Method for inhibiting lipid metabolism of nasopharyngeal carcinoma through LncRNA ANRIL-ZBTB7A pathway

Abstract

The invention discloses a method for inhibiting lipid metabolism of nasopharyngeal carcinoma (NPC) through an LncRNA ANRIL-ZBTB7A pathway. The invention relates to a method for inhibiting lipid metabolism of nasopharyngeal carcinoma by using an LncRNA ANRIL-ZBTB7A pathway, which comprises the following steps: carrying out modification treatment on LncRNA ANRIL so as to negatively regulate an SREBF1-FASN factor and further inhibit lipid metabolism of NPC; when the transformation treatment mode is that the LncRNA ANRIL is over-expressed, the ZBTB7A is knocked down. According to the application disclosed by the invention, the LncRNA ANRIL is combined with shZBTB7A and an SREBP inhibitor famostatin, so that the lipid metabolism of NPC is inhibited, and an important role is played in research and development of targeted therapeutic drugs. The independently designed primer sequences of the chromatin immunoprecipitation-quantitative polymerase chain reaction of the LncRNA ANRIL, the SREBF1 and the FASN can be used as a new way for researching the NPC.

Description

Technical Field

[0001] The present invention belongs to the technical field of nasopharyngeal carcinoma research, and specifically relates to a method for inhibiting lipid metabolism in nasopharyngeal carcinoma by using a LncRNA ANRIL-ZBTB7A pathway. Background Art

[0002] Over 60,000 new cases of nasopharyngeal carcinoma are diagnosed each year. While early symptoms are subtle, advanced stages may include tinnitus, hearing loss, nasal congestion, blood in the mucus, headaches, neck lumps, and cranial nerve palsy. Currently, nasopharyngeal carcinoma is primarily treated with radiation therapy, combined with chemotherapy and targeted therapy.

[0003] Targeted therapy, as an emerging approach, boasts significant efficacy and good safety. Commonly used targeted drugs include EGFR inhibitors and anti-EGFR monoclonal antibodies. However, issues such as a lack of target specificity and patient heterogeneity hinder the widespread application and effectiveness of targeted therapy. Summary of the Invention

[0004] The present invention provides a method for inhibiting lipid metabolism in nasopharyngeal carcinoma through the LncRNA ANRIL-ZBTB7A pathway. By binding LncRNA ANRIL (long non-coding RNA ANRIL) to ZBTB7A, the expression of the patient's fatty acid synthase (FASN) and steroid regulatory element binding transcription factor 1 (SREBF1) is inhibited, thereby inhibiting lipid metabolism in nasopharyngeal carcinoma (NPC), providing support for the development of targeted therapeutic drugs for NPC.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions: The method of inhibiting lipid metabolism in nasopharyngeal carcinoma through the lncRNA ANRIL-ZBTB7A pathway includes: modifying lncRNA ANRIL to negatively regulate the SREBF1-FASN factor, thereby inhibiting lipid metabolism in NPC; and knocking down ZBTB7A when lncRNA ANRIL is overexpressed.

[0006] Furthermore, the ChIP-qPCR primer sequences (5'-3') of the LncRNA ANRIL are as follows: ANRIL-FCTGTTGGCTGCAAAACTCCC; ANRIL-RCCTTCCAGGAGAGTGGAGGA.

[0007] Furthermore, the ChIP-qPCR primer sequences (5'-3') of SREBF1 are as follows: SREBF1-FTCCTTAGTCCACAGCAAACAG; SREBF1-R GATTTCCCTTATTCACAGCCG.

[0008] Furthermore, the ChIP-qPCR primer sequences (5'-3') of FASN are as follows: FASN-F AGTGTCCTGTAGCTTGATGTG; FASN-R GACTCAGAGGTGGATGTCTTG.

