Application of Cactin in preparation of medicine for preventing or treating vascular endothelial inflammation diseases
By inhibiting the transcriptional activity of NF-κB through the Cactin protein coding gene, drugs are prepared for preventing or treating vascular endothelial inflammation, which solves the problem of poor efficacy of existing treatments and achieves effective control of endothelial inflammation caused by disturbed blood flow.
Patent Information
- Application Number
- CN202510896025.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-09
AI Technical Summary
The control rate of existing drugs for treating vascular endothelial inflammatory diseases is poor, and the incidence of cardiovascular diseases is increasing year by year. It is necessary to find early prevention or intervention targets to reduce the incidence and mortality of cardiovascular diseases.
Cactin protein coding gene is used to inhibit the transcriptional activity of NF-κB, thereby reducing vascular endothelial inflammation caused by disturbed blood flow and preparing drugs for preventing or treating vascular endothelial inflammation diseases.
Under disturbed blood flow conditions, Cactin can inhibit the transcriptional activity of NF-κB, reduce the expression of inflammatory factors, and reduce monocyte adhesion, thus having anti-inflammatory and anti-atherosclerotic effects.
Smart Images

Figure CN120605345A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of Cactin in the preparation of drugs for preventing or treating vascular endothelial inflammatory diseases. Background Art
[0002] Cardiovascular risk factors are closely associated with endothelial cell (EC) dysfunction or damage. Mechanical perturbations of the vascular wall contribute to the development and progression of cardiovascular disease. ECs are primarily subjected to three mechanical forces: hydrostatic pressure, cyclic stretch, and fluid shear stress. ECs are highly sensitive to fluid shear stress, which is a key factor in homeostasis but can also be a trigger for disease. In straight arterial sections, blood flow is typically laminar, generating uniform laminar shear stress. In branched and curved arterial sections, however, blood flow is typically disturbed (DF), resulting in oscillatory shear stress (OSS) or low shear stress. Under the background of physiological laminar flow, ECs are quiescent and exhibit anti-inflammatory, anti-proliferative, anti-apoptotic, anti-lipid infiltration, anti-leukocyte adhesion and migration, anti-thrombotic, and reduced endothelial-to-mesenchymal transition and glycolysis. In contrast, atherosclerosis-prone regions within arterial branches, bifurcations, and curvatures are primarily characterized by disturbed blood flow and low shear stress. ECs in these atherosclerotic sites experience oscillations and low shear stress and exhibit low nitric oxide production, reduced barrier function, increased procoagulant and proliferative properties, and an enhanced endothelial-to-mesenchymal transition phenotype.
[0003] Currently, there are a variety of drugs available clinically to treat vascular endothelial injury, but control rates remain poor and the incidence rate is increasing year by year. Therefore, early identification of targets to prevent or intervene in this process and reverse endothelial inflammatory responses is crucial for reducing the incidence of cardiovascular disease, improving patient prognosis, lowering mortality, and reducing national healthcare costs. Summary of the Invention
[0004] In order to solve the problems in the prior art, the present invention provides the use of Cactin in preparing a drug for preventing or treating vascular endothelial inflammatory diseases.
[0005] Cactin (Spliceosome C Complex Subunit) is a protein-coding gene. Cactin was first observed as a renal tumor antigen NY-REN-24 (Scanlan MJ, Gordan JD, Williamson B, et al. [J]. Int J Cancer, 1999, 83: 456–464.) and is expressed in multiple myeloma (Davies FE, Dring AM, Li C, et al. [J]. Blood, 2003, 102: 4504–4511.).
[0006] The inventors of the present invention, through quantitative immunohistochemical analysis, found that cactin expression is elevated in areas of disturbed blood flow in the aortic arch. Furthermore, by simulating disturbed blood flow in vitro, they found that cactin expression levels increased with increasing duration of the disturbed blood flow stimulation. Cactin can alleviate endothelial inflammation caused by disturbed blood flow by inhibiting the transcriptional activity of NF-κB.
[0007] The present invention adopts the following technical solutions:
[0008] Application of Cactin in the preparation of medicines for preventing or treating vascular endothelial inflammatory diseases.
[0009] The Cactin sequence of the present invention is as follows:
[0010] GTGAGGAGTACATGGGCTACAC(F)(SEQ ID NO:1);
[0011] ATCCTCTTGTTCCGCTCCTTCA (R) (SEQ ID NO: 2).
