from the interface of a second polypeptide (e.g., a second constant domain) and thereby accommodates a corresponding knob in an adjacent first polypeptide (e.g., a first constant domain). The hole may be present in the original interface or may be introduced synthetically (e.g., by altering the nucleic acid encoding the interface). Typically, the nucleic acid encoding the interface of the second polypeptide is altered to encode the hole. To achieve this, the nucleic acid encoding at least one original amino acid residue of the second polypeptide is replaced with DNA encoding at least one "import" amino acid residue having a smaller side chain volume than the original amino acid residue. Certain import residues used to form the hole are typically naturally occurring amino acid residues and are preferably selected from alanine (A), serine (S), threonine (T), and valine (V).

[0507] As used herein, the term "interface" generally refers to any amino acid residue present in a domain that can be involved in the contact point between a first polypeptide and a second polypeptide. A "native amino acid" residue is a residue that can be replaced by an "imported amino acid" residue having a side chain volume that is smaller or larger than the original residue. The imported amino acid residue can be a naturally occurring or non-naturally occurring amino acid residue, but the former is preferred. "Naturally occurring" amino acid residues are those residues encoded by the genetic code. "Non-naturally occurring" amino acid residues are residues that are not encoded by the genetic code but are capable of covalently binding to adjacent amino acid residues in a polypeptide chain. Examples of non-naturally occurring amino acid residues are norleucine, ornithine, norvaline, homoserine and other amino acid residue analogs, such as those described in Ellman et al., Meth. Enzym. 202: 301-336 (1991).

[0508] The polynucleotides of the present invention can be obtained using chemical synthesis, recombinant methods or PCR. Chemical polynucleotide synthesis methods are well known in the art and need not be described in detail herein. Those skilled in the art can use the sequences provided herein and commercial DNA synthesizers to generate the desired DNA sequence.

[0509] To prepare polynucleotides using recombinant methods, a polynucleotide comprising the desired sequence can be inserted into a suitable vector, and the vector can be introduced into a suitable host cell for replication and amplification, as further discussed herein. The polynucleotide can be inserted into the host cell by any method known in the art. Cells are transformed by introducing the exogenous polynucleotide using direct uptake, endocytosis, transfection, F-pairing, or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrating vector (such as a plasmid) or integrated into the host cell genome.

[0510] Suitable cloning vectors can be constructed according to standard techniques or can be selected from a large number of cloning vectors available in the art. Although the selected cloning vector can vary depending on the host cell to be used, suitable cloning vectors will generally have one or more characteristics, such as i) the ability to self-replicate, ii) a single target for a specific restriction endonuclease, or iii) a gene that can carry a marker that can be used to select clones containing the vector. Suitable examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors (such as pSA3 and pAT28). These and many other cloning vectors are available from commercial suppliers such as BioRad, Strategene, and Invitrogen.

[0511] An expression vector is further provided. An expression vector is generally a replicable polynucleotide construct containing a polynucleotide according to the present invention. This means that the expression vector must be replicable in the host cell as an episome or as an integral part of the chromosomal DNA. Suitable expression vectors include, but are not limited to, plasmids, viral vectors (including adenoviruses, adeno-associated viruses, retroviruses), cosmids, and the expression vectors disclosed in PCT Publication No. WO 87 / 04462. Vector components may generally include, but are not limited to, one or more of the following: a signal sequence; an origin of replication; one or more marker genes; suitable transcription control components (such as promoters, enhancers, and terminators). For expression (i.e., translation), one or more translation control components, such as ribosome binding sites, translation initiation sites, and stop codons, are also generally required.

[0512] Vectors containing the polynucleotide of interest can be introduced into host cells by any of a number of appropriate means, including electroporation; transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; and infection (for example, where the vector is an infectious agent such as vaccinia virus). The choice of vector or polynucleotide to be introduced will often depend on the characteristics of the host cell.

[0513] The present invention also provides host cells comprising any of the polynucleotides described herein. Any host cell capable of overexpressing heterologous DNA can be used to isolate genes encoding antibodies, polypeptides, or proteins of interest. Non-limiting examples of mammalian host cells include, but are not limited to, COS, HeLa, and CHO cells. See also PCT Publication No. WO 87 / 04462. Suitable non-mammalian host cells include prokaryotes (such as Escherichia coli (E. coli) or Bacillus subtilis (B. subtillis)) and yeasts (such as Saccharomyces cerevisiae (S. cerevisiae), S. pombe (S. pombe), or Kluyveromyces lactis (K. lactis)).

[0514] In addition, any number of commercially available and non-commercially available cell lines expressing polypeptides or proteins may be used in accordance with the present invention. Those skilled in the art will appreciate that different cell lines may have different nutritional requirements or may require different culture conditions for optimal growth and polypeptide or protein expression and will be able to modify the conditions as needed.

[0515] Pharmaceutical compositions

[0516] In another embodiment, the present invention comprises a pharmaceutical composition.

[0517] A "pharmaceutical composition" refers to a mixture of an antibody of the invention and one or more excipients.

[0518] The pharmaceutical compositions of the present invention may be in a variety of forms. These include, for example, liquid, semisolid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, and lyophilized powders. The form depends on the intended mode of administration and therapeutic application.

[0519] Other excipients and modes of administration known in the pharmaceutical technology may also be used. The pharmaceutical compositions of the present invention can be prepared by any of the well-known pharmaceutical techniques, such as effective formulation and administration procedures. The above considerations for effective formulation and administration procedures are well known in the art and are described in standard textbooks. The formulation of drugs is discussed in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania, 1975; Liberman et al., ed., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Kibbe et al., ed., Handbook of Pharmaceutical Excipients (3rd edition), American Pharmaceutical Association, Washington, 1999.

[0520] Acceptable excipients are nontoxic to recipients at the dosages and concentrations employed and may include buffers such as phosphate, citric acid, and other organic acids; salts such as sodium chloride; antioxidants including ascorbic acid and methionine; preservatives such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; chloride); benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); or nonionic surfactants such as TWEEN®. TM 、PLURONICS TM or polyethylene glycol (PEG).

[0521] Therapeutic, diagnostic and other methods

[0522] The antibodies and antibody conjugates of the invention are useful in a variety of applications, including, but not limited to, therapeutic treatment methods and diagnostic treatment methods.

[0523] In some embodiments, the antibodies of the present invention can stimulate or modulate the activity of the IL27 receptor and can be used to treat, prevent, inhibit and improve inflammatory diseases, such as IBD or diseases, disorders and conditions mediated by IL27. In another embodiment, the antibodies of the present invention can stimulate or modulate the activity of the IL27 receptor and can be used to treat, prevent, inhibit and improve multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes or cancer.

[0524] In one aspect, the present invention provides a method for treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes or cancer. In one aspect, the present invention provides a method for treating inflammatory bowel disease (IBD). In some embodiments, the method for treating individual inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes or cancer comprises administering an effective amount of a pharmaceutical composition comprising any one of the antibodies as described herein to an individual in need. In some embodiments, a method for treating individual IBD is provided, comprising administering an effective amount of a composition comprising an antibody provided herein to an individual in need.

[0525] In another aspect, the present invention further provides antibodies or pharmaceutical compositions as described herein for use in the methods described for treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer. In another aspect, the present invention further provides antibodies or pharmaceutical compositions as described herein for use in the methods described for treating autoimmune diseases. In another aspect, the present invention further provides antibodies or pharmaceutical compositions as described herein for use in the methods described for treating inflammatory bowel disease (IBD). In another aspect, the present invention further provides antibodies or pharmaceutical compositions as described herein for use in the methods described for treating ulcerative colitis or Crohn's disease. In another aspect, the present invention further provides antibodies or pharmaceutical compositions as described herein for use in the methods described for treating ulcerative colitis. The present invention also provides use of an antibody as described herein for the manufacture of a medicament for treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer.

[0526] In another aspect, methods are provided for detecting, diagnosing, or monitoring one or more of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer. For example, the antibodies described herein can be labeled with a detectable moiety such as an imaging agent and an enzyme substrate label. The antibodies described herein can also be used in in vivo diagnostic assays, such as in vivo imaging (e.g., PET or SPECT) or staining reagents.

[0527] For all methods described herein, reference to antibodies also includes pharmaceutical compositions comprising the antibodies and one or more additional agents.

[0528] Application and dosing

[0529] Typically, the antibodies of the invention are administered in an amount effective to treat the conditions as described herein.Antibodies of the invention can be administered as the antibodies themselves, or alternatively, in the form of a pharmaceutical composition containing the antibodies.

[0530] The antibodies of the invention are administered by any appropriate route in the form of pharmaceutical compositions suitable for such route and in doses effective for the intended treatment.

[0531] In some embodiments, the antibody can be administered parenterally, for example, directly into the bloodstream, into a muscle, or into an internal organ. Suitable modes of parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, ​​intrasternal, intracranial, intramuscular, and subcutaneous. In one embodiment, the antibody can be administered subcutaneously. Suitable devices for parenteral administration include needle (including microneedle) syringes, needle-free syringes, and infusion techniques.

[0532] In another embodiment, the compounds of the present invention may also be administered topically to the skin or mucous membranes, i.e., transdermally or transdermally. In another embodiment, the compounds of the present invention may also be administered intranasally or by inhalation. In another embodiment, the compounds of the present invention may also be administered rectally or vaginally. In another embodiment, the compounds of the present invention may also be administered directly to the eye or ear.

[0533] The dosage regimen of the antibodies of the present invention or compositions containing such antibodies is based on a variety of factors, including the type, age, weight, sex, and medical condition of the individual; the severity of the condition; the route of administration; and the activity of the specific antibody employed. Thus, the dosage regimen can vary widely. In one embodiment, for the treatment of the indicated conditions discussed herein, the total daily dose of the antibodies of the present invention is generally from about 0.01 to about 100 mg / kg (i.e., mg of the antibody of the present invention per kg of body weight). In another embodiment, the total daily dose of the antibodies of the present invention is from about 0.1 to about 50 mg / kg, and in another embodiment from about 0.5 to about 30 mg / kg.

[0534] The antibodies of the invention may be used alone or in combination with one or more other therapeutic agents.The invention provides any of the uses, methods or compositions as defined herein, wherein the antibodies of the invention are used in combination with one or more other therapeutic agents discussed herein.

[0535] Administering two or more agents "in combination" means that all agents are administered close enough in time to affect treatment of the individual. The two or more agents can be administered simultaneously or sequentially. Additionally, simultaneous administration can be performed by mixing the agents prior to administration or by administering the agents in separate dosage forms at the same time point but at the same or different administration sites.

[0536] Various formulations of the antibodies of the present invention (e.g., one or more of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibodies) can be used for administration. In some embodiments, the antibodies can be administered in pure form. In some embodiments, the antibodies and pharmaceutically acceptable excipients can be in various formulations. Pharmaceutically acceptable excipients are known in the art and are relatively inert substances that facilitate the administration of pharmacologically effective substances. For example, an excipient can provide form or consistency, or act as a diluent. Suitable excipients include, but are not limited to, stabilizers, wetting agents and emulsifiers, salts that change osmotic concentration, encapsulating agents, buffers, and skin penetration enhancers. Excipients and formulations for parenteral and enteral drug delivery are described in Remington, The Science and Practice of Pharmacy, 21st edition, Mack Publishing, 2005.

[0537] In some embodiments, these agents are formulated for administration by injection (e.g., intraperitoneal, intravenous, subcutaneous, intramuscular, etc.). Thus, these agents can be combined with pharmaceutically acceptable vehicles such as saline, Ringer's solution, dextrose solution, and the like. The specific dosing regimen, i.e., dosage, timing, and repetition, will depend on the particular individual and that individual's medical history.

[0538] Antibodies as described herein (e.g., one or more of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibodies) can be administered using any suitable method, including by injection (e.g., intraperitoneally, intravenously, subcutaneously, intramuscularly, etc.). Antibodies, such as monoclonal antibodies or multispecific antibodies, are also administered via inhalation as described herein. In general, for administration of the antibodies of the invention, the dosage depends on the host being treated and the particular mode of administration. In one embodiment, the dosage range of the antibodies of the invention will be from about 0.001 μg / kg body weight to about 20,000 μg / kg body weight. The term "body weight" is applicable when treating patients. When treating isolated cells, as used herein, "body weight" refers to "total cell weight." The term "total body weight" can be applied to both isolated cells and patient treatment. All concentrations and treatment (treatment) levels expressed as "body weight" or simply "kg" in this application are also considered to encompass similar "total cell weight" and "total body weight" concentrations. However, one of ordinary skill in the art will recognize the utility of various dosage ranges, for example, 0.01 μg / kg to 20,000 μg / kg body weight, 0.02 μg / kg to 15,000 μg / kg body weight, 0.03 μg / kg to 10,000 μg / kg body weight, 0.04 μg / kg to 5,000 μg / kg body weight, 0.05 μg / kg to 2,500 μg / kg body weight, 0.06 μg / kg to 1,000 μg / kg body weight, 0.07 μg / kg to 500 μg / kg body weight, 0.08 μg / kg to 400 μg / kg body weight, 0.09 μg / kg to 200 μg / kg body weight, or 0.1 μg / kg to 100 μg / kg body weight.In addition, those skilled in the art will recognize that a variety of different dosage levels will be used, for example, one or more selected from the group consisting of 0.0001 μg / kg, 0.0002 μg / kg, 0.0003 μg / kg, 0.0004 μg / kg, 0.005 μg / kg, 0.0007 μg / kg, 0.001 μg / kg, 0.1 μg / kg, 1.0 μg / kg, 1.5 μg / kg, 2.0 μg / kg, 5.0 μg / kg, 10.0 μg / kg, 15.0 μg / kg, 30.0 μg / kg, 50 μg / kg, 75 μg / kg, 80 μg / kg, 90 μg / kg, 100 μg / kg, 120 μg / kg, 140 μg / kg, 150 μg / kg.

[0014] The present invention provides an antibody that is administered at a dosage of 100 mg / kg to a subject having the antibody of interest. The antibody that is administered at a dosage of 100 mg / kg to a subject having the antibody of interest is preferably administered at a dosage of 100 mg / kg to a subject having the antibody of interest. The antibody that is administered at a dosage of 100 mg / kg to a subject having the antibody of interest is preferably administered at a dosage of 100 mg / kg to a subject having the antibody of interest. The antibody that is administered at a dosage of 100 mg / kg to a subject having the antibody of interest is preferably administered at a dosage of 100 mg / kg to a subject having the antibody of interest. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of symptoms occurs or until sufficient therapeutic levels are achieved.