[0009] Furthermore, when the LncRNA ANRIL is stably overexpressed, the SREBP inhibitor fatostatin is used.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The present invention inhibits the lipid metabolism of NPC by combining LncRNA ANRIL with shZBTB7A and the SREBP inhibitor fatostatin, which plays an important role in the research and development of targeted therapeutic drugs.

[0011] The low expression of ZBTB7A and high expression of ANRIL in the primary lesions of nasopharyngeal carcinoma patients may indicate that the progression of nasopharyngeal carcinoma is limited. Treatment with lipid metabolism inhibitors may have a better effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0013] Figure 1 RNA expression of ZBTB7A and SREBF1 in nasopharyngeal tissues.

[0014] Figure 2 Expression of ZBTB7A in nasopharyngeal cell lines.

[0015] Figure 3 Fluorescence images of HK1 and 5-8F cells transfected with shZBTB7A and ANRIL lentivirus.

[0016] Figure 4 Expression of ZBTB7A and related genes in ANRIL-shZBTB7A stable transgenic substrain.

[0017] Figure 5 Expression of miR-339-5p in NPC substrains.

[0018] Figure 6 In vitro experiments were used to detect the migration and invasion abilities of NPC substrains.

[0019] Figure 7 Mouse experiments were conducted to detect the metastatic ability of NPC substrains.

[0020] Figure 8 Detection of lipid metabolism in NPC substrains.

[0021] Figure 9 Analysis of the interaction relationship between ANRIL / miR-339-5p / ZBTB7A and SREBF1-FASN.

[0022] Figure 10 Diagram of the mechanism of action of LncRNA ANRIL-ZBTB7A in suppressing NPC metastasis through positive feedback. DETAILED DESCRIPTION

[0023] To facilitate a better understanding of the present invention, the following examples are provided to illustrate the present invention in conjunction with the accompanying drawings. These examples belong to the protection scope of the present invention, but do not limit the protection scope of the present invention.

[0024] Example The method of inhibiting lipid metabolism in nasopharyngeal carcinoma through the lncRNA ANRIL-ZBTB7A pathway includes: modifying lncRNA ANRIL to negatively regulate the SREBF1-FASN factor, thereby inhibiting lipid metabolism in NPC; and knocking down ZBTB7A when lncRNA ANRIL is overexpressed.

[0025] The ChIP-qPCR primer sequences (5'-3') for lncRNA ANRIL are as follows: ANRIL-FCTGTTGGCTGCAAAACTCCC; ANRIL-RCCTTCCAGGAGAGTGGAGGA.

[0026] The ChIP-qPCR primer sequences (5'-3') for SREBF1 are as follows: SREBF1-FTCCTTAGTCCACAGCAAACAG; SREBF1-R GATTTCCCTTATTCACAGCCG.

[0027] The ChIP-qPCR primer sequences (5'-3') for FASN are as follows: FASN-F AGTGTCCTGTAGCTTGATGTG; FASN-R GACTCAGAGGTGGATGTCTTG.

[0028] When lncRNA ANRIL was stably overexpressed, the SREBP inhibitor fatostatin was used.

[0029] 1. Experiment 1. Bioinformatics Analysis The GEO database was used to evaluate the expression of ZBTB7A in the GSE40290 database. TargetScan, DIANA, JASPAR, Ensembl, and BLAST tools were used to identify potential binding sequences within ANRIL, miR-339-5p, and ZBTB7A. JASPAR was used to predict potential linkages between ZBTB7A and the promoter regions of SREBF1 and FASN.

[0030] 2. Cell Culture 5-8 F (human highly metastatic nasopharyngeal carcinoma cell line) and 6-10B (human non-metastatic nasopharyngeal carcinoma cell line) were obtained from the Cancer Center of Sun Yat-sen University; CNE3 (human nasopharyngeal carcinoma cell line) was obtained from the Scientific Research and Experimental Center of the People's Hospital of Guangxi Zhuang Autonomous Region; HK1 (human nasopharyngeal carcinoma cell line) and NP69 (human immortalized nasopharyngeal epithelial cell line) were obtained from the Li Ka Shing Faculty of Medicine of the University of Hong Kong.