[0012] According to one embodiment of the present invention, the present invention provides use of a substance that promotes Cactin expression in the preparation of a drug for preventing or treating vascular endothelial inflammation.
[0013] According to one embodiment of the present invention, the vascular endothelial inflammatory disease is atherosclerosis.
[0014] Beneficial effects:
[0015] The present invention provides the use of Cactin in the preparation of drugs for preventing or treating vascular endothelial inflammation diseases. The inventors explored the effect of Cactin on vascular endothelial inflammation under the premise that disturbed blood flow causes vascular endothelial inflammation. Under the influence of disturbed blood flow, the expression level of Cactin in human umbilical vein endothelial cells increases. At the same time, in vivo studies in mice, it was also found that Cactin expression increased in the disturbed blood flow area. After transfecting human umbilical vein endothelial cells with a lentivirus containing a Cactin overexpression plasmid, it was found that in statically cultured cells, overexpression of Cactin inhibited the NF-κB transcription activity of human umbilical vein endothelial cells, reduced the expression level of inflammatory factors, and reduced the adhesion level of THP-1 cells. The inventors transfected HUVECs with an adenovirus containing a Cactin knockdown siRNA plasmid and found that in statically cultured cells, knocking down the expression of Cactin enhanced the NF-κB transcription activity of human umbilical vein endothelial cells, increased the expression level of inflammatory factors, and increased the adhesion level of THP-1 cells. Therefore, the present study shows that overexpression of Cactin has a protective effect on vascular endothelial inflammation and atherosclerosis by inhibiting the transcriptional activity of NF-κB. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is the expression of Cactin in the aorta specimens of C57 mice, where the objective lens magnifications are: 10X, 80X, and 80X respectively.
[0017] Figure 2 Figure 3 Cactin mRNA and protein levels and p-P65 protein levels under DF (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, n=3). (a) Western blotting was used to detect the expression levels of cactin and phosphorylated p65 proteins in HUVECs cells 0, 3, 6, 12, and 24 hours after stimulation with disturbed blood flow. (b) qPCR was used to detect the mRNA level of cactin in HUVECs cells 0, 3, 6, 12, and 24 hours after stimulation with disturbed blood flow.
[0018] Figure 3 Detection of transfection rate after overexpression / knockdown of Cactin in human umbilical vein endothelial cells (****P<0.0001, n=3).
[0019] Figure 4Overexpression of Cactin affects the transcriptional activity of NF-κB and the expression levels of VCAM-1 and TNF-α in HUVECs in static state and under DF treatment (*P<0.05, **P<0.01, ***P<0.001, n=3), where a. The transcriptional activity of NF-κB in the overexpression and negative control groups was detected in static state and after 24 hours of DF treatment; b. The protein expression levels of VCAM-1 and TNF-α were detected in static state and after 24 hours of DF treatment.
[0020] Figure 5 Cactin knockdown affects the transcriptional activity of NF-κB and the expression levels of VCAM-1 and TNF-α in HUVECs in static state and under DF treatment (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, n=3), where a. The transcriptional activity of NF-κB in the cactin knockdown and negative control groups was detected in static state and after 24 hours of DF treatment, respectively; b. The protein expression levels of VCAM-1 and TNF-α were detected in static state and after 24 hours of DF treatment, respectively.
[0021] Figure 6 Overexpression and inhibition of Cactin expression in HUVECs affected the adhesion of THP-1 cells (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, n=3). DETAILED DESCRIPTION
[0022] In order to further illustrate the present invention and its advantages, the technical scheme of the present invention is further described below by specific embodiments. It should be understood that these embodiments are only for the purpose of helping to understand the present invention and should not be regarded as specific limitations of the present invention. Unless otherwise specified, the parts described in the present invention are all by weight and the percentages are all by mass.
[0023] Example 1
[0024] Experimental cells: HUVECs used in this experiment were purchased from CHI Biotech (Maynard, MA, USA). Quality testing showed that the cells were free of HIV-1, HBV, HCV, mycoplasma, bacteria, yeast, and fungi.