[0539] Generally speaking, for administration of the antibodies provided herein, candidate dosages can be administered daily, weekly, every other week, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every ten weeks, every twelve weeks, or more than every twelve weeks.

[0540] In some embodiments, the dosage range of the candidate dose administered daily is from about 1 μg / kg to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For example, daily doses of about 0.01 mg / kg, about 0.03 mg / kg, about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, and about 25 mg / kg can be used.

[0541] In some embodiments, the dosage range of the candidate dose administered weekly is from about 1 μg / kg to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For example, weekly doses of about 0.01 mg / kg, about 0.03 mg / kg, about 0.1 mg / kg, about 0.3 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, and about 30 mg / kg can be used.

[0542] In some embodiments, the dosage range for candidate doses administered every two weeks is from about 1 μg / kg to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For example, a biweekly dosage of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, and about 30 mg / kg can be used.

[0543] In some embodiments, the dosage range for candidate doses administered every three weeks is any one of about 1 μg / kg to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For example, a three-week dosage of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, and about 50 mg / kg can be used.

[0544] In some embodiments, the dosage range for candidate doses administered monthly or every four weeks is from about 1 μg / kg to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For example, monthly doses of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, and about 50 mg / kg can be used.

[0545] In other embodiments, depending on the factors mentioned above, the dosage range of the candidate dose is from about 0.01 mg to about 1200 mg or more per day. For example, a daily dose of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg or about 1200 mg can be used. In one embodiment, a daily dose between 0.01 mg and 100 mg can be used. In one embodiment, a daily dose between 0.01 mg and 1 mg can be used. In one embodiment, a daily dose between 0.1 mg and 100 mg can be used. In one embodiment, a daily dose between 1 mg and 100 mg can be used.

[0546] In other embodiments, depending on the factors mentioned above, the dosage range of the candidate dose is from about 0.01 mg to about 2000 mg or more per week. For example, a weekly dose of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg or 2000 mg can be used. In one embodiment, a weekly dose between 0.01 mg and 0.1 mg can be used. In one embodiment, a weekly dose between 0.01 mg and 100 mg can be used. In one embodiment, a weekly dose between 0.01 mg and 1 mg may be used. In one embodiment, a weekly dose between 0.1 mg and 100 mg may be used. In one embodiment, a weekly dose between 1 mg and 100 mg may be used.

[0547] In other embodiments, depending on the factors mentioned above, the dosage range of the candidate dose is about 0.01 mg to about 2000 mg or more every two weeks. For example, a dose of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg or 2000 mg can be used. In one embodiment, a dose of between 0.01 mg and 0.1 mg every two weeks can be used. In one embodiment, a dose of between 0.01 mg and 100 mg every two weeks can be used. In one embodiment, a biweekly dose of between 0.01 mg and 1 mg may be used. In one embodiment, a biweekly dose of between 0.1 mg and 100 mg may be used. In one embodiment, a biweekly dose of between 1 mg and 100 mg may be used.

[0548] In other embodiments, the dosage range for candidate doses administered every three weeks is from about 0.01 mg to about 2500 mg or more, depending on the factors mentioned above. For example, a three-week dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, about 2000 mg, about 2100 mg, about 2200 mg, about 2300 mg, about 2400 mg, or about 2500 mg can be used. In one embodiment, a dosage of between 0.01 mg and 0.1 mg every three weeks may be used. In one embodiment, a dosage of between 0.01 mg and 100 mg every three weeks may be used. In one embodiment, a dosage of between 0.01 mg and 1 mg every three weeks may be used. In one embodiment, a dosage of between 0.1 mg and 100 mg every three weeks may be used. In one embodiment, a dosage of between 1 mg and 100 mg every three weeks may be used.

[0549] In other embodiments, candidate dosages range from about 0.01 mg to about 3000 mg or more administered every four weeks or monthly, depending on the factors mentioned above. For example, a monthly dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, about 2000 mg, about 2100 mg, about 2200 mg, about 2300 mg, about 2400 mg, about 2500 mg, about 2600 mg, about 2700 mg, about 2800 mg, about 2900 mg, or about 3000 mg can be used. In one embodiment, a monthly dose of between 0.01 mg and 0.1 mg may be used. In one embodiment, a monthly dose of between 0.01 mg and 100 mg may be used. In one embodiment, a monthly dose of between 0.01 mg and 1 mg may be used. In one embodiment, a monthly dose of between 0.1 mg and 100 mg may be used. In one embodiment, a monthly dose of between 1 mg and 100 mg may be used.

[0550] Other dosing schedules may also be suitable, depending on the pharmacokinetic decay pattern that the physician wishes to achieve. In one embodiment, the antibodies of the invention are administered with an initial priming dose, followed by higher and / or continuous substantially constant doses. In some embodiments, dosing is contemplated one to four times a week. In other embodiments, dosing is contemplated once a month, or once every other month, or once every three months. The progress of this therapy is easily monitored by conventional techniques and analysis. The dosing schedule may vary over time.

[0551] For the purposes of the present invention, the appropriate dosage of an antibody (e.g., one or more selected from the group consisting of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibodies) will depend on the antibody or composition thereof employed, the type and severity of the symptom to be treated, whether the agent is being administered for therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, the patient's clearance of the administered agent, and the judgment of the attending physician. Typically, the clinician will administer the antibody until a dose that achieves the desired result is reached. The dose and / or frequency may vary over the course of treatment. Empirical considerations, such as half-life, will generally help determine the dosage. For example, antibodies compatible with the human immune system (such as humanized antibodies or fully human antibodies) can be used to extend the half-life of the antibody and prevent the antibody from being attacked by the host's immune system. The frequency of administration can be determined and adjusted during treatment, and is typically, but not necessarily, based on the treatment and / or suppression and / or amelioration and / or delay of symptoms. Alternatively, a sustained continuous release formulation of the antibody may be appropriate. Various formulations and devices for achieving sustained release are known in the art.

[0552] In one embodiment, the dosage of an antibody (e.g., one or more selected from the group consisting of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibodies) can be determined empirically in a subject who has been given one or more administrations of the antibody. Increasing doses of the antibody are given to the subject. To assess efficacy, indicators of disease can be tracked.

[0553] In some embodiments, an antibody provided herein (e.g., one or more selected from the group consisting of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibodies) can be administered to an individual who has previously received one or more antibodies selected from the group consisting of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibody therapeutics for disease treatment. In some embodiments, an antibody provided herein can be administered to an individual who has previously received an antibody selected from the group consisting of anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibody therapeutics for disease treatment, and the previous anti-IL27RA, anti-gp130, and anti-IL27A / gp130 antibody therapeutic had limited or no efficacy in the individual (e.g., where the individual's disease is resistant to treatment with the previous therapeutic).

[0554] Depending on the physiological condition of the recipient, whether the purpose of administration is therapeutic or prophylactic, and other factors known to skilled physicians, the administration of antibodies according to the methods of the present invention may be, for example, continuous or intermittent. Administration of the antibody may be substantially continuous over a preselected period of time or may be in a series of spaced doses. Therapeutic formulations of the antibodies used according to the present invention are prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing the antibody having the desired purity with a pharmaceutically acceptable carrier, excipient, or stabilizer, as appropriate (Remington, The Science and Practice of Pharmacy 21st edition, Mack Publishing, 2005). Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and may include buffers such as phosphate, citric acid, and other organic acids; salts such as sodium chloride; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexahydroxyquaternium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol, or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins , such as serum albumin, gelatin or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).

[0555] Reagent test kit

[0556] Another aspect of the present invention provides a kit comprising an antibody of the present invention or a pharmaceutical composition comprising the antibody. In addition to the antibody of the present invention or its pharmaceutical composition, the kit may also include a diagnostic agent or a therapeutic agent. The kit may also include instructions for use of the diagnostic or therapeutic method. In some embodiments, the kit includes the antibody or its pharmaceutical composition and a diagnostic agent. In other embodiments, the kit includes the antibody or its pharmaceutical composition and one or more therapeutic agents.

[0557] In yet another embodiment, the invention comprises a kit suitable for performing the treatment methods described herein. In one embodiment, the kit contains a first dosage form comprising one or more of the antibodies of the invention in an amount sufficient to perform the methods of the invention. In another embodiment, the kit comprises one or more antibodies of the invention in an amount sufficient to perform the methods of the invention, and at least a first container for the first dose and a second container for the second dose.

[0558] Another aspect of the invention is a kit comprising one or more anti-IL27RA, anti-gp130, and anti-IL27RA / gp130 antibodies selected from the group consisting of the above-disclosed anti-IL27RA, anti-gp130, and anti-IL27RA / gp130 antibodies and instructions for use according to any of the methods of the invention described herein. Generally, such instructions include a description of the administration of one or more anti-IL27RA, anti-gp130, and anti-IL27RA / gp130 antibodies for the above-disclosed therapeutic treatments.

[0559] Another aspect of the invention is a kit comprising an anti-IL27RA / gp130 antibody as disclosed herein above and instructions for use according to any of the methods of the invention described herein.

[0560] The following examples, which are used to practice specific aspects of the present invention, are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0561] The foregoing description and the following examples detail certain specific embodiments of the present invention and describe the best mode contemplated by the inventors. However, it will be appreciated that no matter how detailed the foregoing is presented in words, the present invention may be practiced in many ways, and the present invention should be interpreted in accordance with the appended claims and any equivalents thereof.

[0562] Although the disclosed teachings have been described with reference to various applications, methods, kits, and compositions, it will be appreciated that various variations and modifications may be made without departing from the teachings herein and the invention claimed below. The following examples are provided to better illustrate the teachings of the present invention and are not intended to limit the scope of the teachings presented herein. Although the present teachings have been described in terms of these exemplary embodiments, those skilled in the art will readily appreciate that numerous variations and modifications of these exemplary embodiments are possible without undue experimentation. All such variations and modifications are within the scope of the present teachings.

[0563] Biological Deposits

[0564] Representative materials of the present invention were deposited on December 17, 2021 at the American Type Culture Collection, 10801 University Boulevard, Manassas, VA 20110-2209, USA.

[0565] The vector "mAb-4894 IL267RA VH" having ATCC Accession No. PTA-127622 contains a DNA insert encoding "mAb-4894 IL267RA VH." The vector "mAb-4894 IL267RA VL" having ATCC Accession No. PTA-127623 contains a DNA insert encoding "mAb-4894 IL267RA VL." The vector "mAb-4894 IL267RA HC" having ATCC Accession No. PTA127626 contains a DNA insert encoding "mAb-4894 IL267RA HC." The vector "mAb-4894 IL267RA LC" having ATCC Accession No. PTA-127627 contains a DNA insert encoding "mAb-4894 IL267RA LC."

[0566] The vector "mAb-4894gp130 VH" with ATCC accession number PTA-127624 contains a DNA insert encoding "mAb-4894gp130 VH". The vector "mAb-4894gp130 VL" with ATCC accession number PTA-127625 contains a DNA insert encoding "mAb-4894gp130 VL". The vector "mAb-4894gp130 HC" with ATCC accession number PTA127628 contains a DNA insert encoding "mAb-4894gp130 HC". The vector "mAb-4894gp130 LC" with ATCC accession number PTA-127629 contains a DNA insert encoding "mAb-4894gp130 LC".

[0567] describe Antibody ATCC accession number IL27RA-VH mAb-4894IL267RA VH PTA-127622 IL27RA-VL mAb-4894IL267RA VL PTA-127623 gp130-VH mAb-4894gp130 VH PTA-127624 gp130-VL mAb-4894gp130 VL PTA-127625 IL27RA-HC mAb-4894IL267RA HC PTA-127626 IL27RA-LC mAb-4894IL267RA LC PTA-127627 gp130-HC mAb-4894gp130 HC PTA-127628 gp130-LC mAb-4894gp130 LC PTA-127629

[0568] The deposit is made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the regulations thereunder (Budapest Treaty). This guarantees the maintenance of viable cultures of the deposit for 30 years from the date of deposit. The deposit will be made by ATCC under the terms of the Budapest Treaty and is subject to an agreement between Pfizer Inc. and ATCC, which provides for perpetual and unrestricted public access to the progeny of the deposited cultures upon the issuance of the associated U.S. patent or upon the public disclosure of any U.S. or foreign patent application, whichever occurs first, and for access to the progeny of the deposited cultures as determined by the authorized U.S. Commissioner of Patents and Trademarks under 35 U.S.C. Section 122 and the Commissioner's Rules thereunder (including 37 C.F.R. Section 1.14, with specific reference to 886 OG 638).

[0569] The assignee of this application has agreed that if a culture of the deposited material dies or is lost or destroyed while being grown under suitable conditions, the material will be replaced with other identical material upon notification. The availability of the deposited material should not be construed as a license to practice the invention in violation of the rights granted by any government under its patent laws.

[0570] The present invention provides a polynucleotide encoding IL27RA-VH encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127622.

[0571] The present invention provides a polynucleotide encoding IL27RA-VL encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0572] The present invention provides a polynucleotide encoding the IL27RA-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and the IL27RA-VL sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0573] The present invention provides a polynucleotide encoding IL27RA-HC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626.

[0574] The present invention provides a polynucleotide encoding IL27RA-LC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0575] The present invention provides a polynucleotide encoding the IL27RA-HC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and the IL27RA-LC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0576] The present invention provides a polynucleotide encoding gp130-VH encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127624.

[0577] The present invention provides a polynucleotide encoding gp130-VL encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0578] The present invention provides a polynucleotide encoding the gp130-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and the gp130-VL sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0579] The present invention provides a polynucleotide encoding gp130-HC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628.

[0580] The present invention provides a polynucleotide encoding gp130-LC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0581] The present invention provides a polynucleotide encoding the gp130-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and the gp130-LC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0582] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622.

[0583] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a light chain variable region (IL27RA-VL) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0584] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

[0585] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626.

[0586] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a light chain (IL27RA-LC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0587] The present invention provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

[0588] The present invention provides an isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624.

[0589] The present invention provides an isolated antibody that specifically binds to gp130, comprising a light chain variable region (gp130-VL) encoded by a plasmid deposited with the ATCC and having ATCC Accession No. PTA-127625.

[0590] The present invention provides an isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0591] The present invention provides an isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) encoded by a plasmid deposited with the ATCC and having ATCC Accession No. PTA-127628.

