Flammulina variety x129, method for identifying the same and application thereof

By using spore-to-spore hybridization and MNP marker site identification methods, the problem of early cap opening in enoki mushroom production has been solved, and a enoki mushroom variety X129 with a short growth cycle, strong disease resistance, and high yield has been provided to meet market demand and is suitable for industrial production.

CN120607971BActive Publication Date: 2026-02-03SHANGHAI XUERONG BIOTECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510835945.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2026-02-03
Estimated Expiration
2045-06-20

AI Technical Summary

Technical Problem

Existing enoki mushroom varieties have problems in production, such as premature cap opening, easy loosening of roots after harvesting, and yellowing. In addition, the variety identification methods are not accurate enough, leading to confusion in production and difficulty in meeting market demand.

Method used

To develop a new enoki mushroom variety, X129, and its identification method, a variety with thick caps, robust stipes, and few buds was obtained through single-spore hybridization. The variety was then identified using a molecular fingerprint composed of eight specific MNP marker sites.

Benefits of technology

It provides enoki mushroom varieties with short growth cycles, strong disease resistance, high yield, good appearance, and good taste, solving the problem of accuracy in variety identification, meeting diversified market demands, and suitable for year-round bottle cultivation in factories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120607971B_ABST
    Figure CN120607971B_ABST
Patent Text Reader

Abstract

The application discloses a flammulina velutipes variety X129, an identification method and application thereof. The flammulina velutipes variety X129 is preserved in the China General Microbiological Culture Collection Center (address: No. 3, Beichen West Road, Chaoyang District, Beijing, China) on June 6, 2025, and the biological preservation number is CGMCC No. 42022. The flammulina velutipes variety X129 provided by the application has a thick and non-opening cap, a thick and strong stem, few nodes, small pores in a transverse section and a white cut root.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of enoki mushroom breeding and strain molecular identification technology, specifically involving an enoki mushroom variety X129 and its identification method and application. Background Technology

[0002] Enoki mushroom (Flammulina filiformis) is the earliest edible mushroom variety to achieve factory-scale production in my country. In 2023, its output climbed to 1.8738 million tons, ranking first among factory-cultivated edible mushroom varieties and becoming one of the most industrialized and competitive varieties in the market. However, in terms of seed industry self-sufficiency, exemplified by white enoki mushrooms, my country lags significantly behind developed countries, with a very high dependence on foreign sources for key seed sources. Currently, domestic enterprises mainly import the 'T' series white spawn from Japan's Chikuma Corporation through a "spawn usage fee" method. Tissue (substrate) isolation is a widely adopted method for obtaining strains in the edible mushroom industry, resulting in numerous instances of "synonyms" (different names for the same strain) in production, causing confusion in the production of seeds and making it difficult to protect the rights of breeders. Problems such as abnormal primordia development, patchy buds, premature cap opening, and watery mushrooms seriously affect yield and marketability, impacting the economic benefits of enterprises. Furthermore, with market development, the market and consumers have increasingly higher requirements for the quality of enoki mushrooms, and traditional enoki mushroom varieties are unable to meet market demand. Summary of the Invention

[0003] The purpose of this invention is to address the shortcomings of existing cultivar identification techniques by providing a cultivar X129 of enoki mushroom (Flammulina filiformis) and its identification method.

[0004] Another objective of this invention is to provide a cultivar X129 of enoki mushroom (Flammulina filiformis) with thick caps and no cap opening, and its identification method, addressing the problem of premature cap opening in enoki mushroom production.

[0005] Another objective of this invention is to address the problems in existing enoki mushroom production, such as the roots easily becoming loose and yellow after harvesting, by providing a enoki mushroom (Flammulina filiformis) variety X129 with a thick stipe, few buds, small pores in cross-section, and off-white roots, along with its identification method.

[0006] The first aspect of this application provides a strain of *Flammulina filiformis* X129, which was deposited on June 6, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China), with the biological accession number CGMCC No. 42022.

[0007] In some embodiments, the fruiting bodies of the enoki mushroom (Flammulina filiformis) variety X129 have the characteristics of being off-white in color, having thick caps without opening, stout stipes, fewer buds, firm roots, and slightly yellow when cut.

[0008] The aforementioned enoki mushroom variety X129 was bred from parent X69 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) and parent X70 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) through single-spore hybridization. On PDA medium, enoki mushroom variety X129 exhibits the following characteristics: white, robust mycelium with a slightly pale outer layer, no conidia, round, velvety colonies with long tips, and an optimal culture temperature of 19℃–20℃. At harvest, the fruiting bodies have small, round, thick, inwardly curled caps with a mountain-shaped apex in longitudinal section; the stipe is columnar, robust, and slightly yellowish; there are few buds; the root is compact, with small pores in cross-section; and the root is off-white after cutting. Overall, the product has good commercial characteristics and quality.