[0025] Primer sequences
[0026]
[0027]
[0028] Cell recovery, culture, medium replacement, passaging, and cryopreservation
[0029] Cell recovery
[0030] Preheat a water bath to 37°C. Remove the frozen cells from the -80°C freezer and quickly transfer them to a 37°C water bath. Gently shake the cryovial. When the cells are almost completely thawed, spray them with alcohol and transfer them to a biosafety cabinet. Add 1 ml of preheated complete culture medium to the cryovial, gently pipette to mix, and then transfer the cells to a centrifuge tube. Centrifuge at 1000 rpm for 5 minutes. Aspirate and discard the supernatant. Add 5 ml of RPMI1640 complete culture medium, gently pipette to mix, and then transfer the cells to a culture dish. Shake well and culture in a 37°C, 5% CO2 cell incubator.
[0031] Cell culture medium replacement
[0032] Aspirate the old culture medium with a pipette, wash three times with appropriate amount of PBS, add RPMI 1640 complete medium, and continue to culture in a 37℃, 5% CO2 cell culture incubator.
[0033] Cell passaging and cryopreservation
[0034] (1) Observation of cell morphology under a microscope: HUVECs were cobblestone-like, the cell confluence rate was about 90%, and the THP-1 cell density reached 80%-90%.
[0035] (2) HUVECs: Aspirate the original culture medium and wash three times with PBS. Add an appropriate amount of trypsin to digest the cells. After the cells detach, add complete culture medium to neutralize the cells. Collect the cells into a 15 ml centrifuge tube. THP-1 cells can be directly collected without trypsin digestion.
[0036] (3) Centrifuge at 1000 rpm for 5 min and aspirate the supernatant.
[0037] (4) If the cells are to be passaged, resuspend the cells in RPMI1640 complete medium and transfer them to culture flasks / plates according to the required ratio. After labeling the cell information, culture them in a 5% CO2, 37°C cell culture incubator.
[0038] (5) If cells are frozen, remove the supernatant and resuspend the cells in cell freezing solution, transfer them to cryopreservation tubes, label them with relevant information, place them in a program freezing box and place them in a -80℃ low-temperature refrigerator for 24 hours. Depending on the situation, they can be stored in a liquid nitrogen tank.
[0039] qRT-PCR
[0040] RNA extraction
[0041] 1. Sterilize the clean bench with UV for at least half an hour, wipe the table with RNase and DNaseAWAY, and wait for 10 minutes; turn on the 4℃ centrifuge in advance to precool it.
[0042] 2. Wash the cell sample 1-3 times with PBS, add 1 mL of Trizol and pipette slowly. After the cells are completely lysed, transfer them to an enzyme-free EP tube. Place the EP tube on a vortex and let it stand at room temperature for 10 minutes.
[0043] 3. Add 1 / 5 volume of chloroform to the EP tube, shake well, and let it stand at room temperature for 10 minutes;
[0044] 4. Place the EP tube in a 4°C centrifuge at 13,000 rpm for 15 minutes;
[0045] 5. Transfer the upper aqueous phase into a new enzyme-free EP tube, add an equal amount of isopropanol, invert to mix, and place at room temperature for 10 minutes;
[0046] 6. Place the EP tube in a 4°C centrifuge at 13,000 rpm for 15 minutes;
[0047] 7. Aspirate the supernatant, add 1 ml of 75% ethanol to the EP tube, and centrifuge at 7500 rpm in a 4°C centrifuge for 10 minutes;
[0048] 8. Aspirate the supernatant, air-dry at room temperature for a few minutes, and add an appropriate amount of DEPC water to dissolve RNA on ice;
[0049] 9. Measure the concentration and purity of the extracted RNA and store it at -80°C.
[0050] Reverse transcription
[0051] 1. Prepare the following RNA mixture in an enzyme-free EP tube (prepare the mixture on ice):
[0052]
[0053] 2. After shaking the mixture, incubate at 42°C for 2 minutes and 60°C for 5 minutes, then place the mixture on ice to cool it quickly.
[0054] 3. Add the following reagents to the RNA mixture to a final volume of 20 μL.
[0055]
[0056] RNase Free dH2O up to 20.0
[0057] 4. Mix the solution in the EP tube by oscillation and centrifuge slightly, then place it in the PCR instrument for reversal. The reversal conditions are: 25℃ for 10 minutes, 55℃ for 30 minutes, and 85℃ for 5 minutes. Then quickly place it on ice to cool.