[0592] The present invention provides an isolated antibody that specifically binds to gp130, comprising a light chain (gp130-LC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0593] The present invention provides an isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0594] The present invention provides an isolated antibody that specifically binds to IL27RA and gp130, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623, and further comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

[0595] The present invention provides an isolated antibody that specifically binds to IL27R and gp130, comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627, and further comprising a heavy chain (gp130-VH) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

[0596] Example

[0597] In order to better understand the present invention, the following examples are described. These examples are for illustrative purposes only and should not be interpreted as limiting the scope of the present invention in any way.

[0598] Example 1. Production of gp130 / IL27a / il27 recombinant protein

[0599] Production of recombinant antigens for immunization and hybridoma screening

[0600] The human gp130 and IL27RA receptor extracellular domain (ECD) complex-Fc fusion (huGP130_IL27RA knob and hole huFc) was generated by transfection of two expression plasmids: one encoding the hugp130 ECD fused to a human Fc with a knob mutation in the CH3 region (VEC-40821: CID1452-IgVHSS_huGP130_ECD_TEV_knobFc_2xST), and the other encoding the IL27RA ECD fused to a human Fc with a hole mutation in its CH3 region (VEC-40820: CID1451-IgVHSS_huIL27R_ECD_TEV_holeFc_Flag). The knob and hole mutations in the Fc region promote efficient heterodimeric complex formation between the gp130 and IL27RA Fc fusions via knob and hole interactions within the respective Fc regions.

[0601] Expi293F TM Cells (Gibco A14527) were propagated in expression medium (Gibco A14351) in non-baffled shake flasks at 8.0% CO₂, 36°C, and rotation at 120 RPM in a Kuhner ISF1-X incubator. One day prior to transfection, cell cultures were diluted to 1.6E6 / ml in non-baffled shake flasks or Sartorius Wave cell culture bags. If necessary, the cell culture was adjusted to 3.0E6 / ml on the day of transfection. Immediately prior to transfection, expression plasmid DNA (1.3 mg / L cell culture) and polyethyleneimine (2.6 mg / L cell culture, Polyscience, 24765) were diluted separately in OptiMEM (Gibco 31985-070) and then filtered through a 0.2 μM filter. After incubation at room temperature for 5 minutes, the diluted reagents were combined and incubated for an additional 6 minutes at room temperature before being added to the cell culture. 2.5 hours after transfection, valproic acid (Sigma P4543) was added to a final concentration of 3 mM. 120 hours after transfection, the cell culture was transferred to a sterile 1 L Nalgene bottle and centrifuged at 1-3,000 × g for 5-10 min. The clarified conditioned medium was filtered through a 0.8 / 0.2 μM depth filter (Sartopore 2XLG) before further processing or storage at -20°C.

[0602] Conditioned culture medium was bound in batches to protein A resin (MabSelect SuRe, Cytiva), equilibrated, and washed in buffer A (PBS containing 20 mM imidazole). Bound proteins were eluted using buffer B (150 mM glycine pH 3.5, 40 mM NaCl), which was immediately neutralized with 10% 1 M Tris-HCl pH 8.0. Fractions containing the protein of interest were pooled, concentrated using a 10K MWCO Amicon Ultra concentrator (Millipore), and applied to a HiLoad Superdex S200 16 / 60 pg column (Cytiva).

[0603] In addition, the expression and purification of recombinant cynomolgus monkey (cyno) huGP130_IL27RA knob and hole Fc proteins were performed in a similar manner.

[0604] Production of recombinant IL27 ligands for activity analysis

[0605] The IL27 ligand consists of two subunits: p28 and Ebi3. It produces two forms of ligand complexes:

[0606] 1. Single Fc format:

[0607] IL27 huIL27p28_C107S_L212C_CH23LSFc_His6 / huEBI3_M99C_Flag, as described below. Figure 6 As shown in .

[0608] The IL27 p28 single Fc construct sequence is provided as SEQ ID NO: 49 and the EBI3 construct sequence is provided as SEQ ID NO: 50

[0609] Expression was performed in a manner similar to that described for the antigen, and purification proceeded as follows: CM was batch-bound to Protein A resin washed with 15 CV of Buffer A (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.47 mM KH2PO4, 20 mM imidazole). Samples were eluted using a low pH buffer (Buffer B: 150 mM glycine, pH 3.5, 40 mM NaCl) and neutralized with Buffer C (1 M Tris, pH 8) at a 1:10 V:V ratio (buffer to sample). The different fractions were then run on a gel, and those containing protein were pooled and concentrated using a 10K MWCO Amicon Ultra 4 tube. Final purification was performed at 4°C using a HiLoad Superdex column equilibrated with PBS + 1 M NaCl. The collected fractions were run on a gel, and those containing protein were pooled. Analytical SEC was performed on the final sample using the equilibration buffer (PBS or PBS with 1 M NaCl).

[0610] Heterodimeric pestle and mortar form:

[0611] IL27_huIL27A_C107S_L212C_TEV_knobFc_His6 / huEBI3_M99C_Flag / Hole as Figure 7 is shown as empty.

[0612] EBI3 is provided as SEQ ID NO: 50. IL27 p28 Fc knob [knob mutation Y349C-T366W] is provided as SEQ ID NO: 51. Fc hole (empty) [hole mutation S354C-T366S-L368A-Y407V] is provided as SEQ ID NO: 52.

[0613] Expression was performed in a similar manner to that described for the antigen, and the purification process was as follows: CM was bound in batches to a protein A resin washed with 15CV buffer A (PBS). The sample was eluted using a low pH buffer (buffer B, 150mM glycine pH 3.5, 40mM NaCl) and neutralized with buffer C (1M Tris pH 8) at a 1:10 V:V ratio (buffer relative to sample). The different fractions were then run on a gel and those fractions with protein were pooled and concentrated using a 10K MWCO Amicon Ultra 4 tube. The protein was then bound in batches to an anti-flag resin (10 ml) washed with PBS. After overnight batch binding, the protein was eluted with low pH buffer B and neutralized with buffer C (1:10 V:V ratio, buffer relative to sample). The different fractions were then run on a gel and those fractions with protein were pooled and concentrated using a 10K MWCO Amicon Ultra 4 tube. Final purification was performed using a HiLoad Superdex column equilibrated with PBS at 4° C. The collected fractions were run on a gel and those containing protein were pooled and stored at −80° C.

[0614] Example 2. Derivation of IL27RA and gp130 Binding Domains via Hybridoma Methods

[0615] Generation and isolation of monoclonal antibodies binding to human and macaque gp130 from humanized mice

[0616] AlivaMab κλ mice were immunized once a week with a mixture of soluble hIL-27RA-gp130 knob and hole hFc protein and TLR agonists as adjuvants. They were immunized according to the following schedule shown in Table 1 below:

[0617] Table 1 - Mouse immunization schedule

[0618]

[0619] The TLR agonist cocktail consists of the following components:

[0620] Table 2 - TLRs relative to mixtures

[0621]

[0622]

[0623] Proteins were combined with the indicated volume of TLR agonist cocktail (40 μL / mouse) and injected.

[0624] On day 28, immune sera were collected and screened for binding to hIL-27RA-gp130 knob and hole hFc and control hFc-tagged proteins by protein ELISA. Sera were also screened for binding to HEK293 cells expressing the native IL-27RA / gp130 receptor and to CHO cells expressing recombinant IL-27RA / gp130 by flow cytometry. Finally, sera were screened for IL-27RA / gp130 agonist activity in a pSTAT3 HTRF assay. Two mice with the best titers received an additional boost on day 56 and a final boost on day 62 with 50 μg of immunogen without adjuvant. Four days later, mice were euthanized, and their splenocytes and lymph node cells were fused with Sp2mIL6 mouse myeloma cells by electrofusion.

[0625] Hybridomas were screened in a protein ELISA format for binding to hIL-27RA-gp130 knob and hole hFc and to control hFc-tagged proteins. They were also tested by flow cytometry for binding to CHO parental cells, CHO cells expressing only the IL27RA chain, CHO cells expressing only gp130, and CHO cells expressing the complete IL-27RA-gp130 receptor. Prioritized hybridomas that produced antibodies employing a kappa light chain and binding to CHO-gp130 and CHO IL-27RA-gp130 cells were identified as gp130-specific antibodies and underwent VH-VL molecular cloning.

[0626] Briefly, cDNA was generated from purified RNA using SMARTer IIA oligonucleotides (Clontech) and oligo(dT)20. The cDNA was then amplified using RACE PCR. To amplify the heavy chain, oligo SMART 2ndF (GTGGTATCAACGCAGAGTACGCG) (SEQ ID No: 55) was used as a forward primer, and GGGTGCCAGGGGGAAGACSGA (SEQ ID NO: 56), which is specific for mouse IgG, was used as a reverse primer. To amplify the kappa light chain, oligo SMART 2ndF (GTGGTATCAACGCAGAGTACGCG)-SEQ ID No: 53 was also used as a forward primer, and the kappa-specific primer GAAGATGAAGACAGATGGTGCAGCCAC-SEQ ID No: 54 was used as a reverse primer. The VH amplicon was then cloned into a pTT5-hIgG_EFN_EEE_Flag (SAPI, SMART) vector and the VL amplicon was cloned into a pTT5-hκ (SAPI, SMART) vector via infusion cloning. Thirteen unique paired sequences were identified and selected for further characterization (clones 2194, 2211, 2191, 2203, 2200, 2207, 2183, 2214, 2202, 2187, 2189, 2199, and 2201). Clone 2187 derived from hybridoma 13B10 provided the lead binding domain.

[0627] Isolation of rat monoclonal antibodies that bind to human and cynomolgus macaque IL27RA

[0628] Sprague-Dawley rats were immunized with 12 IP injections of 20 μg of soluble hIL-27Rα-gp130 knob and hole hFc protein emulsified in Ribi adjuvant (Sigma S6322). The first nine immunizations were administered twice weekly; the remaining three immunizations were administered weekly. Immune sera were screened for binding to HEK293 cells that had been knocked down by CRISPR to underexpress native IL-27Rα / gp130. Their agonist activity was also tested in the pSTAT3 HTRF assay. One rat with the best titer received a final boost of 20 μg of the unadjuvanted immunogen. Seven days later, the rats were euthanized, and their splenocytes were fused with P3X mouse myeloma cells by electrofusion.

[0629] Hybridomas were screened for binding to hIL-27RA-gp130 knob and hole hFc and control hFc-tagged proteins by protein ELISA format, and for binding to HEK293 cells and HEK293 IL-27RA / gp130 CRISPR-reduced cells by flow cytometry. Prioritized hybridomas were subjected to limiting dilution subcloning. Subclones were tested for binding to hIL-27RA-gp130 knob and hole hFc by ELISA and for binding to CHO parental cells, CHO cells expressing only the IL-27RA chain, CHO cells expressing only gp130, and CHO cells expressing the complete IL-27RA-gp130 receptor by flow cytometry. VH-VL molecular cloning was performed on 23 hybridoma-expressed antibodies specific for the IL-27RA chain. Clone 0917, derived from hybridoma 1C5_A6-10-7, provided the primary binding domain.

[0630] Screening of antibody pairs to identify IL27RA / gp130 agonists

[0631] Screening of antibodies against IL27RA or gpl30 from the hybridomas described in Example 2 failed to identify a single mAb that could agonize IL-27RA / gpl30 overexpression in CHO cells as measured by STAT3 phosphorylation. Therefore, matrices of antibodies were tested in a bispecific format to identify agonists of the heterodimer.

[0632] A panel of 87 anti-IL27RA antibodies was collected from the hybridoma screen described in Example 2 and from a screened phage display library (data not shown), representing 44 different CDR H3 families and 72 unique CDR H3-CDR L3 sequences, as well as a mixture of functional inhibitors and non-inhibitors of IL-27. A panel of 89 anti-gp130 antibodies was collected from a similar source, representing 76 different CDR H3 families and 89 unique CDR H3-CDR L3 sequences, as well as a mixture of functional inhibitors and non-inhibitors of IL-27. Bispecific antibodies were generated by cloning anti-IL-27RA antibodies into a human IgG1 vector ("RRR") carrying engineered arginine residues D221R, P228R, and K409R (EU numbering), and cloning anti-gp130 antibodies into a human IgG1 vector ("EEE") carrying engineered glutamic acid residues D221E, P228E, and L368E (EU numbering). Under mild reduction and reoxidation conditions, a mixture of antibodies carrying RRR and EEE mutations will preferentially form RRR-EEE heterodimers (Strop et al., 2012). This redox procedure was miniaturized so that bispecific antibodies could be formed from a mixture of 20 μg of each starting antibody, first incubated with reduced 1 mM glutathione (GSH) at 37°C for 1 hour, and then reoxidized with 1 mM glutathione disulfide (GSSG). The resulting material was shown to be compatible with cell and whole blood assays of IL-27R activity, including phosphorylation of STAT3 in CHO cells overexpressing IL-27RA and gp130 (described in Example 2) and phosphorylation of STAT3 and STAT1 in CD3+ T cells in human whole blood (described in Example 8).

[0633] A total of 2156 bispecific IgGs were generated. Of these, 50 demonstrated agonism in the CHO pSTAT3 assay, and (of the 29 potent agonists tested), 12 demonstrated robust agonism of pSTAT1 in CD3+ T cells in human whole blood (data not shown). These observations were replicated when these 12 bispecific antibodies were produced at a multi-milligram scale and purified from redox buffer and any remaining parental antibodies. These 12 represent combinations of four anti-gp130 antibodies (Ab 2187 and three unrelated antibodies) with five anti-IL-27RA antibodies (Ab 917 and four unrelated antibodies), each with unique VH and VL sequences. Within this panel, two "clusters" were apparent: any member of a panel of three anti-gp130 antibodies (including Ab-2187) could pair with any member of a panel of three anti-IL-27RA antibodies (including Ab-0917) to form an active bispecific agonist. The most potent activity was observed from the bispecific Ab-0917 and Ab-2187 pair, and these antibodies were selected as the primary binding domains for humanization and optimization (Example 3).

[0634] Example 3. Humanization and optimization of the binding domain

[0635] Humanization and optimization of the anti-gp130 binding domain

[0636] The heavy chain variable domain of anti-gpl30 clone 2187 was subcloned into an expression vector containing untagged human Fc, and the resulting protein was renamed clone 2246, which will be referred to as the parental clone for the description of humanization and optimization.