[0009] The second aspect of this application provides a method for identifying the enoki mushroom (Flammulina filiformis) variety X129 described in any of the above embodiments, wherein the identification method uses a molecular fingerprint spectrum composed of 8 specific MNP marker sites for identification.

[0010] In some embodiments, the primer sequences for the eight specific MNP marker sites are as follows:

[0011] Forward primer (5'-3') of MNP 1 SEQ ID NO.1:

[0012] CAAGATGGCATCTTCTTGGGAA;

[0013] Reverse primer (5'-3') SEQ ID NO.2:

[0014] GATGAATGGAGAAAGCCGTATGTAC;

[0015] Forward primer (5'-3') of MNP 2 SEQ ID NO.3:

[0016] GAAATAGACACTGCCGTCAACTTC;

[0017] Reverse primer (5'-3') SEQ ID NO.4:

[0018] TCGATAAGCAAGTTGGTCTCCAA;

[0019] Forward primer (5'-3') of MNP 3 SEQ ID NO. 5:

[0020] TTTTCAACCTGGAGACGAAGATTGA;

[0021] Reverse primer (5'-3') SEQ ID NO. 6:

[0022] AACAATACGCAATCGATACCAAGAC;

[0023] Forward primer (5'-3') for MNP 4 SEQ ID NO.7:

[0024] GTAAACATTGAGGCTATCATACCGC;

[0025] Reverse primer (5'-3') SEQ ID NO: 8

[0026] GGGTATATCATTCGCTAGATGCAGA;

[0027] Forward primer (5'-3') of MNP 5 SEQ ID NO.9:

[0028] GTCAATCATGAAGTGGCTGAAGTG;

[0029] Reverse primer (5'-3') SEQ ID NO.10:

[0030] AGAATACCTGGACAAGAAAGCTGTC;

[0031] Forward primer (5'-3') for MNP 6 SEQ ID NO.11:

[0032] GTATAAAGCCCACAGCCTTCTTACT;

[0033] Reverse primer (5'-3') SEQ ID NO.12:

[0034] AACACGGATGACAAGATCCATATCT;

[0035] Forward primer (5'-3') for MNP 7 SEQ ID NO.13:

[0036] CATTGACAGGAACAGCAACACC;

[0037] Reverse primer (5'-3') SEQ ID NO.14:

[0038] GAGAAAAAGTTCTATGAACCAGCCC;

[0039] Forward primer (5'-3') for MNP 8 SEQ ID NO.15:

[0040] CATAGCATAGGTGGATAAAATGCGG;

[0041] Reverse primer (5'-3') SEQ ID NO.16:

[0042] GTCTTGAAGATGGCAACCAATCTG.

[0043] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X129 includes the following steps:

[0044] (1) Extract total genomic DNA from the mycelia of all the samples of *Flammulina velutipes* to be tested;

[0045] (2) Using the total genomic DNA as a template, PCR amplification was performed using primers as described in MNP1 to MNP8;

[0046] (3) Sequencing each amplification product separately to obtain sequencing data;

[0047] (4) Based on the sequencing data, determine the genotype of 8 loci in each enoki mushroom mycelial sample to be tested. If the genotype corresponding to the 8 loci is a heterozygous sequence, then the enoki mushroom to be tested is the X129 variety; otherwise, the enoki mushroom to be tested is a non-X129 variety.

[0048] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X129 involves using a kit to extract total genomic DNA from the mycelia of all enoki mushroom samples to be tested.

[0049] In some embodiments, the PCR amplification system in the identification method for the enoki mushroom (Flammulina filiformis) variety X129 includes:

[0050] 0.2 μM 4 μL primer set;

[0051] 20 ng / μL~30 ng / μL DNA template 4 μL;

[0052] GenoPlexs 3×T Master Mix 10μL;

[0053] ddH2O 12μL.

[0054] In some embodiments, the PCR amplification reaction program is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 20 s, 60°C annealing for 4 min, 15 cycles; 72°C extension for 4 min; 10°C storage.

[0055] In some embodiments, the identification method for the Flammulina filiformis variety X129 uses an Illumina Next Seq550 for sequencing each amplification product.

[0056] The third aspect of this application provides the application of the enoki mushroom (Flammulina filiformis) variety X129 described in any of the above embodiments in enoki mushroom breeding.

[0057] The fourth aspect of this application provides the application of the enoki mushroom (Flammulina filiformis) variety X129 described in any of the above embodiments in food production.