[0031] NPC cell lines HK1, 5-8 F, 6-10B, and CNE3 were cultured in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum. NP69 was cultured in keratinocyte serum-free medium supplemented with 5% bovine pituitary extract and recombinant epidermal growth factor.

[0032] The above-mentioned cell culture reagents, equipment, culture methods, etc. all adopt existing technologies and are not described in detail here.

[0033] 3. Quantitative Real-Time Polymerase Chain Reaction (qPCR) Total RNA was extracted from cell lines and tissues using TRIzol reagent. A portion of the total RNA was reverse transcribed using the RevertAid FirstStrand cDNA Synthesis Kit to generate cDNAs for ZBTB7A, ANRIL, SREBF1, and FASN. Another portion of the total RNA was reverse transcribed using the miRcute Plus miRNA First-Strand cDNA Kit. −ΔΔCt Methods: Relative RNA expression was calculated and normalized to human β-actin (hACTB) or U6. Primers were used for qPCR reactions; their sequences are listed in Table 1.

[0034] Table 1 The following primers were used for qPCR reaction

[0035] 4. Western blotting (WB) Cell lines were lysed using radioimmunoprecipitation buffer and the protease inhibitor phenylmethylsulfonyl fluoride. 20 μg of total protein was separated by SDS-PAGE and transferred to a 0.45 μm nitrocellulose membrane. The membrane was then incubated overnight at 4°C with the following primary antibodies: Abcam Anti-ZBTB7A (1:500 dilution, catalog number ab70208); Sigma-Aldrich Anti-SREBP1 (1:500 dilution, catalog number ABS1508); Cell Signaling Anti-FASN (1:500 dilution, catalog number 3189S); and Beyotime Anti-ACTB (1:1200 dilution, catalog number AA128). The membrane was then incubated for 2 hours at 37°C with Beyotime anti-rabbit (1:8000 dilution) or anti-mouse (1:12000 dilution) antibodies. ACTB was used as a loading control. Enhanced chemiluminescence reagent was added to the membrane for detection using an imaging system.

[0036] 5. Cell Transfection Based on cell characteristics and qPCR and Western blotting results, cells 5-8F and HK1, which express high levels of ZBTB7A, were selected for ZBTB7A silencing and ANRIL overexpression. Plasmids for ZBTB7A silencing and an empty vector were constructed, each with green fluorescence, and packaged into lentiviral vectors. Plasmids for ANRIL overexpression and an empty vector were constructed, each with cherry fluorescence, and packaged into lentiviral vectors. The sequences of the ZBTB7A short hairpin RNA and the overexpressed ANRIL are shown in Table 2.

[0037] Table 2 Sequences of knockdown of ZBTB7A and overexpression of ANRIL

[0038] Lentivirus was stably transfected into HK1 and 5-8F cells. Cells stably transfected with empty vector lentivirus served as a negative control (CtrlANRIL). Sublines were designated CtrlANRIL-HK1-shZBTB7A, ANRIL-HK1-shZBTB7A, CtrlANRIL-5-8F-shZBTB7A, and ANRIL-5-8F-shZBTB7A. Dual transfection was maintained with 1 μg / mL and 1.5 μg / mL puromycin, respectively. Sublines were observed using an IX71 fluorescence microscope.

[0039] 6. Half-maximal inhibitory concentration (IC50) experiment The double-gene stable intervention substrain was seeded in a 96-well plate at a density of 5000 cells per well and incubated at 37°C for 2 hours. Fatostatin was added to the wells at concentrations of 0.1 μM, 1 μM, 5 μM, 10 μM, 15 μM, 20 μM, 40 μM, 60 μM, and 100 μM and incubated for 4 hours. The cell counting kit-8 assay was then performed. The absorbance was measured at 450 nm using a Synergy H1 microplate reader. The cell inhibition rate was calculated as follows: [(Ac - As) / (Ac - Ab)] ×100%, Among them, Ac represents the control well, As represents the test well, and Ab represents the blank well.