[0637] The 2246 binding domain has the human frameworks IGHV4-4*07_IGHJ4*03 (for VH) and IGKV3-20*01_IGKJ4*01 (for VL). IGHV4-4*07_IGHJ4*03 is a less optimal framework than the preferred framework in terms of physiological properties and manufacturability. In addition, in silico T-cell epitope analysis revealed an extremely poor EpivaxISPRI immunogenicity propensity score for the 2246 VH sequence (+6.2, compared to a better score of <-50). Although this high score is primarily mediated by germline epitopes rather than non-germline epitopes, this score still indicates an increased risk of immunogenicity unless associated with one of the preferred germlines, whose risk has been empirically reduced in multiple late-stage programs. Therefore, rehumanization was performed to transplant the VH CDRs into another framework, IGHV1-69*01, with six backmutations (A24V, M48I, I69M, A71V, E73T, A78F) (Pfabat numbering) to restore binding activity. The 2246 VL CDRs were also transplanted into the framework IGKV1-39*01 without backmutations. The rehumanized clone 4247 fully retained the binding activity of the parental clone 2246. However, it still has three non-germline T cell epitopes in the CDRs, two in the VH and one in the VL, and a moderately high immunogenicity score of -40.05 (current standard, Pfizer TReg regulation v1.00); it also has an N-linked glycosylation site in CDR-H2.

[0638] Before the availability of the co-crystal structure of the 2246 series, a set of 96 point mutations that were predicted to reduce the T cell epitope content and eliminate the N-linked glycosylation site in H2 with minimal impact on stability were designed, synthesized and characterized to retain gp130 binding. No mutation was able to remove the glycosylation site in H2 without a significant loss of binding activity. However, this liability was determined to be low risk and experimentally confirmed to be unoccupied. Therefore, no further efforts were made to remove it. When solving the co-crystal structure of gp130 / Fab3754 (a re-humanized variant of parent 2246), a second set of mutations was also designed to potentially enhance binding activity without adding new T cell epitopes to avoid loss of binding activity. The 20 affinity mutations were combined with the 9 binding-validated epitope removal mutations to generate a set of 54 VH chains and 7 VL chains, which were matrixed to produce 378 antibody-optimized variants. These mutant variants were screened for retention of gp130 binding activity, and 10 constructs that did not compromise binding activity or molecular properties were subsequently classified in the next round of screening, along with two novel combinatorial variants. Simultaneously, 20 backmutated variants of 4247 were evaluated for reduced risk of in silico immunogenicity and retention of gp130 binding; three of these variants, along with unmodified 4247, advanced to the next round of screening. In the final screening round, 12 optimized CDR constructs were hybridized with four framework variants and analyzed for gp130 binding and molecular properties. The resulting IgG molecular clone, 4574, incorporated five total mutations: two mutations in the VH CDRs, two in the VL CDRs, and one in the FW-H. Mutations S(H54)T, S(H65)D, F(H78)H, and S(L52)E (Pfabat numbering) reduce T cell epitope content, whereas mutation S(L94)Y appears to compensate for the small loss in gpl30 binding. Clone 4574 does not contain predicted non-germline epitopes and other tier 1 sequence possibilities.

[0639] Humanization and optimization of the anti-IL27RA binding domain

[0640] The heavy chain variable domain of anti-IL27RA clone 0917 was subcloned into an expression vector containing an untagged human Fc, and the resulting protein was renamed clone 2255, which will be referred to as the parental clone for the description of humanization and optimization.

[0641] For humanization, the VH CDRs of 2255 were transplanted into the framework IGHV3-7*01 with two backmutations, V48I and A49G (Pfabat numbering); and the VL CDRs were transplanted into IGKV1-39*01 with three backmutations, L46R, L47V, and Y49F (Pfabat numbering). The resulting humanized molecule fully retained the binding activity of the parental clone 2255. However, it has six non-germline T-cell epitopes spread across all three heavy chain CDRs, two additional non-germline T-cell epitopes in L2, one potential first-tier deamidation site in CDR-L1, and a very high polyreactivity score (DNA 26, insulin 14, while the desired score is <5). A limited screen of 16 CDR variants to reduce T-cell epitope content revealed that the K(L53)G mutation (clone 4207) significantly reduced DNA binding polyreactivity scores while maintaining much of the parental IL27R binding activity and removing T-cell epitopes. Additional screening of variants of humanized 2255 (approximately 500 clones) and variants of the homologous humanized 2257 antibody (approximately 150 clones) with the replacement K(L53)D mutation identified several mutations with putative immunogenicity or DNA affinity-reducing benefits that could potentially be tolerated as mutations of 4207. The results of these screens were combined with structural analysis of the newly available co-crystal structure of IL27R / Fab2255 to generate a panel of 48 single CDR variants of 4207, each containing 1 to 3 mutations predicted to reduce T-cell epitope content and / or polyreactivity with minimal impact on stability and affinity, or potentially enhance binding activity, in case there is a need to compensate for the loss of binding activity due to the possibility of removing mutations. Mutant variants were screened for retention of IL27R binding and DNA polyreactivity, and mutations from approximately 10 variants with favorable profiles were recombined into 80 VH and 9 VL sequences, which were then matrixed to generate a final set of 720 antibody-optimized variants. Optimized variants were synthesized, screened, and sorted in a similar manner to identify the final IgG molecule, clone 4701. Clone 4701 incorporated five mutations into the VH CDRs and additional mutations into L2. Mutations N(H35)Q, I(H51)T, I(H57E), and K(L53)G (Pfabat numbering) each reduced T cell epitope content and appeared to contribute at least slightly to the reduced DNA binding; mutation S(H30)E appeared to reduce DNA binding, while A(H96)K appeared to compensate for the IL-27R binding activity lost by the other mutations. No tolerant mutations were identified that removed a potential NS deamination site in CDR-L1, however, this deamination possibility was already reduced risk in the expanded Phase I assessment and was therefore not explored further. Clone 4701 does not contain predicted non-germline epitopes and retains only reduced-risk Tier 1 sequence possibilities in CDR-L1.It also had greatly reduced polyreactivity scores, DNA 10-13 and insulin 5-7. When combined with the optimized anti-gpl30 arm (4574) in a bispecific molecule, the polyreactivity score was further reduced to the acceptable range of <5.

[0642] Example 4. Polyreactivity / nonspecific interaction assessment

[0643] The final optimized binding domains for both gp130 and IL27Ra were evaluated in a molecular suit of physiological properties as monospecific homodimeric IgGs (clone 4574 for the anti-gp130 arm and clone 4701 for the anti-IL27RA arm) and also as the final bispecific molecule mAb-4894. Three types of analyses were performed to assess polyreactivity / nonspecific interaction propensity as described below.

[0644] DNA and insulin ELISA

[0645] 384-well ELISA plates (Nunc Maxisorp) were coated overnight at 4°C with DNA (10 μg / ml) and insulin (5 μg / ml) in PBS, pH 7.2. ELISAs adapted from the assays described in Tiller et al., J. Immunol. Methods 329, 112, 2008; U.S. Patent No. 7,314,622 were performed on a PerkinElmer Janus liquid handling robot. The wells were washed with water, blocked with 50 μl of polyreactive ELISA buffer (PEB; PBS, pH 7.2, 1 mM EDTA, containing 0.05% Tween-20) for 1 hour at room temperature, and rinsed once with 80 μl of water. Test samples (10 μg / ml in PBS, pH 7.2, 0.05% Tween-20, 1 mM EDTA) were added to the wells in quadruplicate and incubated for 1 hour at room temperature. The plates were washed three times with 80 μl of water, and 25 μl of 32 ng / ml goat anti-human IgG (Fcγ fragment specific) conjugated with horseradish peroxidase (Jackson ImmunoResearch) in PBS pH 7.2, 0.05% Tween-20, and 1 mM EDTA was added to each well. The plates were incubated at room temperature for 1 hour, washed three times with 80 μl of water, and 25 μl of TMB substrate (Sigma Aldrich) was added to each well. After 6 minutes and 45 seconds, the reaction was stopped by adding 25 μl of 0.18 M orthophosphoric acid to each well, and the absorbance at 450 nm was read. DNA and insulin binding scores were calculated as the ratio of the ELISA signal at 10 μg / ml antibody relative to the signal in wells containing buffer.

[0646] Affinity Capture Self-Interaction Nanoparticle Spectroscopy (AC-SINS)

[0647] Proteins can interact with themselves, especially at increased concentrations. This self-interaction can cause viscosity problems associated with formulations during drug development, as well as increased clearance risks. (Avery et al. MAbs. 2018; 10(2): 244-255). AC-SINS analysis measures self-interactions and is used to help predict the potential for high viscosity and poor pharmacokinetic properties.

[0648] AC-SINS analysis was standardized in a 384-well format on a Perkin-Elmer Janus liquid handling robot. 20 nm gold nanoparticles (Ted Pella, Inc., catalog number 15705) were coated with a mixture of 80% goat anti-human Fc (Jackson ImmunoResearch Laboratories, Inc. catalog number 109-005-098) and 20% nonspecific goat polyclonal antibody (Jackson ImmunoResearch Laboratories, Inc. catalog number 005-000-003), buffered with 20 mM sodium acetate, pH 4.3, and diluted to 0.4 mg / ml. After a one-hour incubation at room temperature, unoccupied sites on the gold nanoparticles were blocked with thiolated polyethylene glycol (2 kD). The coated nanoparticles were then concentrated 10-fold using a syringe filter, and 10 μl was added to 100 μl of PBS, pH 7.2, containing 0.05 mg / mL of the test sample. The coated nanoparticles were incubated with the test sample in a 96-well polypropylene dish for 2 hours and then transferred to a 384-well polystyrene dish and read on a Tecan spectrophotometer. The absorbance was read from 450 to 650 nm in increments of 2 nm and a Microsoft Excel macro was used to identify the maximum absorbance, smooth the data, and fit the data using a second-order polynomial. The average blank (PBS buffer alone) smoothed maximum absorbance was subtracted from the sample smoothed maximum absorbance to determine the AC-SINS score.

[0649] Human FcRn column

[0650] The human FcRn affinity column was prepared as previously described in Koch et al., mAbs 5:576-586, 2013 (see below). To determine human FcRn column retention time, 50 μg of test sample adjusted to pH 5.5 was injected onto a GE high-performance Streptavidin Sepharose column (Cat. No. 17-5113-01) coated with in-house expressed and purified biotinylated hFcRn, and the sample was eluted using a linear pH gradient from pH 5.5 (MES) to 8.8 (Tris) in the presence of 150 mM NaCl. FcRn column data are reported as relative retention time, where the sample elution time was subtracted from the retention time of the analytical potency control mAb-A to normalize for intra-assay variation.

[0651] Based on the results of these analyses, as shown in Table 3 below, a typical acceptable low level of risk was determined for the monoclonal antibody of the final bispecific molecule, mAb-4894.

[0652] Table 3 - Results of polyreactivity / nonspecific interaction assessment

[0653]

[0654]

[0655] Example 5. Large-scale production of primary antibodies

[0656] Generation of stable CHO cell pools for large-scale production of mAb-4894

[0657] The two binding arms of the final bispecific molecule, mAb-4894, were expressed separately as IgG (homodimers), with either EE or RR mutations in their IgG1 Fc domains favoring heterodimer formation during the subsequent redox reaction during purification. Specifically, the anti-gp130 binding arm with the RR mutation in its Fc was designated as clone anti-gp130 4875RR (derived from 4574, also referred to as anti-gp130-4574), and the anti-IL27RA arm with the EE mutation was designated as clone anti-IL27RA 4880EE (derived from 4701, referred to as IL27RA-4701). EE / RR mutations in the heavy chain constant region favor heterodimer formation: on the EE side, D221E and L368E (according to EU numbering) or D234E and L381E (according to Kabat numbering); on the RR side, D221R and K409R (according to EU numbering) or D234R and K422R (according to Kabat numbering). The EE arm contains the anti-IL27RA binding variable domain, and the RR side arm contains the anti-gp130 variable domain. The binding arms of the final bispecific antibody also contain alanine mutations to minimize effector function: L234A, L235A, G237A (according to EU numbering) or L247A, L248A, G250A (according to Kabat numbering) according to human IgG1.

[0658] Expression vectors encoding cloned anti-gp130 4875RR and IL27RA 4880EE, pSSI2.0-IL27-4574-2X and pSSI2.0-IL27-4701-2X, respectively, were constructed in the SSI system. Each expression vector was transfected into CHOK1 SV SSI 7876 (HCLIB-53) cells using neodymium electroporation (Bio-Rad) to generate two independent stable pools. Transfectants stably expressing the relevant antibody proteins were selected using glutamine synthesis and blasticidin (Gibco Cell Culture) resistance in CDCH0 (Invitrogen) medium.

[0659] The two pools were then expressed separately using 10 L of CHO cells grown in Pfizer production medium. Conditioned culture media for both homodimers (EE and RR) were collected on day 12 and processed for purification as described later. (CHO cell lines secreting IL-27R antibody homodimers (designated IL-27R-4880EE and gp130-4875RR) were generated using a protocol (CLD_SSI 2.0 v1) from Pfizer's Biotherapeutics Pharmaceutical Sciences (PharmSci) Cell Line Development Laboratory.)

[0660] IL27RA-4880EE homodimer cell line production:

[0661] CHOK1 SV SSI 7876 cells (HCLIB-53) were electroporated with 5 μg of the pSSI2.0 expression plasmid (VEC-38718), encoding the anti-IL27RA-4880EE homodimer antibody, and 45 μg of the pFlpE recombinase plasmid (AVEC-25020) at 300 V and 900 uF. Transfections were performed in triplicate to generate three independent pools (DX18-1, DX18-2, and DX18-3). Twenty-four hours after transfection, the resulting pool fluid was changed to L-glutamine-free medium (CDCHO-Invitrogen catalog number 10743-029 lot 2085431). Cultures were monitored over a 3-4 day period. After establishment, a small-scale production study was performed by inoculating a 200 mL volume of culture with 0.3×10 cells / mL in CDCH0 fully defined preloaded medium (MFR H000002813). On days 3 to 6 and 10 and 11, the culture was sampled and fed with 5.4 mL of fully defined feed version 6.2A (CDFv6.2A) and 5.0 mL of 10% glucose. On day 7, the culture was sampled and fed with 16.2 mL of CDFv6.2A and 15.0 mL of 10% glucose. On day 12, conditioned medium was collected from pools DX18-1, DX18-2, and DX18-3 for crude protein A titer assessment. Two 10L controlled working volume reactors were inoculated with cell cultures containing 8L of M310 production medium (PFPSOI AN LAB 0701: GS AU8 with spermine 4HCl, 12mM asparagine, 12mM aspartic acid, 8g / L glucose, +14mM KCl (M310) **Batch No. 0A215201026026) containing one of the pools (DX18-1, DX18-2, and DX18-3, 1:1:1 ratio DX18-PoP). The cultures were maintained at 36.5°C with 12° rocking at 18 RPM. The cultures were fed 3.4% M391 (EXP M391 Batch No. 0A215201028002) daily (Days 3-12) and 2.5% 10% glucose daily (Days 4-12). The pH was controlled to 7.05 + / - 0.15. The dissolved oxygen set point was 30%. On day 12, the dissolved oxygen was measured by 30" 5 μm Pall Conditioned culture medium was collected by filtration through a 10" 0.22 μm Pall Suport filter (Cat. No. NP6EKVP1GA).