[0058] qRT-PCR
[0059] 1. Prepare the PCR reaction solution according to the table below (prepare on ice):
[0060]
[0061] 2. Slightly shake the reaction solution to mix, centrifuge lightly, and place it in a quantitative PCR instrument. The amplification program is: 95℃ for 30s, 40 cycles (95℃ for 5s, 60℃ for 30s).
[0062] 3. Draw the dissolution curve on the computer and perform statistical analysis and calculations.
[0063] Construction and packaging of lentiviral vectors
[0064] The lentiviral-packaged Cactin overexpression plasmid was purchased from Shanghai Pharmaceutical Technology Co., Ltd., China. Gene name: LV5-CACTIN (Homo), number: NM_021231.2, product batch number: 20221128, report number R2022-SH2884.
[0065] Lentiviral transfection and screening of stable transfected cell lines
[0066] 1. Plate: 6-wells, 2×10 4 The cells were seeded at a density of 100 cells / well with complete culture medium and incubated in a cell culture incubator overnight.
[0067] 2. Dilute the virus: Prepare 2.5ml of DMEM + 2.5μl of polybrene. Add the desired amount of lentiviral stock solution to the diluent at an MOI of 10. Remove the old medium and add the diluted virus solution to establish a control group. Incubate at 37°C, 5% CO2 overnight. 12-24 hours after transfection, replace the medium with RPMI1640 complete medium and continue culturing for 24-48 hours. Analyze gene transfer efficiency using an inverted fluorescence microscope.
[0068] 3. Screening for Stably Transfected Cell Lines: After determining transfection efficiency, replace the culture medium with RPMI1640 complete medium containing puromycin (1 μg / mL). Incubate until no cell death is observed in the transfected group and the fluorescence reaches 100%. Complete cell death is observed in the blank control group. Western blotting is used to assess changes in target gene expression.
[0069] Cactin knockdown plasmid
[0070] Cactin knockdown plasmid was purchased from Qingke Biotechnology Co., Ltd.
[0071]
[0072] siRNA transfection
[0073] 1.6-well, add 3×10 5cells / well, 2.5 ml complete medium, 37°C, 5% CO2 overnight;
[0074] 2. Replace 1.5ml of fresh culture medium, prepare two 1.5ml EP tubes, add 10μL of Cactin knockdown empty plasmid to one tube, add 10μL of Cactin knockdown plasmid to another tube, dissolve them in 250μL OPTI-MEM respectively, invert to mix, take two more 1.5ml EP tubes, dissolve 5μL of lipo8000iRNA in 250μL OPTI-MEM, pipette 3-5 times to mix, and let stand at room temperature for 5 minutes;
[0075] 3. Mix the above siRNA and transfection reagent, blow gently to mix, and let it stand at room temperature for 20 minutes
[0076] 4. Add the above reagent mixture evenly to a 6-well plate; shake thoroughly and incubate in a 37°C, 5% CO2 incubator. Replace the medium with fresh medium after 6 hours. 48 hours after transfection, extract total cell protein and verify Cactin expression by Western blot.
[0077] Low oscillatory shear stress system
[0078] A rocking “seesaw” system (SK-R1807-S, DLAB Scientific, Beijing, China) was used to simulate disturbed blood flow in vitro, with a shear force range of approximately ±4 dyn / cm 2 HUVECs were plated at 2×10 4 Once the cells reached approximately 80%-90% confluence, the plates were transferred to a shaker set at 60 cycles per minute and incubated there for the desired time.
[0079] Western blot (WB)
[0080] Total cell protein extraction
[0081] 1. After the cell experiment is completed, remove the old culture medium, wash the cells three times with PBS to remove any residue, add the prepared RIPA lysis buffer (100 μL RIPA: 2 μL phosphatase inhibitor: 1 μL PMSF), and lyse on ice for 30 minutes.
[0082] 2. Use a cell scraper to scrape the cells thoroughly and collect them into a 1.5mL EP tube, and further lyse them in an ultrasonic lyser
[0083] 3. Place the EP tubes symmetrically in a pre-cooled 4°C centrifuge and centrifuge at 12,000 rpm for 15 minutes.
[0084] 4. Collect the supernatant in a new EP tube, mark it, and store it at -80℃ after measuring the protein concentration using the BCA protein concentration assay kit.
[0085] Western blot detection
[0086] 1. Mix the protein sample with 5× loading buffer in a 4:1 ratio, then heat it in a metal thermostat at 100°C for 10 minutes to denature the protein.