[0058] The enoki mushroom variety X129 in this application is an excellent industrialized variety with a short growth cycle, strong disease resistance, high yield, good appearance, good taste, and high nutritional quality. It provides a foundation for breaking through the predicament faced by the enoki mushroom industry and for the industry's transformation and upgrading.

[0059] In this application, the *Flammulina velutipes* variety X129, after factory-scale bottle cultivation, achieved an average yield of 555g / bottle (1500mL), higher than the parent varieties X69 (545g / bottle) and X70 (500g / bottle). Its growth cycle was 1 day faster than parent X69 and 2 days slower than parent X70. The caps of *Flammulina velutipes* variety X129 are thick, with an average diameter of 6.73mm, an average thickness of 1.64mm, and an average height of 4.23mm; the stipes have an average diameter of 3.5mm and an average length of 16.6mm. The fruiting bodies of *Flammulina velutipes* variety X129 are off-white; the caps are small, round, thick, and inwardly curled, with a mountain-shaped apex in longitudinal section; the stipes are relatively thick, and the fruiting bodies develop uniformly. Compared to parent variety X69, the caps are slightly larger, have better inward curling, are less prone to opening, and are slightly yellowish in color; compared to parent variety X70, the stipes are thicker, have fewer lateral buds, are more compact, and are lighter in color. The enoki mushroom variety X129 possesses excellent traits, meets diverse market demands, and is suitable for year-round bottle cultivation in industrial settings, demonstrating promising prospects for application and promotion. The MNP fingerprint spectrum of enoki mushroom variety X129 exhibits specificity and particularity for identifying this variety, providing reliable and accurate results. Compared to morphological identification, it offers advantages such as intuitive visualization, minimal error, and immunity to environmental factors. Attached Figure Description

[0060] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below, wherein:

[0061] Figure 1 A control diagram showing the mycelial antagonism test between enoki mushroom variety X129 and its parents X69 and X70;

[0062] Figure 2 The mycelial growth diagrams show the enoki mushroom variety X129, its parents X69 and X70, and the main cultivated varieties.

[0063] Figure 3 Shake bottle growth diagrams of Enoki mushroom variety X129, parental lines X69 and X70, and the main cultivated varieties;

[0064] Figure 4 The images show the frontal morphology of the fruiting bodies of the enoki mushroom variety X129, its parents X69 and X70, and the main cultivated varieties at the time of harvest.

[0065] Figure 5 Side view of the fruiting bodies of enoki mushroom variety X129, parent X69 and parent X70, and the main cultivated variety at the time of harvest;

[0066] Figure 6 The images show the root morphology of the fruiting bodies of the enoki mushroom variety X129, its parents X69 and X70, and the main cultivated varieties at the time of harvest. Detailed Implementation

[0067] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to examples. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0068] In the description of this invention, "several" means one or more, "multiple" means two or more, "greater than", "less than", "exceeding" etc. are understood to exclude the number itself, and "above", "below", "within" etc. are understood to include the number itself.

[0069] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0070] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to specific examples.

[0071] Flammulina strain X69 is a cultivar of Flammulina independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits: dense white mycelium with a lighter inner ring, slow growth rate, and prominent conidia. In Erlenmeyer flasks and shake flasks, the strain grows slowly, has low mycelial content, small mycelial balls, short spines, a few fragments, and a thicker clear layer. During fruiting in the growing room, mycelial growth is slow, and there is no bud shedding; at harvest, the fruiting bodies have thick caps, robust and compact stipes, and are relatively white after root cutting, with a biological conversion rate of 150%–160%. However, scratching can cause clogging of the pores, resulting in spoilage. In the fruiting stage of the growing room, the strain exhibits disadvantages such as patchy buds, a small number of buds, and partially opened caps on the fruiting bodies.

[0072] The enoki mushroom strain X70 is also a cultivated variety of enoki mushroom independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits relatively dark white mycelium with a lighter outer ring and no conidia. In Erlenmeyer flasks and shake flasks, the strain grows rapidly, producing small fruiting bodies with short spines and a small amount of clear layer. During the fruiting stage in the growing room, the growth rate is relatively fast; at harvest, the fruiting bodies have small, thick caps that do not open, thin stipes, and an overall yellowish color, with a biological conversion rate of 145%–155%. However, it has drawbacks such as a small number of bud drop during bud emergence, lower uniformity of fruiting bodies, more lateral buds, more crystal mushrooms, and generally lower firmness.

[0073] One embodiment of this application provides a strain of enoki mushroom (Flammulina filiformis) X129, which was deposited on June 6, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China), with the biological accession number CGMCC No. 42022.