[0662] Table 4 Small-scale (200 mL) and large-scale (10 L) expression analysis of IL27R-4880EE homodimers from stable CHO SSI pools

[0663]

[0664] VCD = viable cell density

[0665] Anti-gp130-4875 RR homodimer cell line production:

[0666] CHOK1 SV SSI 7876 cells (HCLIB-53) were electroporated with 5 μg of the pSSI2.0 expression plasmid (VEC-38719) encoding the anti-gp130-4875 RR homodimer antibody and 45 μg of the pFlpE recombinase plasmid (AVEC-25020) at 300 V and 900 uF. Transfections were performed in triplicate to generate three independent pools (DX19-1, DX19-2, and DX19-3). 24 hours after transfection, the resulting pool fluid was changed to medium without L-glutamine (CDCHO - Invitrogen Cat. No. 10743-029 Batch 2085431). The culture was monitored over a 3-4 day time course. After establishment, a small-scale production study was performed by inoculating a 200 mL volume of culture with 0.3×10 6 cells / mL in CDCHO fully defined preloaded medium (MFR H000002813). On days 3 to 6 and 10 and 11, the culture was sampled and fed with 5.4 mL of fully defined feed version 6.2A (CDFv6.2A) and 5.0 mL of 10% glucose. On day 7, the culture was sampled and fed with 16.2 mL of CDFv6.2A and 15.0 mL of 10% glucose. On day 12, conditioned medium was collected from the DX19-1, DX19-2, and DX19-3 pools for crude protein A titer assessment. A 10 L working volume controlled reactor was inoculated with a cell culture containing 8 L of M310 production medium (PFPSOI AN LAB 0701: GS AU8 with spermine 4HCl, 12 mM asparagine, 12 mM aspartic acid, 8 g / L glucose, +14 mM KCl (M310) **Batch No. 0A215201026026) containing one of the pools (DX19-1, DX19-2, and DX19-3, 1:1:1 ratio DX19-PoP). The culture was maintained at a temperature of 36.5 ° C and rocked at 18 RPM at an angle of 12 °. The culture was fed 3.4% M391 (EXP M391 batch number 0A215201028002) (days 3-12) and 2.5% of 10% glucose daily (days 4-12). pH was controlled to 7.05 + / - .15. The dissolved oxygen set point was 30%. On day 12, the 30" 5 μm Pall Conditioned culture medium was collected by filtration through a 10" 0.22 μm Pall Suport filter (Cat. No. NP6EKVP1GA).

[0667] Table 5 Small-scale (200 mL) and large-scale (25 L) expression analysis of IL27R-4875RR from stable CHO SSI pools

[0668]

[0669] Redox and purification of primary bispecific antibodies

[0670] Conditioned culture media of EE and RR homodimers were captured separately on MabSelect Sure LX resin on an Akta Avant (GE Healthcare Life Sciences). A redox reaction to generate heterodimers was performed in vitro. Homodimers were incubated with a molar excess of cysteine ​​in a 1:1 ratio. The redox-treated material was purified on a column with Fractogel TMAE Hicap(M) (EMD Millipore) resin equilibrated in 50 mM Tris, pH 8.1 in weak-partitioning mode. Purification was further optimized using microcolumn screening with ion exchange (IEX) and hydrophobic interaction chromatography (HIC) resins. The material was diluted 1:1 with 800 mM sodium sulfate, 700 mM sodium phosphate, 100 mM Tris, pH 7.2, and purified using a gradient of elution buffer (50 mM sodium phosphate, pH 7.2) using Butyl HP HIC resin (Cytiva). The final buffer was exchanged with His / sucrose buffer (20 mM histidine, 8.5% sucrose, pH 5.8) using a 30 kDa regenerated cellulose membrane (EMD Millipore). Protein concentration was quantified using absorbance at 280 nm using the calculated absorbance.

[0671] Conversion percentage was assessed by high-performance hydrophobic interaction chromatography (HP-HIC). This method exploits the difference in hydrophobicity between the two homodimers / components (anti-IL27RA (IL27R-4880EE) and anti-gp130 (IL27R-4875RR)) and the final product protein (heterodimer). Samples were run on a ProPac HIC-10 column (Thermo Fisher) using a gradient of 1 M sodium sulfate, 50 mM sodium phosphate, pH 7.2. HP-SEC was performed by injecting 15 μL of the reaction mixture into an HPLC equipped with a YMC-pack-Diol 200 column and a UV detector (280 nM). The column temperature was set at 25°C, and an isocratic elution (50 mM sodium phosphate buffer) was used to maintain a flow rate of 0.3 mL / min.

[0672] Example 6. Evaluation of IL27RA / gp130 Binding to Human and Cynomolgus Monkey IL27RA and gp130 Results

[0673] The cross-reactivity of mAb-4894 with the human and cynomolgus macaque antigens gp130 (human - SEQ ID NO: 45, cynomolgus macaque - SEQ ID NO: 46) and IL27RA (human - SEQ ID NO: 41, cynomolgus macaque - SEQ ID NO: 42) was measured by surface plasmon resonance by anti-FAB capture of mAb-4894 on a biacore chip (arms containing anti-IL27RA-4880 EE and anti-gp130-4875 RR). Human or cynomolgus macaque IL27RA or gp130 were flowed over the chip and the association and dissociation rates were determined, and the affinity constants were calculated.

[0674] As shown in Table 6, the mAb-4894 bispecific antibody is able to bind to both human and cynomolgus macaque gp130 and IL27RA. The binding affinities of the two arms of mAb-4894 were tuned to have an approximately 1000-fold difference, with affinity for the IL27RA subunit approaching 0.1 nM, but affinity for the widely distributed gp130 subunit exceeding 100 nM. This differential affinity is expected to allow sufficient potency for agonist activity while minimizing binding to other gp130-containing receptors.

[0675] Table 6. Biacore affinity of mAb-4894 bispecific antibody for human and macaque GP130 and IL27R

[0676] Analytes ligand ka(1 / Ms) kd(1 / s) KD(nM)±Std n Human GP130 mAb-4894 3.37E+05 5.66E-02 169.86±27.67 2 Macaque GP130 mAb-4894 2.15E+05 4.03E-02 187.59±1.42 2 Human IL27R mAb-4894 9.98E+05 1.10E-04 0.11±0.01 2 macaque IL27R mAb-4894 1.17E+06 1.95E-03 1.68±0 2

[0677] Materials and methods

[0678] Preparation of biosensor chips

[0679] An anti-Fab sensor chip was prepared by amine coupling of anti-human Fab antibodies to all eight channels of a CM5 sensor chip according to the manufacturer's instructions. The flow channel was activated by injecting a 1:1 mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 100 mM N-hydroxysuccinimide (NHS) at a flow rate of 10 μL / min for 7 minutes. Anti-Fab IgG antibodies were diluted to 25 μg / mL in 10 mM sodium acetate, pH 5.0, and injected through all flow cells at 10 μL / min for 7 minutes. All channels were blocked with 1 M ethanolamine-HCl (ETH) at 10 μL / min for 7 minutes. The final immobilized amount of capture antibody was approximately 14,000 resonance units (RU). The operating buffer used for immobilization and kinetics was HBS-EP + (10 mM 4-(2-hydroxyethyl)-1-piperidin-2-yl)-1-hydroxy ... Hexaethyl sulfonic acid (HEPES) (pH 7.4), 150 mM sodium chloride, 3 mM ethylenediaminetetraacetic acid (EDTA), 0.05% (v / v) Tween-20).

[0680] SPR analysis

[0681] The binding affinity of mAb-4894 to human and cynomolgus macaque gp130 and IL27RA was determined using a BIAcore 8K+ instrument (Cytiva) at 37°C with a 10 Hz collection rate. The mAb-4894 bispecific antibody was diluted to 0.08 μg / mL in HBS-EP+ buffer and captured for 100 seconds by anti-Fab IgG immobilized on flow cell 2 of all eight channels at a flow rate of 10 μL / min to achieve a capture level of approximately 50 RU. Flow cell 1 of each channel served as a reference flow cell. Following antibody capture, a three-fold dilution series of cytokines or HBS-EP+ buffer, ranging in concentration from 405 nM to 15 nM (huGP130 and cyGP130) and from 45 nM to 1.67 nM (huIL27R and cyIL27R), was injected over the sensor surface at 50 μL / min for 60 seconds. Dissociation was monitored for 600 seconds and the surface was regenerated with two injections of 10 mM glycine, pH 1.7, at 30 μl / min. Data were double-referenced (Myszka, D., J. Mol. Recognit 1999; 279-284). Binding affinities and rate constants for human and cynomolgus GP130 and IL27R were determined by fitting the resulting sensorgram data to a 1:1 Langmuir model in BIAcore Insight evaluation software version 3.0.12.15655 (Cytiva).

[0682] Example 7. Epitope overlap assessment of the IL27RA arm against the ligand IL27:

[0683] result

[0684] Because both the IL27 ligand complex (composed of p28 and Ebi3) and mAb-4894 bind to the IL-27 receptor, the ligand and mAb-4894 may bind to similar epitopes on the receptor complex, thereby potentially eliciting antagonistic activity of the IL27RA arm of mAb-4894 against the ligand. Therefore, the present inventors used the Octet system to assess potential epitope competition between the binding domain of mAb-4894 and the ligand complex.

[0685] Briefly, two sets of sensor tips were first coated with IL27 recombinant ligand complexes (complex production described in Example 1), and then one set was subjected to saturation binding of IL27RA before being subjected to IL27RA binding clone 2255 (parental clone) to find out whether the ligand could simultaneously bind to both IL27RA and antibody 2255. However, before being subjected to 2255, the other set was incubated in plain buffer as a positive control for binding of 2255 to the ligand.

[0686] like Figure 8 As shown in Figure 2, 2255 failed to show any detectable binding to the ligand sensor tip that had been bound to IL27RA (Sensor B6), whereas binding to the bare sensor tip that had been pre-exposed to buffer only (Sensor C6) was readily apparent. This result indicates the potential antagonistic activity of the IL27RA-binding domain of mAb-4894 (anti-IL27RA-4880EE) against IL27 ligands when used as a monospecific antibody.

[0687] Materials and methods

[0688] The samples were diluted with 1× sample dilution buffer (Sartorius) and also used as assay buffer. The plate was shaken between experimental steps at 30° C. The sensors were used in duplicate.

[0689] Amine-reactive second-generation (AR2G) sensors (Sartorius) were activated by immersion in a 1:1 mixture of 11.0 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 5.8 mM N-hydroxysuccinimide (NHS) for 180 seconds. The sensors were then immersed in hIL27R-CH23Fc-Flag diluted to 25 μg / mL in 10 mM sodium acetate, pH 5.0, for 300 seconds to directly immobilize hIL27R-CH23Fc-Flag onto the sensor. Finally, the sensors were immersed in 1 M ethanolamine-HCl (ETH) for 200 seconds to block all amine binding sites. The final immobilized amount of hIL27R was approximately 1.0 nm.

[0690] After the same set of sensors were immersed in sample buffer for 100 seconds to establish a baseline, the sensors were immersed in 300 nM hIL27:EBi3 for 260 seconds to allow binding of hIL27:EBi3 to hIL27RA (Association 1). At a high concentration of 300 nM hIL27:EBi3, it is assumed that almost all hIL27R on the sensor is bound to hIL27:EBi3. The sensors were then immersed in 300 nM GBT-IL27R-2255 for 260 seconds to assess whether GBT-IL27R-2255 could still bind to the hIL27:EBi3 and hIL27R-CH23Fc-Flag complex.

[0691] One set of sensors was used as a negative control by immersing in buffer solution instead of GBT-IL27R-2255 after binding hIL27:EBi3 to show the dissociation of hIL27:EBi3 from immobilized hIL27RA. No binding should be observed with these sensors.

[0692] After establishing a baseline, one set of sensors was used as a positive control by being immersed in a buffer solution instead of hIL27:EBi3. These sets of biosensors were then immersed in GBT-IL27R-2255 without binding hIL27:EBi3 to demonstrate the binding of GBT-IL27R-2255 to hIL27RA immobilized on the sensors.

[0693] Table 7 - Sensor tip assignments for epitope testing

[0694] sensor Direct fixation 1st association 2nd association B6 Il27R IL27:Ebi3 GBT-IL-27R-2255 C6 Il27R buffer GBT-IL-27R-2255 D6 Il27R IL27:Ebi3 buffer

[0695] Example 8. Evaluation of the Bispecific Bispecific IL27RA / gp140 on Human and Macaque T Cells, Monocytes, and Colonic Epithelial Cells

[0696] result

[0697] Key pharmacological endpoints were used to evaluate the biological activity of IL27RA / gp140 bispecific mAb-4894, particularly its ability to determine its activation pathway, including the expression of factors associated with IL27R agonism, including phosphorylation of signal transducer and activator of transcription 1 and 3 (pSTAT1 and pSTAT3) in CD3+ T cells, and the activity of anti-inflammatory mediators such as programmed death ligand 1 (PD-L1) and the enzyme indoleamine-pyrrole 2,3-dioxygenase (IDO1) in CD14+ monocytes and primary cultured colon epithelial cells. The results are described below and summarized in Table 9.