[0040] The IC50 value of Fatostatin was determined to be 15 μM.

[0041] 7. Scratch Healing Assay The double-gene stable intervention substrain was seeded in a 6-well plate at a density of 10 per well. 6 cells and cultured for 24 hours. Subsequently, the medium was replaced with serum-free medium. A dense cell layer was created by manually scraping the cell layer using a sterile 200 μL pipette tip. Simultaneously, 15 μM fatostatin was added to the wells and incubated for 24 hours. 10% dimethyl sulfoxide in PBS (pH 7.2-7.4) was used as a control reagent. Subsequently, samples were observed in three randomly selected microscopic fields (Olympus; original magnification: ×40) at 0 or 24 hours.

[0042] 8. Transwell Migration and Invasion Assay The double-gene stable intervention substrain was cultured in serum-free 1640 medium for 24 hours. 4 cells (migrating) or 10 5 Cells (invading) were suspended in serum-free medium containing 15 μM fatostatin or 10% DMSO in PBS and added to the upper surface of a 6.5 mm Transwell chamber in a 24-well plate. In addition, 800 μL of medium containing 10% FBS was added to the lower surface. In the invasion assay, the upper surface was coated with a 70 μL dilution layer of basement membrane matrix, consisting of 17.5 μL of matrix gel and 52.5 μL of serum-free medium. After 24 hours, non-migratory or non-invasive cells on the upper surface of the filter were completely removed using a cotton swab. Subsequently, migratory or invasive cells on the lower surface of the filter were washed with PBS, fixed with methanol, and stained with 1% crystal violet. Migratory or invasive cells were quantified by visual counting using a microscope.

[0043] 9. Mouse Inguinal Lymph Node (LN) Metastasis Model Balb / c nude mice (female, 4 weeks old) were purchased, bred, and maintained at the Experimental Animal Center of Guangxi Medical University. Because 5-8F mice have a high metastatic potential, this strain was selected to establish the animal model. Before tumor cell inoculation, all mice were anesthetized with 35 mg / kg sodium phenobarbital intraperitoneally. Subsequently, 5 × 10 cells / mL in 100 μL sterile PBS were injected. 6 Ctrl / ANRIL-5-8F-shZBTB7A or ANRIL-5-8F-shZBTB7A cells were injected into the footpads of mice (n = 5 per group) as previously described. Mice were randomly assigned to different groups and intravenously injected with 10% DMSO in PBS or fatostatin (15 mg / kg) every 3 days for 3 weeks. After 7 weeks of growth, mice were euthanized. Footpad tumors and inguinal lymph nodes were removed, cut into 4 μm sections, stained with hematoxylin and eosin (H&E), and histologically verified.

[0044] 10. H&E Staining After dewaxing, paraffin sections were stained with hematoxylin solution and eosin, then dehydrated and mounted in neutral gelatin. Cell nuclei appear blue, and cytoplasm appears red. Sections were observed using a fluorescence microscope.

[0045] 11. Immunohistochemistry (IHC) Clinical nasopharyngeal carcinoma and mouse xenograft tissues were dissected and fixed overnight in 4% paraformaldehyde. The tissues were deparaffinized in xylene and rehydrated through descending concentrations of ethanol. Subsequently, 4 μm paraffin sections underwent antigen retrieval and blocked with bovine serum albumin. Primary antibodies used included anti-ZBTB7A, anti-SREBP1, and anti-FASN. Nuclei stained with hematoxylin appear blue, while proteins stained with DAB appear brown. Protein expression was scored based on mean staining intensity (mean optical density, AOD). The average level of positive signal was analyzed using ImageJ.