[0087] 2. Place the gel in the electrophoresis tank and add electrophoresis solution to soak the gel. Gently remove the comb and then load the sample. Start with 80V for electrophoresis. After the band passes through the stacking gel, adjust the voltage to 120V and end the electrophoresis when the band reaches the bottom of the gel plate.
[0088] 3. Lay the black side of the transfer cassette flat, then place a sponge pad and filter paper on top, soaking them in electrophoresis solution. Remove the top layer of concentrated gel, place it on the filter paper, and cover it with a PVDF membrane (activated with methanol). Clamp the transfer cassette and place it in the electrophoresis tank according to the corresponding color. Pour in the rapid transfer solution and perform electrophoresis.
[0089] 1. Adjust the current to a constant current of 400mA and determine the transfer time according to the molecular weight of the protein.
[0090] 2. After the transfer is completed, remove the membrane, mark the front and back, soak the membrane in TBST, and then place it in rapid blocking solution and block at room temperature for 10 minutes;
[0091] 3. After blocking, wash the membrane three times with TBST on a shaker, each time for 10 minutes;
[0092] 4. Place the membrane in the prepared primary antibody and incubate overnight at 4°C;
[0093] 5. Wash the membrane three times with TBST on a shaker, 10 min each time;
[0094] 6. Place the membrane in the corresponding prepared secondary antibody and incubate on a horizontal shaker at room temperature for 1 hour;
[0095] 7. Wash the membrane three times with TBST on a shaker, 10 min each time;
[0096] Prepare the developer and mix it evenly. After the membrane is slightly dried, immerse it in the exposure solution, adjust the exposure parameters and input the stripe information, expose and develop, obtain the image, and statistically analyze the results.
[0097] Dual luciferase assay
[0098] 1.6-wells, 2×10 4 Cells were seeded at a density of 1000 cells / well, complete culture medium was added, and the cells were cultured in a cell incubator overnight.
[0099] 2. Before transfection, replace the medium with 2 ml of fresh culture medium and co-transfect the cells with pRL-TK and pNFκB-TA-luc plasmids in a certain ratio according to the requirements of the transfection reagent. Culture for 36 hours.
[0100] 3. After continuing to treat in the shaking system for 24 hours, tilt the six-well plate, aspirate the cell culture medium, add reporter gene cell lysis buffer at 500 μL / well, fully lyse at room temperature, centrifuge at 12000g for 5 minutes, and take the supernatant for determination.
[0101] 4. Place the Renilla luciferase assay substrate (100X) on ice and dissolve the Firefly Luciferase Assay Reagent and Renilla Luciferase Assay Buffer to room temperature in advance.
[0102] 5. Prepare Renilla luciferase assay working solution: 100 μL Renilla luciferase assay buffer: 1 μL Renilla luciferase assay substrate (100X)
[0103] 6. Select chemiluminescence on the multifunctional microplate reader, with a measurement time of 10 seconds and a measurement interval of 2 seconds.
[0104] 7. Add 100 μL of lysate sample to each well of a 96-well plate and take 100 μL of reporter gene cell lysate as a blank control.
[0105] 8. Add 100 μL of firefly luciferase detection reagent, mix gently with a pipette, and immediately perform chemiluminescence measurement of RLU (relative light unit).
[0106] 9. After measuring the firefly luciferase RLU, immediately add 100 μL of Renilla luciferase working solution, mix gently, measure the RLU, and perform statistical analysis.
[0107] Monocyte adhesion assay
[0108] 1. Count THP-1 cells, collect the required number of cells by centrifugation, remove the supernatant, and wash the cells 2 to 3 times with PBS.
[0109] 2. Resuspend THP-1 cells in 1 / 10 of the cell culture medium containing Calcein Blue AM staining solution (3 μM) and incubate at 37°C for 30 min.
[0110] 3. Wash the cells twice with PBS (or other buffer) to remove excess dye. Replace with fresh complete medium and resuspend the cells at a volume of 1×10 6 indivual
[0111] 4. Aspirate an equal volume of culture medium from the pretreated HUVECs in each group, add the labeled THP-1 cells to the HUVECs six-well plate, and incubate in a cell culture incubator in the dark for 30 minutes.