[0698] mAb-4894 induced pSTAT1 and pSTAT3 in CD3+ T cells from human whole blood with average EC50s of 0.43 nM and 0.23 nM, respectively (n=3). The window for STAT3 phosphorylation is smaller than that of STAT1 and exhibits higher donor-to-donor variability. In cynomolgus monkey whole blood, mAb-4894 induced pSTAT1 and pSTAT3 in CD3+ T cells with average EC50s of 1.74 nM and 1.17 nM, respectively (n=4).

[0699] IDO1 is a cytosolic enzyme with a hematopoietic (Fe2+) prosthetic group that catalyzes the metabolism of tryptophan (Trp) and converts it to kynurenine (Kyn). The IDO1 pathway was originally described as an innate immune mechanism that protects host organisms from infection. Elevated IDO1 levels largely inhibit the proliferation of effector T cells and induce apoptosis of effector T cells, and accumulated Trp metabolites induce the differentiation of Tregs, collectively leading to immunosuppression. The immunoprotective and immunosuppressive effects of IDO1 and Trp metabolites are strictly controlled by the stoichiometry of available local factors. The resulting effects of these local activities regulate IDO1 expression and help maintain overall immune homeostasis and peripheral immune tolerance. IL-27 is one of the immunoregulatory cytokines that induces IDO1. In human peripheral blood mononuclear cell (PBMC) populations, the IL-27 bispecific antibody mAb-4894 upregulated IDO1 expression in the cytoplasm of CD14+ monocytes in a dose-dependent manner. The average EC50 in the monocyte population (flow cytometry analysis) was 0.005 nM (n=3). In primary cultured human colonic epithelial cells from two donors, IDO1 mRNA expression was significantly upregulated by mAb-4894, with an average EC50 of 20 nM. The activity of secreted IDO1 in cell culture supernatants was also assessed by LC-MS analysis. The average EC50 for IDO1 activity in colonic epithelial cells from two donors was 5.4 nM (n=2). The results are summarized in Table 9.

[0700] PD-L1 (CD274) is the primary inhibitory ligand for PD-1 (programmed cell death protein 1, also known as CD279). Engagement of PD-1 with PD-L1 alters T cell activity in various ways, such as inhibiting T cell proliferation, survival, cytokine production, and other effector functions. In human whole blood, mAb-4894 induced PD-L1 expression in a dose-dependent manner, with an average EC50 of 0.002 nM (n=2). The results are summarized in Table 9.

[0701] Table 9 IL27RA / gp140 bispecific induced pSTAT1 and pSTAT3 as well as PD-L1 and IDO1 expression in human and cynomolgus macaque T cells, monocytes and colon epithelial cells

[0702] analyze species agonists EC50 (nM) n T cell pSTAT1 Human mAb-4894 0.4 3 macaques mAb-4894 1.74 4 T cell pSTAT3 Human mAb-4894 0.2* 3 macaques mAb-4894 1.17 4 Monocyte PD-L1 Human mAb-4894 0.002 2 Monocyte IDO1 Human mAb-4894 0.005 3 Primary colon epithelial cells IDO1 Human mAb-4894 5.4 2

[0703] *Due to high donor variability, data are calculated based on MAX induction percentage (MAX%)

[0704] Materials and methods

[0705] Whole blood from healthy human donors or untreated cynomolgus macaques was collected in tubes containing anticoagulant, distributed in 96-well plates, warmed to 37°C, and stimulated with serially diluted concentrations of mAb-4894 or isotype control IgG8.8 antibody for 15 minutes (human) or 20 minutes (cynomolgus macaque) according to the manufacturer's instructions, followed by additional Lyse / Fix buffer (BD Biosciences, catalog number 558049). Cells were washed in FACS buffer and then permeabilized in pre-chilled 90% methanol (for human samples) or BD Phosflow Perm buffer III (for cynomolgus macaque samples). During agonist stimulation, T cells were labeled with anti-CD3 antibody. Cells were washed again and incubated with fluorescently labeled antibodies recognizing phosphorylated STAT1 (pY701) or STAT3 (pY705) (Table 10), then evaluated by flow cytometry and analyzed with FlowJo software. The mean relative fluorescence units (RFU) in the gated T cell population were calculated by multiplying the percentage of pSTAT+ cells by the mean fluorescence intensity (MFI). EC50 values ​​(Table 9) were determined by plotting the agonist concentration versus RFU response for all donors using nonlinear 3-parameter best fit analysis software from GraphPad Prism 9 (GraphPad Software, Inc).

[0706] 95 μl of healthy human whole blood was aliquoted into a deep 96-well plate and then treated with 5 μl of serially diluted mAb-4894 or isotype control IgG8.8 antibody for 3 hours in a 37°C incubator. The cells were stained with human FC block (BD Biosciences, catalog number 564220), anti-CD3, anti-CD14, and anti-PDL-1 antibodies for 30 minutes in a 37°C incubator, with dilutions of 1:10, 1:50, 1:5, and 1:20, respectively (Table 10). According to the manufacturer's instructions, the samples were lysed / fixed for 20 minutes at 37°C with pre-warmed 1× lysis / fixation buffer. The cells were centrifuged, washed, and resuspended with FACS buffer. Monocyte PD-L1 expression was assessed by flow cytometry and MFI was analyzed using FlowJo software 10.7.1 (FlowJo, LLC). EC50 values ​​(0.002 nM, Table 9) were determined by plotting agonist concentration versus MFI for all donors using nonlinear 3-parameter best fit analysis software from GraphPad Prism 9.

[0707] Human PBMCs were isolated from healthy human whole blood by density gradient centrifugation using SepMate tubes (Stemcell technologies, catalog number 85450) and 15 ml of Ficoll-Paque Premium Reagent (GE Healthcare, catalog number 17-5442-02). 190 μl of freshly isolated human PBMCs (5×10^6 cells / ml in 10% FBS RPMI) were aliquoted into 96-well plates (Corning Costar, catalog number 3879, polypropylene) and then treated with 10 μl of serially diluted mAb-4894 or isotype control IgG8.8 antibody for 20 hours in a 37°C incubator. Cells were washed and further stained with the Live / DeadFixable Aquaous Cell Staining Kit (Invitrogen, catalog number L34966), human Fc block, and anti-CD14 (Table 10), followed by fixation / permeabilization with Cyto Fix / Cyto Perm buffer (BD, catalog number 554722) for 20 minutes at 4°C, and finally stained with anti-IDO1 at 1:100 (Table 9) for 30 minutes at 4°C. Monocyte IDO1 expression was assessed by flow cytometry and MFI was analyzed using FlowJo software 10.7.1. EC50 values ​​(0.005 nM, Table 9) were determined by plotting agonist concentrations versus MFI for all donors using nonlinear 3-parameter best-fit analysis software from GraphPad Prism 9.

[0708] Two donors of primary human colon epithelial cells (Cell Biologics, H-6047) (lot 02130, lot 041417ABC) were purchased and seeded into 48-well plates in complete DMEM / F-12 medium until 90% confluence was achieved. The cells were then treated with serially diluted mAb-4894 or an isotype control IgG8.8 antibody for 24 hours in a 37°C incubator. Supernatant samples were saved and quality controlled, followed by protein precipitation with additional acetonitrile reagent. Isotopically labeled tryptophan and kynurenine were added as internal standards. The supernatant was evaporated under nitrogen, reconstituted with injection buffer, and kynurenine (Kyn) production, reflecting IDO1 activity, was assessed by LC-MS analysis. The average EC50 value (5.4 nM, Table 9) was determined by plotting agonist concentrations for all donors against Kyn production using nonlinear 3-parameter best-fit analysis software from GraphPad Prism 9.

[0709] Table 10 - Antibodies used in the biological evaluation of IL27RA / gp130 bispecifics

[0710]

[0711]

[0712] Example 9. Biological effects of IL27RA / gp140 bispecific on T helper and T reg cells

[0713] result

[0714] CD4+ T helper cells play a variety of important roles in the development and maintenance of various autoimmune diseases, including IBD. CD4+ T helper cells can be characterized into different subtypes based on different sets of cytokines secreted, which in turn mediate unique cellular activities: Th1, Th2, and Th17 cells. In vitro, untreated CD4+ T cells can be induced and differentiated into these three types of T helper cells. During the skewing cycle, mAb-4894 upregulated IFNγ and T-bet expression during Th1 cell differentiation (data not shown), but had no effect on the expression of pro-inflammatory IFNγ in fully differentiated Th1 cells, indicating that mAb-4894 does not induce a pro-inflammatory response, such as Figure 4mAb-4894 downregulated GATA-3 and IL-13 expression during Th2 cell differentiation (data not shown) and downregulated IL-17A expression during Th17 cell differentiation. mAb-4894 also downregulated IL-17A and GM-CSF in fully differentiated Th17 cells. The data are shown in Table 11.

[0715] Table 11 - Downregulation of IL-17A in Th17 cells

[0716] analyze species agonists IC50(nM) n analyze Th17 cell IL-17A Human mAb-4894 0.0055 2 Th17 cell IL-17A

[0717] Regulatory T (Treg) cells are necessary to maintain peripheral tolerance, prevent autoimmune diseases, and limit chronic inflammatory diseases. There are two types of Treg: natural Treg (nTreg) and inducible Treg (iTreg). Treg also express several immune checkpoint molecules, including Tim-3 and LAG-3, which deliver negative immunoregulatory signals when engaged with T cell activation. Compared with the negative control antibody 8.8, mAb-4894 induced more CD4+CD25+FOXP3+iTreg from untreated CD4+ T cells, upregulated the LAG3+ population, upregulated Tim-3 expression and also increased the Tim-3+ cell population. In nTreg, mAb-4894 upregulated IL-10 gene expression in 2 donors and upregulated LAG3 expression at both transcript levels (n=2) and protein levels (n=2). Data are shown in Figure 5 middle.

[0718] mAb-4894 was tested in three types of dendritic cell (DC) differentiation conditions: immature DC, immunogenic DC, and tolerogenic DC. CD83 expression in the periphery may have functional significance and influence lymphocyte maturation, survival, or function. It has been reported that CD83 enhances T cell proliferation in vitro through overexpression on antigen-presenting cells (APCs). Immunoglobulin-like transcript 4 (ILT4) is an immunosuppressive molecule primarily expressed in myeloid cells. mAb-4894 significantly downregulated cell surface CD83 expression and upregulated ILT4 expression, which may also contribute to the inducible inhibitory effect of mAb-4894 on allogeneic T cell proliferation mediated by all three types of DC. Other markers such as HLA-DR and PD-L1 were also upregulated by the bispecific antibody mAb-4894 in both immature and immunogenic DCs in both tested donors.

[0719] Materials and methods

[0720] Untreated human CD4+ T cells were isolated from human leukocytes (Leukopak) using the EasySep Human Untreated CD4+ T Cell Isolation Kit (Stemcell Technologies, Catalog No. 17555). Cells were cultured in a human Th17 differentiation cocktail (IL-6, TGF-β1, IL-1b, IL-21, and IL-23, Table 12) and immunocultured (Stemcell Technologies, Catalog No. 10971) in a 37°C incubator for 4 days with or without serially diluted mAb-4894. IL-17A concentrations in the supernatants were assessed by MSD analysis (V-PLEX Human IL-17A Kit, Meso Scale Discovery, Catalog No. K151RFD-2) and analyzed using GraphPad Prism 9. The IC50 for IL17A inhibition (0.0055 nM, Table 11) was averaged from two independent donors.

[0721] Naive human CD4+ T cells were isolated from healthy human whole blood and treated with a Th1-biased cocktail (immunoculture, IL-12, IL-18, anti-IL-4 antibody, Table 10) for 7 days in a 37°C incubator. After 1 day of rest, the cells were treated with serially diluted mAb-4894 or isotype control IgG8.8 antibody (0.15 pM to 3 nM) for 1 day. Supernatants were saved and IFNg production was measured by MSD Research (Meso Scale Discovery, Catalog No. K151QOD-2). Data were analyzed using Graphpad Prism software.

[0722] Naive human CD4+ T cells were isolated from human leukocyte collection using the EasySep Human Naive CD4+ T Cell Isolation Kit and cultured in a 37°C incubator for 4 days with or without mAb-4894 or isotype control IgG8.8 antibody treatment (1.35 nM) in RPMI complete medium plus anti-CD3 / CD28 beads (Dynabead Human T Activating Factor CD3 / CD28, Gibco, Catalog No. 11131D) and IL-2 (5 ng / ml) (Table 12). After bead removal, cells were allowed to rest overnight in complete RPMI medium and then fluorescently labeled antibodies were used to recognize CD4, CD25, LAG3, Tim3, CD127, and FOXP3 (Table 10). Data were evaluated by flow cytometry and analyzed using FlowJo software 10.7.1.

[0723] Table 12 - Recombinant proteins used in the biological evaluation of the Il27RA / gp130 bispecific

[0724]

[0725]

[0726] Example 9. In vivo biological effects of IL27RA / gp140 bispecifics

[0727] result

[0728] Changes in in vivo markers of pharmacological activity of mAb-4894's anti-IL27RA / gp130 bispecific (IDO-1 activity, CXCL10 and CXCL11 concentrations, platelet counts) were demonstrated in cynomolgus macaques. mAb-4894-associated increases in serum chemokine concentrations of CXCL10 (also known as IP-10) (range 5.30×-20.96× compared to baseline) and CXCL11 (4.76×-74.44×) were noted. Increases in IDO-1 activity, measured as a function of unlabeled kynurenine and 13C-kynurenine, were also observed. The greatest increase was observed at 1 mg / kg / dose (4.29×-9.81× compared to baseline). The results are shown in Tables 17 and 18.

[0729] These results demonstrate that the anti-IL27RA / gpl30 bispecific antibody mAb-4894 modulates in vivo pharmacological biomarkers consistent with IL-27 activity / agonism.

[0730] Table 17: Intravenous administration of mAb-4894 to monkeys on Days 1 and 8 (Study 1)

[0731]

[0732] 1 Peak fold changes in IDO-1 activity measured in plasma increased between days 1 and 15.

[0733] 2 The peak fold changes in the concentrations of CXCL10 or CXCL11 proteins in serum increased on days 1-15.

[0734] 3 AUC of PF-07314477 concentrations in plasma on days 8-11.

[0735] Table 18: Intravenous or subcutaneous administration of mAb-4894 to monkeys on Days 1, 8, 15, 22, and 29 (Study 2)

[0736]

[0737] 1 Peak fold changes in IDO-1 activity measured in plasma increased from days 1 to 36.