[0046] 12. Fluorescent staining of lipid droplets (LDs) Nile red fluorescence staining was performed using a lipid droplet fluorescence detection kit. 5×10 3Cells were evenly distributed into black, clear-bottomed 96-well microplates. Prior to staining, cells were incubated in serum-free medium. As a positive control, cells were treated overnight in complete medium with oleic acid (OA), provided in the assay kit, at a 1:2000 dilution. For lipid droplet staining, cells were fixed, washed, and stained with a working solution of Nile Red (1:1000) and DAPI (1 μg / mL). The fluorescence signal of the cells was measured using a microplate reader. Nile Red fluorescence was measured using 549 nm excitation and 628 nm emission, while DAPI fluorescence was measured using 358 nm excitation and 461 nm emission. Differences in cell number were corrected by using the Nile Red fluorescence signal of NC-ANRIL-HK1-shZBTB7A to normalize the Nile Red signals of the other groups. Data represent the average of five wells, with each sample performed in five wells.

[0047] 13. Triglyceride (TG) and total cholesterol (TC) testing 5×10 5 The cells were seeded in different 6-well plates and cultured. Subsequently, 15 μM adiposestatin was added to one well and incubated for 24 hours. The cells were digested with 0.25% trypsin, washed with PBS, and then 5×10 6 HK1 and 5-8F substrain cells were inoculated with either adipostatin or a control and sonicated on ice. Extracts were processed and measured using a microplate reader according to the manufacturer's instructions for TG and TC. To assess TG and TC, absorbance was measured at 420 nm and 500 nm, respectively. TG and TC concentrations were calculated according to the instructions provided with the kit.

[0048] 14. Enzyme-linked immunosorbent assay (ELISA) for SREBP1 and FASN The activities of SREBP1 and FASN in the HK1 and 5-8F substrains with stable double-gene intervention were assessed using ELISA kits. Cells in each group were rinsed with ice-cold PBS, scraped from the culture dish, transferred to a 15-mL centrifuge tube, suspended in PBS at a concentration of 100 million cells / mL, and then stored at -20°C overnight. After two freeze-thaw cycles to disrupt the cell membrane, the cell lysate was centrifuged at 5000 g for 5 minutes at 4°C. The supernatant was collected, dispensed into a 96-well plate, and assayed using a microplate reader. Absorbance was measured at 450 nm, and SREBP1 and FASN concentrations were calculated using a standard curve.

[0049] 15. Transmission Electron Microscopy (TEM) Cells of the HK1 and 5-8F substrains stably transfected with both genes were digested, transferred to a 15 mL centrifuge tube, centrifuged at 1000 rpm for 5 minutes, suspended in electron microscopy fixative, and adjusted to a concentration of 1 million cells / 1.5 mL EP tube at 4°C. The cells were then stored and transported at 4°C for 2 hours. The samples were fixed, dehydrated, and cut into 60-80 nm sections. The sections were stained with methenamine lead and examined using a transmission electron microscope.

[0050] 16. Dual-luciferase reporter gene assay Wild-type (WT) and mutant (MUT) versions of ANRIL and ZBTB7A were cotransfected with the miR-339-5p mimic and its negative control (NC) (Ribobio, Guangzhou, China) into 5-8F and HK1 cells using Lipofectamine 3000. Similarly, WT and MUT versions of SREBF1 and FASN were cotransfected with the ZBTB7A overexpression plasmid and the NC plasmid into cells. Relative luciferase activity was measured using a microplate reader according to the instructions of the Dual-Luciferase Reporter Assay System.

[0051] 17. Chromatin Immunoprecipitation (ChIP)-qPCR ChIP-qPCR was performed following the previously described method. 7 5-8F and HK1 cells underwent a two-step double cross-linking process. Protein-DNA complexes were immunoprecipitated using an anti-ZBTB7A antibody. Purified DNA was analyzed by qPCR using QuantStudio 5 and SYBR Green Master Mix. The primer pairs used are listed in Table 3.