[0112] 5. Gently wash with PBS 3 times to remove non-adherent cells
[0113] 6. Observe and photograph under a fluorescence microscope and calculate the adhesion density between THP-1 and HUVECs.
[0114] Animal experiments
[0115] Healthy male mice (C57BL / 6J) of 6-8 weeks old were used as experimental animals. The animals were purchased from the Chongqing Medical University Laboratory Animal Center and acclimated to their surroundings. They were maintained in a 12-h light / 12-h dark cycle with free access to food and water for up to 94 weeks.
[0116] Aortic tissue sampling
[0117] (1) Mice were intraperitoneally anesthetized with 3% sodium pentobarbital. After the mice were anesthetized, they were killed with high concentrations of carbon dioxide. The mice were then placed under an optical microscope and their limbs were fixed so that their thoracic and abdominal surfaces were facing upwards.
[0118] (2) Cut and separate the mouse skin along the midline from the perineum to the neck, cut the chest and abdominal muscles and peritoneum layer by layer, open the chest cavity and fix it.
[0119] (3) Use toothless forceps to remove the lungs, liver, intestines and other organs covering the heart and aorta.
[0120] (4) Use a sterile syringe to inject 1 ml of 1% heparinized saline into the left ventricle of the mouse.
[0121] (5) Starting from the root of the aorta, gradually free the aorta, the three branches of the supra-arch arteries, the celiac artery, the mesenteric artery, and the renal arteries from top to bottom until the bilateral common iliac arteries are freed as much as possible. When freeing the aorta, remove as much of the mesenteric and fatty tissue around the artery as possible.
[0122] (6) Separate the heart, vena cava, and pulmonary artery. Retain the aorta and gradually cut off the pulmonary artery, vena cava, three branches of the supra-aortic artery, celiac artery, mesenteric artery, bilateral renal arteries, bilateral common iliac arteries, and paravertebral branches of the aorta. The aorta is then completely removed.
[0123] (8) Place the removed aorta in a 6 cm sterile culture dish filled with 0.9% saline. Gently grasp the aorta with forceps to clean away any remaining blood.
[0124] (9) After taking photos and recording the specimens, the aorta specimens to be used for tissue section staining were placed in a centrifuge tube marked with the specimen information and filled with 4% paraformaldehyde for fixation in preparation for subsequent operations.
[0125] paraffin sections
[0126] (1) Fixation: Mouse aorta tissue was fixed in 4% paraformaldehyde solution for 24 hours.
[0127] (2) Dehydration: Alcohol gradient dehydration: 75% ethanol, 85% ethanol, 95% ethanol, anhydrous ethanol (I), anhydrous ethanol (II) soak for 1 min each. Soak twice in xylene, each soaking for 1 min.
[0128] (3) Paraffin embedding: Place the tissue sample in melted paraffin wax to allow the wax to penetrate evenly and fully into the tissue sample. Place the wax-soaked tissue sample in a mold, pour in the melted paraffin wax, and then allow the paraffin to cool and solidify.
[0129] (4) Sectioning: Fix the tissue block on the microtome and then perform paraffin sections at a thickness of 5 μm.
[0130] (5) Spreading: Use a brush or writing brush to gently remove the cut tissue slices from the knife and spread them in warm water (40°C).
[0131] (6) Drying: Bake at 37°C overnight.
[0132] (7) Collect the slices the next day after drying and store them at room temperature in a dark place.
[0133] Immunohistochemistry
[0134] (1) Sectioning: The thickness of the slices should be 4 μm. The slices should be spread in water at about 40°C and then baked in an oven at 60°C for 30 minutes.
[0135] (2) Dewaxing to water: Take out the slices and soak them in xylene I, xylene II, and xylene III for 5 minutes each. Then soak the slices in anhydrous ethanol, 95% ethanol, and 75% ethanol for 1 minute each. Wash with distilled water for 5 minutes.
[0136] (3) Antigen retrieval: Microwave EDTA heat repair for 5-8 minutes and cool to room temperature.
[0137] (4) Inactivation of endogenous peroxidase: Draw a circle with an immunohistochemistry pen to prevent the reagent from flowing out, add endogenous peroxidase blocking solution, and wash the slices with PBS buffer and soak them twice, 5 minutes each time.
[0138] (5) Blocking: Add blocking serum and incubate at 37°C for 30 minutes. After blocking, wash the sections with PBS buffer.