[0738] 2 The peak fold changes in serum CXCL10 protein concentrations increased from days 1 to 36.

[0739] 3 AUC of PF-07314477 concentrations in plasma on days 29-43.

[0740] method

[0741] In vivo pharmacology of mAb-4894 in cynomolgus macaques

[0742] Male and female cynomolgus macaques from Mauritius aged 2.5 years and older were acclimated for a minimum of 30 days prior to the start of dosing. In Study 1, dose groups containing one male and one female monkey were administered PF-08314470 by intravenous (IV) injection at 0.1, 1, 10, or 100 mg / kg on days 1 and 8. In Study 2, dose groups containing one male and one female monkey were administered vehicle control or PF-08314470 by IV and subcutaneous (SC) injection at 0.01, 0.1, or 1 mg / kg IV or 1 mg / kg SC on days 1, 8, 15, 22, and 29. Blood was collected at various times during the study to assess indoleamine 2,3-dioxygenase 1 (IDO-1) enzyme activity or serum chemokine concentrations. After the final dose, blood was collected at various time points within 72 hours (Study 1) or 360 hours (Study 2) for toxicokinetic analysis. Total mAb-4894 concentrations in serum were determined using a ligand binding assay and the area under the curve (AUC) concentration was estimated for each individual animal.

[0743] IDO1 activity analysis

[0744] Before dosing and at different time points after administration of mAb-4894, whole blood samples collected in anticoagulant were mixed with 13C-labeled tryptophan in vitro and stored at 37°C. After overnight incubation, plasma was separated by centrifugation and stored at -80°C. At the end of each study, the concentrations of 13C-labeled and unlabeled kynurenine (the final product of IDO-1 enzymatic conversion of 13C-labeled and endogenous tryptophan, respectively) in each plasma sample were measured by LC-MS / MS. The fold change of the two kynurenine products in each animal was determined by comparing them with their respective concentrations in the pre-dose samples. For each animal, the peak fold change increase between the start of dosing and seven days after the last dose was determined for each kynurenine product. Serum CXCL10 and CXCL11

[0745] Serum was collected from all animals at various time points and the concentrations of CXC chemokines (CXCL10 and CXCL11) were determined using a ligand binding assay. The peak fold change increase compared to the pre-dose level of each chemokine was determined in each animal.

[0746] Example 11: IL27RA / gp130 bispecific epitope

[0747] Experimental method.

[0748] IL27Ra(D1-D2)+FAb-2255.

[0749] Co-crystals of IL27Ra (D1-D2) bound to the FAb fragment of GBT-IL27R-2255 were obtained by hanging-drop vapor-diffusion from 20% PEG 4000, 200 mM lithium sulfate, and 100 mM MES, pH 6. The crystals have consistent symmetry with the monoclinic space group P21, with unit cell parameters of β = 90.6° and has 4 complex copies in the crystallographic asymmetric unit. The crystals were flash frozen in liquid nitrogen using 20% ​​EG as a cryoprotectant solution. The single frozen crystal collection was set up at the IMCA beamline 17-ID at the Argonne National Laboratory (APS). The data were processed and scaled using autoPROC, and the final data set was 82.5% complete. The structure was solved by molecular replacement using PHASER. Several rounds of manual adjustment and model rebuilding using COOT and crystallization optimization using autoBUSTER produced a crystal with an R of 23.1%. workand 26.2% R free The final model, where R work =||F obs |-|F calc || / |F obs | and R free Equivalent to R work , but the calculations were done for 5% of the randomly selected reflections omitted from the self-optimization process. The ribbon diagram of the eutectic structure is shown in Figure 2 middle.

[0750] gp130(D1-D2-D3)+Fab-3754(humanized 2246)

[0751] Co-crystals of gp130 (D1-D2-D3) bound to Fab-3754 (a humanized variant of antibody 2246) were obtained by hanging drop vapor diffusion from 20% PEG 6000, 200 mM CaCl2, 100 mM MES pH 6. The crystals have consistent symmetry with the primitive space group P1, with unit cell parameters α = 62.8°, β = 77.36°, γ = 86.1° and has two complex copies in the crystallographic asymmetric unit. The crystals were flash frozen in liquid nitrogen using 20% ​​glycerol as a cryoprotectant solution. The single frozen crystal collection was set up at the IMCA beamline 17-ID at Argonne National Laboratory (APS). The data were processed and scaled using automated PROC, and the final dataset was 72% complete. The structure was solved by molecular replacement using PHASER. Several rounds of manual adjustments and model rebuilding using COOT, and crystallization optimization using automated BUSTER, yielded a crystal with 22% R work and 24.4% R free The final model, where R work =||F obs |-|F calc || / |F obs | and R free Equivalent to R work , but 5% of the reflections were randomly selected and omitted from the self-optimization process. The ribbon diagram of the cocrystal structure is shown in Figure 3 middle.

[0752] result

[0753] The IL-27RA and gp130 amino acids that are in close contact (within 3.80 Å) with anti-IL-27RA antibody 2255 and gp130 antibody 3754 are shown in Tables 19 and 20, respectively. Briefly, the epitopes of the two Fabs are described as follows: Fab-2255 utilizes all CDR loops except CDR-L1 for contacts, binding only to domain D2 of the receptor. The binding interface is controlled by polar and electrostatic interactions (a total of 9 hydrogen bonding contacts), with the heavy chain loops CDR-H2 and CDR-H1 contributing the most to the interaction. The buried surface area on the antigen is extensive.

[0754] Fab-3754 binds at the tip of domain D1 of gp130. All CDR loops except CDR-L2 make contact with the antigen. The binding interface is primarily polar at its center, with nine specific hydrogen bonding contacts. The heavy chain loops CDR-H3, CDR-H2, and CDR-H1 contribute most to the interaction. The dimensions of the binding interface are It is located at the lower middle end of the mAb-antigen interface.

[0755] Table 19 IL-27RA residues within 3.80 angstroms of antibody 2255

[0756]

[0757]

[0758] Table 20 gp130 residues within 3.80 angstroms of antibody 3754

[0759]

[0760]

[0761] Example 12: Expression, purification and characterization of alternative bispecific format variants

[0762] The IL27RA / gp130 bispecific antibody GBT-IL-27R-4933 was constructed using the same variable heavy and light chain regions from GBT-IL-27R-4894 in an alternative format to examine the impact of modifying the heterodimerization strategy on bispecific function and manufacturing characteristics. The alternative format utilizing knob-hole Fc (KiH) heterodimerization is called KiH mFd ( Figure 9). It utilizes a Fab configuration, which is referred to as "modified Fd" (mFd) and is used for anti-gp130 FAb. In this configuration, the anti-gp130 light chain (Table 21) is joined to the lower hinge region (DKTHTCPPCP) of the human IgG1-effector function-minimized Fc region to generate the VL-CL-Fc protein chain of this bispecific modality. The modified Fd chain is designed to pair with the anti-gp130 LC within the VL-CL-Fc chain and is composed of anti-gp130 VH, human IgG1-CH1 (Table 21), and the upper human IgG1 hinge amino acids EPKSC, which contain Cys at linear position 221 for forming an interchain disulfide bond with Cys (linear position 214) in the anti-gp130 Fab kappa constant domain. The GBT-IL-27R-4933 bispecific was constructed using the KiH mFd bispecific modality.

[0763] Specifically, the LC of gp130-4875 (SEQ ID NO: 24) was joined to the lower hinge region of an IgG1-effector function-minimized Fc engineered with the pit heterodimerization mutations T(360)S, L(362)A, and Y(401)V, and S(348)C (linear numbering) to generate the GBT-IL-27R-4933 VL-CL-Fc chain (Table 21). The GBT-IL-27R-4933-modified Fd chain (Table 21) was constructed by fusing gp130-4875 VH (SEQ ID NO: 21) to an IgG1 CH1 (SEQ ID NO: 9) and the upper hinge sequence EPKSC. IL-27RA 4880 VH (SEQ ID NO: 7) was fused to IgG CH1 (SEQ ID NO: 9) and an IgG1-effector function-minimized Fc containing the knob heterodimerization mutations T(364)W plus Y(347)C (linear numbering) to generate GBT-IL-27R-4933 HC (Table 21). GBT-IL-27R-4933 LC is identical to IL-27RA 4880 LC (SEQ ID NO: 14).

[0764] Table 21 Chain Sequences of GBT-IL-27R-4933

[0765]

[0766]

[0767] The KiH-mFd IL27RA / gp130 bispecific antibody GBT-IL-27R-4933 was prepared by using the manufacturer's recommended protocol in Expi293F TMAll four protein chains were transiently co-expressed in host cells or produced by generating stable CHO cell lines using the methods described in Example 5. Purification of the bispecific antibody was performed in a multistep process, first using standard protein A (MabSelect SuRe LX) and TMAE chromatography (run in 50 mM Tris, pH 8.3) as described in Example 5, followed by mixed-mode anion exchange chromatography (CaptoAdhere, Cytiva) and hydrophobic interaction chromatography (HIC) on a phenyl 650M column (TOSOH). Final buffer exchange was performed as described in Example 5.

[0768] A comparison of process yield and purity for two IL27RA / gp130 bispecific antibodies, GBT-IL-27R-4894 (EE-RR format) and GBT-IL-27R-4933 (KiH-mFd format), is shown in Table 22. Significant differences were observed between the two formats. Although GBT-IL-27R-4894 (EE-RR format) required two separate Protein A chromatography columns for initial purification of the EE and RR parent molecules prior to redox, the overall process required fewer nonstandard steps and produced higher yields and purity of protein than GBT-IL-27R-4933 (KiH-mFd format). Stable CHO pool expression of GBT-IL-27R-4933 was 0.35 / g / L, as measured by Protein A yield, while GBT-IL-27R-4894 expressed approximately three-fold higher levels. After Protein A purification, the EE and RR arms of GBT-IL-27R-4894 were >99% pure as measured by SEC, while GBT-IL-27R-4933 was only 55% pure, with approximately 40% high-molecular-weight material that was not removed by TMAE. Although high-molecular-weight material was removed from GBT-IL-27R-4933 by the mixed-mode and HIC steps, 5-10% residual homodimers remained in the final product. In contrast, the GBT-IL-27R-4894 (EE-RR form) protein could be purified to >99% purity, with <0.01% homodimer remaining in the final material.

[0769] Table 22 Purification process of GBT-IL-27R-4894 (EE-RR form) and GBT-IL-27R-4933 (KiH-mFd form) stably expressed by CHO

[0770]

[0771] Physiological and biological analysis evaluation:

[0772] The IL27RA / gp130 bispecific antibodies GBT-IL27R-4933 (knob-and-hole) and GBT-IL27R-4894 (EE-RR) were extensively characterized to assess the bioanalytical and physiological properties of these complex molecules. Specifically, the following methods were used to assess key molecular properties: analytical size exclusion chromatography (aSEC) to determine the percentage of high molecular weight species (HMMS) as an indicator of aggregation; thermal stability using differential scanning calorimetry (DSC); non-reducing capillary gel electrophoresis (cGE) to assess the percentage of peaks of interest (POI); imaging capillary electrophoresis (iCE) to assess charge heterogeneity; dynamic light scattering (DLS) to assess viscosity; and AC-SINS, DNA ELISA, insulin ELISA, and human FcRn chromatography for nonspecific analysis.

[0773] Analytical SEC was performed using a YMC-Pack Diol-200 SEC column in 20 mM Na PO , 400 mM NaCl, pH 7.2 buffer. The retention time (min) and peak width at 50% height (min) of the main peak, as well as the area under the curve (AUC) of the main peak (POI), low molecular weight species (LMMS) peak, and HMMS peak were recorded and used to calculate the percentages of the main peak (POI), HMMS, and LMMS. Protein samples were concentrated to approximately 150 mg / mL and maintained at 25°C for up to 6 weeks, or concentrated to 5 mg and stressed at 40°C for up to 4 weeks.

[0774] For the DSC method, samples were dispensed into the sample pan of an automated MicroCal PEAQ-DSC (Malvern Panalytical, Ltd.) at 0.3 mg / mL, equilibrated at 10°C for 5 minutes, and then scanned to 110°C at a rate of 100°C per hour. Raw data were baseline corrected and normalized to protein concentration. MicroCal PEAQ-DSC software (Malvern Panalytical, Ltd.) was used to fit the data to a non-two-state model with an appropriate number of transitions.

[0775] Viscosity was measured by a dynamic light scattering (DLS) bead-based method at concentrations up to approximately 175 mg / mL. Purified antibodies in phosphate-buffered saline, pH 7.2 (PBS), were dialyzed extensively against 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA, pH 5.8, using a membrane cartridge device 10K MWCO (Thermo Scientific). Antibodies were concentrated using a Viva spin concentrator 10K MWCO (GE Healthcare). Protein was concentrated to approximately 175 mg / ml and lower concentrations were prepared by dilution with sample buffer. All samples were prepared in 12 μL. 300 nm beads (Nanosphere, Thermo Scientific) were added to the protein sample and a buffer blank. The beads were diluted 1:100 in 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA, pH 5.8, and 0.75 μL of the diluted beads were spiked into the protein sample. The protein / bead and buffer / bead samples were mixed by gentle vortexing. 8 μL of sample was transferred to a 1536-well plate (SensoPlate, glass bottom, Greiner Bio-One) for analysis by DLS. The plate was sealed with optically clear tape and centrifuged at 2000 RPM for 2 minutes to remove bubbles. DLS measurements were performed using a DynaPro plate reader (Wyatt Technology, Santa Barbara, Calif.). Samples were incubated at 25°C and measured with 15 consecutive 25-second acquisitions. The radius of the beads was averaged to obtain data with an acceptable decay curve. Viscosity was calculated based on the Stokes-Einstein equation. Sample viscosity was calculated as the measured apparent radius divided by the nominal bead radius 10 times 0.893 cP, which is the viscosity of water at 25°C.

[0776] Non-reducing cGE was performed using the Caliper LabChip GXII (PerkinElmer Inc., Hopkinton, MA) according to the manufacturer's recommended protocol. Charge heterogeneity was analyzed according to the following specifications using a protein simple iCE3 instrument with a PrinCE autosampler (ProteinSimple, San Jose, CA). Protein was diluted in water to 2 mg / mL. The sample diluent consisted of 0.01 mg / mL pI marker 7.55, 0.01 mg / mL pI marker 10.1, 1.0% Pharmalyte pH 5-8, 3.0% Pharmalyte pH 8-10.5, 0.25% methylcellulose, 2.0 M urea, and 4.25 mM arginine. The sample contained 15 μL of protein at 2 mg / mL and 85 μL of sample diluent. The sample was focused at 1500 volts for 1 minute and then at 3000 volts for 9 minutes. The IL27RA / gp130 bispecific antibody was additionally subjected to DNA / insulin polyreactivity, AC-SINS self-association, and human FcRn chromatography physiological characterization to assess nonspecific properties, as described in Example 4.