[0052] Table 3 ChIP-qPCR primer sequences

[0053] 18. Statistical Analysis Statistical analysis was performed using SPSS 25 and GraphPad Prism 8.3.0. All experiments were repeated three times independently. All data are presented as mean ± standard deviation (SD). Two-tailed Student's t The test compares two independent groups. Depending on the experimental conditions, you can also use the unpaired Student's t Statistical analysis was performed using the statistician's test or Fisher's exact test. F If the variances of the tests were significantly different, the Mann-Whitney test was used to assess the number of LDs in NPC cells. P<A value of 0.05 indicated that the difference was statistically significant.

[0054] 2. Results Analysis 1. RNA expression of ZBTB7A and SREBF1 in nasopharyngeal tissues.

[0055] The GEO database was searched and the GSE40290 dataset showed that the level of ZBTB7A in normal nasopharyngeal tissue (NPE) was significantly higher than that in NPC tissue ( Figure 1 A), while the opposite was true for SREBF1 ( Figure 1 B).

[0056] 2. Expression of ZBTB7A in nasopharyngeal cell lines.

[0057] NP69 is an immortalized nasopharyngeal epithelial cell line with non-cancerous characteristics and can be used as a normal control. The RNA level of ZBTB7A in nasopharyngeal carcinoma cell lines HK1, 5-8F and 6-10B was higher than that in NP69 ( Figure 2 A). The ZBTB7A protein levels in HK1 and 5-8F cells were higher than those in NP69, while there was no significant difference between 6-10B, CNE3 and NP69 ( Figure 2 B-2C). Different levels of ZBTB7A in nasopharyngeal carcinoma tissues and cell lines suggest 3. ANRIL overexpression mediates the effect of ZBTB7A knockdown on the reduction of lipid metabolism target genes.

[0058] Stable knockdown of ZBTB7A failed to inhibit the migration and invasion of NPC cells. Microarray analysis and validation in nasopharyngeal tissue revealed that a series of genes surrounding ZBTB7A, such as ANRIL, SREBF1, and FASN, may maintain NPC cell characteristics through compensatory mechanisms. We predicted that miR-339-5p may serve as a potential bridge between ANRIL and ZBTB7A.

[0059] shZBTB7A and ANRIL were stably co-transfected into NPC cells, passaged and photographed; stably co-transfected shZBTB7A and CtrlANRIL substrain was used as a control ( Figure 3 Compared with the control, ZBTB7A levels increased inversely, accompanied by upregulation of ANRIL and downregulation of SREBP1 and FASN ( Figure 4 The expression of miR-339-5p in ANRIL and shZBTB7A co-transfected cells was lower than that in the control group ( Figure 5 Therefore, the coordinated dysregulation of target genes at the transcriptional and translational levels suggests the disruption of lipid homeostasis in NPC. It is urgent to systematically analyze the metabolic reprogramming mechanism and establish the causal relationship between these molecular abnormalities and carcinogenic phenotypes.

[0060] 4. ANRIL overexpression mediates the weakened migration and invasion effects of NPC cells caused by ZBTB7A knockdown.

[0061] It was determined that 15 μM fatostatin was the most effective concentration for interfering with NPC cell lines ( Figure 6 A). Compared with stable ZBTB7A knockout in HK1 and 5-8F, stable ANRIL overexpression and shZBTB7A reversibly reduced the migration and invasion capabilities of HK1-shZBTB7A and 5-8F-shZBTB7A cells. Furthermore, fatostatin significantly impeded the progression of cells. Furthermore, the combination of ANRIL and SREBP inhibitors directly inhibited their migration and invasion ( Figure 6 B-6D). Compared with NC-ANRIL-HK1-shZBTB7A, overexpression of fatostatin or ANRIL significantly inhibited the migration ability of NPC cells, and the combination of the two produced the greatest inhibitory effect on the cells ( Figure 6 C).

[0062] 5. ANRIL overexpression mediated the attenuated NPC cell metastasis effect caused by ZBTB7A knockdown.