[0139] (6) Primary antibody incubation: add primary antibody dropwise, incubate in a 37°C wet box for 60 min, and rinse with PBS three times, 5 min each time.
[0140] (7) Secondary antibody incubation: add secondary antibody, incubate at 37°C for 30 minutes, and rinse with PBS three times, 5 minutes each time.
[0141] (8) Color development: Add DAB color development solution
[0142] (9) Restaining: Add hematoxylin staining solution to completely cover the tissue, incubate at room temperature for 5 minutes, and rinse with distilled water to return to blue.
[0143] (10) Dehydration and transparent mounting: The sections were dehydrated using 75%-95%-100% ethanol gradient for 1 minute each time, transparentized with xylene twice for 2 minutes each time, mounted with neutral gum, and the mounting medium was allowed to dry naturally.
[0144] Statistical methods
[0145] Statistical analysis of differences between samples was performed using GraphPad Prism software v8.0. All data are presented as mean ± standard deviation (SD) of at least three independent experiments. Comparisons were performed using the independent sample t-test, or for groups >2, one-way analysis of variance (ANOVA) with paired t-test (Tukey) post hoc analysis. Statistical significance is indicated as *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. P < 0.05 was considered statistically significant.
[0146] Study Results
[0147] Cactin is expressed in the mouse aorta, with differences observed between the medial and lateral aortic arch curves. Blood flow in the lateral aortic arch is faster, tends to be laminar, and has a stable direction, while blood flow in the medial bend slows, with lower shear forces and a tendency to turbulence or eddies, making it a high-risk area for atherosclerosis. The inventors conducted quantitative analysis of Catin using immunohistochemical staining and found that Cactin is expressed in the mouse aorta, with significantly stronger expression in the medial bend than in the lateral bend in the aortic arch endothelial layer (p<0.0001), while no significant difference in expression was observed between the two sides of the descending aorta.
[0148] Disturbed blood flow stimulates upregulation of Cactin expression accompanied by activation of the NF-κB signaling pathway
[0149] The inventors detected the expression level of p-NF-κB by Western blotting and found that the expression level of p-NFkB increased over time after the stimulation of disturbed blood flow, indicating that the NF-κB pathway was activated (p<0.0001). In HUVECs after the stimulation of disturbed blood flow, the expression levels of cactin mRNA and protein also increased over time (p<0.0001).
[0150] Construction of Cactin knockdown / overexpression plasmids and transfection into human umbilical vein endothelial cells
[0151] HUVECs were transfected with cactin-overexpressing lentiviral plasmids and cactin-knockdown adenoviral plasmids, respectively, and the expression level of cactin was detected by WB. After overexpression of the cactin gene, the cactin level in HUVECs was significantly increased (p<0.0001), and after knockdown of the cactin gene, the cactin expression level in HUVECs was significantly decreased (p<0.0001).
[0152] Overexpression of Cactin inhibits NF-κB transcriptional activity and improves the inflammatory response of HUVECs induced by disturbed blood flow
[0153] Dual-luciferase assays for NF-κB transcriptional activity revealed that cactin overexpression reduced NF-κB transcriptional activity compared with the empty vector group (P < 0.05). After 24 hours of stimulation with disturbed blood flow, NF-κB transcriptional activity increased (P < 0.01), and cactin overexpression reversed the increased NF-κB transcriptional activity induced by disturbed blood flow (P < 0.01). Western blot analysis of TNF-α and VCAM-1 protein expression revealed that cactin overexpression reduced TNF-α (P < 0.001) and VCAM-1 (P < 0.05) protein expression compared with the empty vector group. After 24 hours of stimulation with disturbed blood flow, TNF-α and VCAM-1 protein expression increased (P < 0.01), and cactin overexpression reduced the TNF-α (P < 0.05) and VCAM-1 (P < 0.01) protein expression levels induced by disturbed blood flow.
[0154] Cactin knockdown enhances NF-κB transcriptional activity and aggravates the inflammatory response of HUVECs induced by disturbed blood flow
[0155] The inventors used dual luciferase assays to detect NF-κB transcriptional activity and found that cactin knockdown increased NF-κB transcriptional activity compared with the NC group (P < 0.05). After 24 hours of disturbed blood flow, NF-κB transcriptional activity increased (P < 0.0001), and cactin knockdown further increased NF-κB transcriptional activity (P < 0.01). Western blot analysis of TNF-α and VCAM-1 protein expression revealed that cactin knockdown increased TNF-α (P < 0.0.05) and VCAM-1 (P < 0.05) protein expression compared with the NC group. After 24 hours of disturbed blood flow, TNF-α (P < 0.001) and VCAM-1 (P < 0.01) protein expression increased, and cactin knockdown further increased TNF-α (P < 0.01) and VCAM-1 (P < 0.01) protein expression.