[0777] A summary of the results of the physiological and bioassay evaluations of GBT-IL27R-4933 (knob-mold) and GBT-IL27R-4894 (EE-RR) indicates that both generally possess favorable molecular properties similar to those of standard well-expressed antibodies (Table 23). Both exhibited good thermal stability with Tm1 values ​​> 65°C and low viscosity (at or below 15 cP at 175 mg / ml) in 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA pH 5.8. Both variants exhibited acceptable nonspecific binding profiles and acceptable stability by aSEC, cGE, and iCE after challenge at 25°C and 40°C or incubation in the presence of mouse serum (Table 23).

[0778] Table 23. Summary of key physiological and bioanalytical properties evaluated for bispecific variants

[0779]

[0780] Functional activity:

[0781] Comparison of functional activity showed that GBT-IL27R-4933 (knob-mortise) had slightly lower agonist potency than GBT-IL27R-4894 (EE-RR) in three assays in human whole blood (Table 24). The assays were performed as described in Example 8. EC for STAT1 phosphorylation in CD3+ T cells 500.233 and 0.083 nM for 4933 and 4894, respectively (2.8-fold ratio). EC of PD-L1 upregulation in CD14+ monocytes 50 The EC values ​​for 4933 and 4894 were 0.006 and 0.002 nM (3-fold ratio), respectively, and the EC values ​​for IDO1 expression in CD14+ monocytes were 50 For 4933 and 4894, the values ​​were 0.015 and 0.008 nM, respectively (1.8-fold ratio).

[0782] GBT-IL27R-4894 (EE-RR form) showed consistent superiority over GBT-IL27R-4933 (knob-mortar) based on observed differences in biological activity and manufacturing characteristics.

[0783] Table 24. Activity of IL27RA / gp130 bispecific antibodies in EE / RR and knob-and-hole formats in whole blood

[0784]

[0785] Table 13 IL27RA and gp130 antibody sequences

[0786]

[0787] Table 14 IL27RA / gp130 bispecific antibody mAb-4894 sequence

[0788]

[0789] Table 15 Antibody coding sequences

[0790]

[0791] Table 16 Sequence Listing

[0792]

[0793]

[0794]

[0795]

[0796]

[0797]

[0798]

[0799]

[0800]

Claims

1. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) selected from the group consisting of: (i) an antibody comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7, and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8; (ii) an antibody comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6; (iii) an antibody comprising the IL27RA-VH sequence of SEQ ID NO: 7 and the IL27RA-VL sequence of SEQ ID NO: 8; (iv) an antibody comprising an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32; (v) an antibody that competes for binding to IL27RA with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 7 and a VL having the amino acid sequence of SEQ ID NO: 8; and (vi) An antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623.

2. The antibody of claim 1 , further comprising an Fc domain, wherein the Fc domain is of the isotype of IgA, IgD, IgE, IgM or IgG, and optionally is human IgG1, comprising one or more substitutions selected from the group consisting of: (i) L234A, L235A and G237A according to EU numbering, where the numbering is based on human wild-type IgG1; (ii) D221E and L368E (according to EU numbering), wherein the numbering is based on human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), wherein the numbering is based on human IgG1 wild type.

3. The antibody according to any one of claims 1 to 2, comprising a heavy chain (HC) and a light chain (LC) selected from the group consisting of: (i) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14; (ii) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14; and (iii) an antibody encoded by an isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both; (iv) an antibody encoded by an isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 39, the nucleic acid sequence of SEQ ID NO: 34, or both; and (v) An antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627.

4. The antibody of any one of claims 1 to 3, wherein the antibody antagonizes IL27RA.

5. The antibody of any one of claims 1 to 3, wherein the antibody further comprises a binding domain against a second target, and the second target is optionally gp130.

6. An isolated antibody that specifically binds to glycoprotein 130 (gp130), comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising one or more selected from the group consisting of: (i) an antibody comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22; (ii) an antibody comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20; (iii) an antibody comprising the gp130-VH sequence of SEQ ID NO: 21 and the gp130-VL sequence of SEQ ID NO: 22; (iv) an antibody comprising a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36; (v) an antibody that competes for binding to pg130 with a second antibody, the second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 21 and a VL having the amino acid sequence of SEQ ID NO: 22; and (vi) an antibody comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127624, and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

7. The antibody of claim 6, further comprising an Fc domain, wherein the Fc domain is of the isotype of IgA, IgD, IgE, IgM or IgG, and optionally is human IgG1, comprising one or more substitutions selected from one or more of the group consisting of: (i) L234A, L235A and G237A according to EU numbering, where the numbering is based on human wild-type IgG1; (ii) D221E and L368E (according to EU numbering), wherein the numbering is based on human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), wherein the numbering is based on human IgG1 wild type.

8. The antibody according to any one of claims 6 to 7, comprising a heavy chain (HC) and a light chain (LC) selected from the group consisting of: (i) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 30 and a light chain having the sequence of SEQ ID NO: 24; (ii) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24; (iii) an antibody encoded by an isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds gp130, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both; (iv) an antibody encoded by an isolated polynucleotide encoding the heavy chain, light chain, or both of an antibody that binds gp130, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both; and (v) An antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

9. The antibody of any one of claims 6 to 8, wherein the antibody further comprises a binding domain against a second target, and the second target is optionally IL27RA.

10. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises the antibody of any one of claims 1 to 5, and wherein the second antigen binding site comprises the antibody of any one of claims 6 to 9.

11. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises IL27RA-VH and IL27RA-VL, wherein the second antigen binding site comprises gp130-VH and gp130-VL, wherein the antibody is selected from the group consisting of: (i) an antibody, wherein: a) the IL27RA-VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; b) the IL27RA-VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 6; c) the gp130-VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; d) and the gp130-VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20; (ii) an antibody comprising: IL27RA-VH comprising the amino acid sequence of SEQ ID NO: 7, IL27RA-VL comprising the amino acid sequence of SEQ ID NO: 8, gp130-VL comprising the amino acid sequence of SEQ ID NO: 21, and gp130-VL comprising the amino acid sequence of SEQ ID NO: 22; and (iii) an antibody comprising the IL27RA-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and the IL27RA-VL sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127623, and further comprising the gp130-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127624 and the light chain variable region (gp130-VL) sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127625.

12. The antibody of any one of claims 10 to 11, further comprising an Fc domain, wherein the Fc domain is of the isotype of IgA, IgD, IgE, IgM or IgG, and optionally is human IgG1, comprising one or more substitutions selected from one or more of the group consisting of: (i) L234A, L235A and G237A according to EU numbering, where the numbering is based on human wild-type IgG1; (ii) D221E and L368E (according to EU numbering), wherein the numbering is based on human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), wherein the numbering is based on human IgG1 wild type.

13. The antibody of claim 12, wherein the antibody comprises an Fc domain comprising a first Fc chain and a second Fc chain, wherein the first Fc chain and the second Fc chain each comprise one or more amino acid modifications that promote binding of the first Fc chain to the second Fc chain.

14. The antibody of claim 13, wherein the first Fc chain comprises amino acid modifications at positions 221 and 409 (EU numbering) of human IgG1, and wherein the second Fc chain comprises amino acid modifications at positions 221 and 368 (according to EU numbering) of human IgG1, and wherein optionally, the modifications are D221R and K409R in the first chain and D221E and L368E in the second chain.

15. An isolated antibody comprising a first antigen binding site that binds IL27RA and a second antigen binding site that binds gp130, wherein the first antigen binding site comprises VH and VL, wherein the second antigen binding site comprises VH and VL, and wherein the binding affinity of the antibody for human IL27RA is at least two orders of magnitude lower than the binding affinity of the antibody for human gp130.

16. The antibody of any one of claims 1 to 15, selected from the group consisting of: (i) an antibody comprising a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO:27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO:14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO:30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO:34; and (ii) an antibody comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627, and further comprising a heavy chain (gp130-VH) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and a light chain (gp130-LC) sequence encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

17. The antibody of any one of claims 9 to 16, wherein the antibody has one or more characteristics selected from the group consisting of: (i) The binding affinity for IL27RA is higher than that for gp130 as measured by SPR; (ii) has a binding affinity for IL27RA that is at least 10-fold greater than its binding affinity for gp130 as measured by SPR; (iii) the antibody binds to human IL27RA with an affinity of less than 1 nM as measured by SPR; (iv) the antibody binds to human gp130 with an affinity of less than 1000 nM as measured by SPR; (v) the antibody agonizes IL27RA; (vi) the antibody binds to cynomolgus macaque IL27RA; (vii) the KD of the antibody for cynomolgus monkey IL27RA, as measured by SPR, is within 10 orders of magnitude of the KD of the antibody for human IL27RA; (viii) the antibody antagonizes gp130; (ix) the antibody binds to cynomolgus macaque gp130; (x) the antibody has a KD for binding to cynomolgus monkey gp130 that is within 3 orders of magnitude of the KD for binding to human gp130 as measured by SPR; (xi) the antibody has a binding affinity for IL27RA that is at least 100-fold greater than that for gp130 as measured by SPR; (xii) the antibody binds human IL27RA with an affinity of less than 1 nM as measured by SPR; (xiii) the antibody binds to human gp130 with an affinity of less than 1000 nM as measured by SPR; (xiv) the antibody binds to human IL27RA with an affinity of between 0.01 nm and 5 nM and to human gpl30 with an affinity of between 10 nm and 1000 nM as measured by SPR; (xv) the antibody is characterized by an EC50 of less than 10 nM in a phosphorylated STAT1 CD3+ T cell fluorescence flow cytometric assay; (xvi) the antibody is characterized by an EC50 of less than 5 nM in a flow cytometric analysis of phosphorylated STAT1 CD3+ T cells; (xvii) the antibody is capable of downregulating the production of pathogenic cytokines; (xviii) the antibody is capable of downregulating Il-17 production in T helper cells; (xix) the antibody is characterized by an IC50 of less than 0.05 nM as measured by the 11-17 immunoassay; (xx) the antibody is capable of promoting the differentiation of regulatory T cells; (xxi) The antibody is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression; (xxii) the antibody is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression in CD14+ human monocytes and / or human colonic epithelial cells; and (xxiii) The antibody is characterized by an EC50 of less than 100 nM as measured by LC-MS analysis of kynurenine production.

18. A pharmaceutical composition comprising a therapeutically effective amount of the antibody according to any one of claims 1 to 17 and a pharmaceutically acceptable carrier.

19. The antibody according to any one of claims 1 to 17 or the pharmaceutical composition according to claim 18, for use in the treatment of a disease, and wherein optionally, the inflammatory disease is one or more selected from the group consisting of: inflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes and cancer.

20. A method of treating a medical condition comprising administering to a subject in need thereof a therapeutically effective amount of the antibody of any one of claims 1 to 17 or the pharmaceutical composition of claim 18, and wherein optionally the medical condition is one or more selected from the group consisting of: inflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

21. An isolated polynucleotide encoding the antibody of any one of claims 1 to 17.

22. The polynucleotide of claim 21, wherein the polynucleotide is RNA.

23. An isolated polynucleotide comprising one or more selected from the group consisting of: (i) a polynucleotide encoding the VH of an antibody that binds to IL27RA, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO 31; (ii) a polynucleotide encoding the VL of an antibody that binds IL27RA, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32; (iii) polynucleotides encoding the VH and VL of an antibody that binds IL27RA, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 31 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 32; (iv) a polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds to IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both; (v) an isolated polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds IL27RA, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 39, the nucleic acid sequence of SEQ ID NO: 34, or both; (vi) a polynucleotide encoding the VH of an antibody that binds gp130, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 35; (vii) a polynucleotide encoding the VL of an antibody that binds gp130, wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 36; (viii) polynucleotides encoding the VH and VL of an antibody that binds gp130, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 35 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 36; (ix) a polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds gp130, wherein the polynucleotide comprises: the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both; (x) a polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds gp130, wherein the nucleic acid comprises: the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both; (xi) a polynucleotide encoding IL27RA-VH encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127622; (xii) IL27RA-VL encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127623; (xiii) polynucleotides encoding the IL27RA-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127622 and the IL27RA-VL sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127623; (xiv) a polynucleotide encoding IL27RA-HC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127626; (xv) a polynucleotide encoding IL27RA-LC encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127627; (xvi) polynucleotides encoding the IL27RA-HC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127626 and the IL27RA-LC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127627; (xvii) a polynucleotide encoding gp130-VH encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127624; (xviii) a polynucleotide encoding gp130-VL encoded by a plasmid deposited with ATCC and having ATCC Accession No. PTA-127625; (xix) polynucleotides encoding the gp130-VH sequence encoded by the plasmid deposited with the ATCC and having ATCC Accession No. PTA-127624 and the gp130-VL sequence encoded by the plasmid deposited with the ATCC and having ATCC Accession No. PTA-127625; (xx) a polynucleotide encoding gp130-HC encoded by a plasmid deposited with the ATCC and having ATCC Accession No. PTA-127628; (xxi) a polynucleotide encoding gp130-LC encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127629; and (xxii) a polynucleotide encoding the gp130-VH sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127628 and the gp130-LC sequence encoded by the plasmid deposited with ATCC and having ATCC Accession No. PTA-127629.

24. A vector comprising the polynucleotide according to any one of claim 23.

25. An isolated host cell comprising the polynucleotide of claim 23 or the vector of claim 24.

26. A method of producing an isolated antibody comprising culturing the host cell of claim 25 under conditions that result in production of the antibody, and recovering the antibody.

Citation Information

Patent Citations

  • Production of Bispecific Antibodies

    US20090182127A1

  • Recombinant immunoglobin preparations

    US4816567A

  • Chimeric antibody with specificity to human B cell surface antigen

    US5500362A

  • Method for making heteromultimeric polypeptides

    US5731168A

  • Methods and transformed mammalian lymphocytic cells for producing functional antigen-binding protein including chimeric immunoglobulin and fragments

    US5807715A