[0063] Based on the high metastatic potential of 5-8F cells, an animal model was established using it to simulate the metastasis of NPC cells through the lymphatic system. Cells of the 5-8F-shZBTB7A substrain were injected into the footpads of mice and dissected after 7 weeks. Figure 7 A). Analysis of inguinal lymph node volume showed that overexpression of fatostatin or ANRIL effectively inhibited cell metastasis compared with ZBTB7A knockdown, and the combination of the two may prevent the formation of metastatic lesions. The inguinal lymph node volume of mice with ANRIL-shZBTB7A and fatostatin was the smallest among all groups ( Figure 7 B). Metastatic lesions were observed in all groups except the ANRIL overexpression and fatostatin group. Despite the presence of tumors in the footpads of the mice, no metastases were found in this group. Although ANRIL overexpression or fatostatin reduced lymph node volume, they were unable to completely eliminate metastatic lesions. H&E staining showed that the metastasis rates were 100% and 60%, respectively ( Figure 7 C, 7F). The levels of SREBP1 and FASN in mice bearing NC-ANRIL-shZBTB7A were the highest among all groups, but the levels in other groups did not differ ( Figure 7 D-7E). This combination completely inhibited the lymphatic metastasis of NPC cells, which was associated with the inhibition of lipid metabolism.

[0064] 6. ANRIL overexpression mediated the effect of ZBTB7A knockdown on reduced lipid metabolism in NPC.

[0065] Based on the in vitro and in vivo results, we found that the combination of shZBTB7A, ANRIL overexpression, and fatostatin effectively inhibited the migration, invasion, and metastasis of NPC cells, so further examination of lipid metabolism is necessary.

[0066] Compared with shZBTB7A, ANRIL overexpression effectively reduced the number of LDs and the concentrations of TG, TC, SREBP1, and FASN in cells. The concentrations of SREBP1 and FASN represent their activity in cells. In addition, fatostatin further inhibited lipid markers other than LDs. This may be because fatostatin toxicity may cause some NPC cells to die, and LDs could no longer be observed. Figure 8 A-8C). The combination of ANRIL overexpression and fatostatin achieved the greatest suppression of TG, TC, SREBP1, and FASN in NPC cells. These results provide an explanation for the disappearance of metastatic lesions in the combination group in vivo ( Figure 8 B-8C).

[0067] Subsequently, the microscopic morphology of LDs and mitochondria in cells was observed by transmission electron microscopy. Compared with ANRIL overexpression and / or fatostatin, LDs were more abundant in the cytoplasm of shZBTB7A cells ( Figure 8 D). The effects of DMSO or fatostatin on mitochondria were observed by transmission electron microscopy. Mitochondrial changes in the HK1 substrain were more pronounced than in the 5-8F substrain. In the HK1-shZBTB7A substrain, mitochondria became swollen and dense in cells treated with NC-ANRIL and fatostatin; mitochondria in cells treated with ANRIL and DMSO remained swollen; and mitochondria in cells treated with ANRIL and fatostatin became concentrated. In addition to the NC-ANRIL and DMSO groups, mitochondria in the 5-8F-shZBTB7A substrain became swollen ( Figure 8 E). Abnormal lipid metabolism and mitochondrial function indicate that NPC cell migration is inhibited.

[0068] 7. The ANRIL / miR-339-5p / ZBTB7A positive feedback loop directly inhibits SREBF1-FASN.

[0069] In NPC cells, we found a potential relationship between the expression of ZBTB7A and related genes, such as ANRIL, miR-339-5p, SREBP1, and FASN. Intervention of ZBTB7A and ANRIL led to changes in cellular malignant characteristics, which may be related to changes in lipid metabolism.