[0156] Cactin regulates monocyte adhesion induced by disturbed blood flow
[0157] The inventors found that by co-culturing THP-1 and HUVECs, overexpression of cactin reduced THP-1 adhesion compared with the empty control group (P<0.001). However, after 24 hours of disturbed blood flow, THP-1 adhesion increased (P<0.01). Overexpression of cactin reduced the increase in THP-1 adhesion induced by disturbed blood flow (P<0.001). Compared with the NC group, knockdown of cactin increased THP-1 adhesion (P<0.05). After 24 hours of disturbed blood flow, THP-1 adhesion increased (P<0.01). Knockdown of cactin further increased THP-1 adhesion (P<0.001).
[0158] The inventors analyzed the expression and distribution of Cactin by immunohistochemical staining of mouse aortas. For the first time, they found that there were significant differences in the expression of Cactin in the aortic arch, with the inner bend being significantly stronger than the outer bend. In the endothelial cells and smooth muscle cells of the inner bend of the aortic arch, Cactin expression was stronger than that in the outer bend. In the descending aorta segment, there was no significant difference in the expression of Cactin on both sides of the blood vessels. In view of the above-mentioned role of Cactin, increased Cactin expression may be related to inflammation induced by disturbed blood flow. In in vitro experiments, the inventors used HUVEC cells as the subject, simulated disturbed blood flow to stimulate HUVECs in vitro, and confirmed that disturbed blood flow increased the mRNA and protein expression of Cactin, and activated the NF-κB pathway.
[0159] Next, the inventors investigated whether cactin also affects NF-κB transcriptional activity in human umbilical vein endothelial cells. HUVECs were treated with either cactin knockdown or overexpression. Compared with the empty vector group, cactin overexpression inhibited NF-κB transcriptional activity. Compared with the negative control group, NF-κB transcriptional activity increased after cactin knockdown. This suggests that cactin can inhibit NF-κB transcriptional activity in human umbilical vein endothelial cells. To further validate the role of cactin, the inventors stimulated HUVECs with simulated perturbed blood flow in vitro for 24 hours. The results showed that NF-κB transcriptional activity was also inhibited in HUVECs treated with cactin overexpression compared to the empty vector group. Similarly, in the cactin knockdown group, NF-κB transcriptional activity increased after perturbed blood flow stimulation. This further demonstrates that cactin is involved in perturbed blood flow-induced endothelial inflammation.
[0160] Perturbed blood flow can promote monocyte adhesion. The present study showed that 24 hours after perturbed blood flow stimulation, overexpression of cactin inhibited VCAM-1 expression and adhesion of THP-1 cells to HUVECs, while knockdown of cactin further increased VCAM-1 expression and adhesion of THP-1 cells to HUVECs. These findings suggest that cactin may inhibit VCAM-1 expression by suppressing NF-κB transcriptional activity, thereby inhibiting THP-1 cell adhesion to HUVECs.
[0161] In summary, this study is the first to reveal that cactin distribution is differentially expressed in the mouse aortic arch and is associated with hemodynamics. Cactin can alleviate endothelial inflammation induced by disturbed blood flow and reduce monocyte adhesion to endothelial cells by inhibiting NF-κB transcriptional activity.
Claims
1. Use of Cactin in the preparation of a drug for preventing or treating vascular endothelial inflammatory diseases; the Cactin sequence is shown below: GTGAGGAGTACATGGGCTACAC(F)(SEQ ID NO:1); ATCCTCTTGTTCCGCTCCTTCA (R) (SEQ ID NO: 2).
2. The use according to claim 1, characterized in that: By promoting the expression of Cactin in the patient's body, the occurrence of vascular endothelial inflammation can be inhibited, thereby achieving the purpose of preventing or treating vascular endothelial inflammation.
3. The use according to claim 1, characterized in that: The vascular endothelial inflammatory disease is atherosclerosis.