[0070] miR-339-5p was predicted to serve as a potential bridge connecting ANRIL and ZBTB7A ( Figure 9 A). In NPC cells, the negative correlation between ANRIL and miR-339-5p, as well as between ZBTB7A and miR-339-5p, was confirmed by dual-luciferase reporter gene assay ( Figure 9 B). It is predicted that ZBTB7A has a potential interaction with the ANRIL promoter region ( Figure 9 C). The positive correlation between ZBTB7A and ANRIL was confirmed by luciferase reporter gene assay ( Figure 9 D), ChIP-qPCR experiments revealed that ZBTB7A directly binds to the ANRIL promoter ( Figure 9 E) These two experiments indicate that ZBTB7A directly promotes the expression of ANRIL. Prediction: ZBTB7A has potential interactions with the promoter regions of SREBP1 and FASN, respectively ( Figure 9 F). Negative correlations were observed between ZBTB7A and SREBF1, as well as between ZBTB7A and FASN ( Figure 9 G), found that ZBTB7A directly binds to the promoters of SREBF1 and FASN ( Figure 9 H), indicating that ZBTB7A directly inhibits the expression of SREBF1 and FASN, respectively. These results suggest that the ANRIL / miR-339-5p / ZBTB7A axis forms a positive feedback loop, directly inhibiting lipid metabolism through SREBF1-FASN overexpression.

[0071] ZBTB7A is a crucial transcription factor in NPC progression. Stable knockdown of ZBTB7A impairs ANRIL uptake of miR-339-5p, thereby attenuating ZBTB7A's inhibition of SREBP1 and FASN. These results suggest that low ZBTB7A expression maintains NPC progression. This study revealed that overexpression of ANRIL enhances the uptake of miR-339-5p, thereby strengthening ZBTB7A's inhibition of SREBP1 and FASN, and combined with SREBP inhibitors to block NPC metastasis through lipid metabolism ( Figure 10 ).

[0072] The detection methods, reagents, equipment and operation methods used in the relevant detection items such as the experimental parts 3-17 of the present invention are all existing technologies and existing products. The reagents and equipment models used are not innovative, and the specific models are not described here; the experiments, result analysis and annotations of the drawings are all conventionally used in this field, and the abbreviations and abbreviations involving the experimental group / control group, indicators, etc. are all conventionally used and will not be described in detail.

[0073] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "include," "comprise," or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, the phrase "includes an element defined by ... does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes the element."

[0074] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for inhibiting lipid metabolism in nasopharyngeal carcinoma by using the LncRNA ANRIL-ZBTB7A pathway, characterized in that: include: LncRNA ANRIL-ZBTB7A was modified to negatively regulate SREBF1-FASN factors, thereby inhibiting NPC lipid metabolism; The transformation treatment method is to knock down ZBTB7A when LncRNA ANRIL is overexpressed.

2. The method for inhibiting lipid metabolism in nasopharyngeal carcinoma by the LncRNA ANRIL-ZBTB7A pathway according to claim 1, characterized in that: The ChIP-qPCR primer sequences (5'-3') of the LncRNA ANRIL are as follows: ANRIL-FCTGTTGGCTGCAAAACTCCC; ANRIL-RCCTTCCAGGAGAGTGGAGGA.

3. The method for inhibiting lipid metabolism in nasopharyngeal carcinoma by the LncRNA ANRIL-ZBTB7A pathway according to claim 2, characterized in that: The SREBF1 ChIP-qPCR primer sequences (5'-3') are as follows: SREBF1-FTCCTTAGTCCACAGCAAACAG; SREBF1-R GATTTCCCTTATTCACAGCCG.

4. The method for inhibiting lipid metabolism in nasopharyngeal carcinoma by the LncRNA ANRIL-ZBTB7A pathway according to claim 3, characterized in that: The FASN ChIP-qPCR primer sequences (5'-3') are as follows: FASN-F AGTGTCCTGTAGCTTGATGTG; FASN-R GACTCAGAGGTGGATGTCTTG.

5. The method for inhibiting lipid metabolism in nasopharyngeal carcinoma by the LncRNA ANRIL-ZBTB7A pathway according to any one of claims 1 to 4, characterized in that: When the LncRNA ANRIL was overexpressed, the SREBP inhibitor fatostatin was used.

Images