[0074] In this application, the breeding steps for the enoki mushroom variety X129 are as follows:

[0075] White enoki mushroom strains X69 and X70 were selected as parents. Spores from both strains were collected, and single-spore strains were selected. Thirteen X69 single-spore strains and seven X70 single-spore strains with normal mycelial growth and moderate growth rate were selected. These single-spore strains were then subjected to single-single hybridization, and microscopic examination revealed a total of 89 hybrid strains with clamp connections. In the laboratory, 62 hybrid progeny were initially screened based on colony morphology, growth rate, and mycelial morphology in shake flasks, resulting in six superior hybrid strains. Fruiting was then conducted at Shandong Xuerong Biotechnology Co., Ltd., yielding four hybrid strains with faster mycelial growth, shorter growth cycle, smaller caps, higher yields, and thicker stipes for secondary screening. The secondary screening results showed that two hybrid strains had higher yields than the parents and the main cultivated varieties. Further pilot-scale trials were conducted using the parent strain and the main cultivated variety as controls. The results showed that strain X129 performed exceptionally well, with significantly higher yields than the parent strain and the main cultivated variety. The fruiting bodies were slightly yellowish-white, with normal-sized, round, and thick caps; the stipes were robust; the number of buds was low; the rootstock was firm; the cross-section showed small holes; and the cut root was off-white. Overall, the commercial characteristics and quality were good. This variety was named X129, and a plant variety right was applied for.

[0076] In some embodiments, the fruiting bodies of the enoki mushroom (Flammulina filiformis) variety X129 have the characteristics of being off-white in color, having thick caps without opening, stout stipes, fewer buds, firm roots, and slightly yellow when cut.

[0077] The MNP fingerprint spectrum of enoki mushroom variety X129 possesses specificity and particularity for identifying this variety, yielding reliable results. Compared to morphological identification, it offers advantages such as intuitiveness, minimal error, and immunity to environmental factors. The enoki mushroom variety X129 described in this application is a superior, commercially viable variety with a short growth cycle, strong disease resistance, high yield, excellent appearance, good taste, and high nutritional value. It provides a foundation for breaking through the current challenges facing the enoki mushroom industry and for its transformation and upgrading.

[0078] The comparison diagram of mycelial antagonism test between enoki mushroom variety X129 and its parents X69 and X70 is shown in the figure. Figure 1 As shown.

[0079] See the mycelial growth and shake flask growth diagrams of enoki mushroom variety X129, parental lines X69 and X70, and the main cultivated variety. Figure 2 As shown.

[0080] See the morphological images of the fruiting bodies of enoki mushroom variety X129, its parents X69 and X70, and the main cultivated varieties. Figure 3 As shown.

[0081] The aforementioned enoki mushroom variety X129 was bred from parent X69 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) and parent X70 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) through single-spore hybridization. On PDA medium, enoki mushroom variety X129 exhibits the following characteristics: white, robust mycelium with a slightly pale outer layer, no conidia, round, velvety colonies with long tips, and an optimal culture temperature of 19–20℃. At harvest, the fruiting bodies have small, round, thick, inwardly curled caps with a mountain-shaped apex in longitudinal section; the stipe is columnar, robust, and slightly yellowish; there are few buds; the root is compact, with small pores in cross-section; and the root is off-white after cutting. Overall, the product has good commercial characteristics and quality.

[0082] Traditional enterprises mainly promote and produce enoki mushroom varieties with narrow genetic bases and highly similar phenotypic traits, making them difficult to distinguish using traditional morphological identification methods, leading to frequent identification errors and varietal contamination. Methods such as ISSR and RAPD rely on gel electrophoresis for identification, and PCR amplification results are often difficult to replicate due to mismatches, requiring continuous optimization of the reaction system to improve reliability. With the rapid development of high-throughput sequencing technology, developing highly reproducible and accurate varietal identification techniques at the whole-genome level has become a new trend. In 2020, MNP markers were promulgated and implemented as a national standard, "MNP Marker Method for Plant Variety Identification" (GB / T 38551-2020). Therefore, developing an accurate, reliable, stable, low-workload, and high-throughput varietal identification method provides technical support for the protection of intellectual property rights for enoki mushroom varieties in my country, market supervision, and rapid identification in varietal dispute arbitration.

[0083] Based on this, one embodiment of this application also provides a method for identifying the Flammulina filiformis variety X129 described in any of the above embodiments, wherein the identification method uses a molecular fingerprint spectrum composed of 8 specific MNP marker sites for identification.

[0084] In some embodiments, the primer sequences for the specific MNP marker sites are as follows:

[0085] Forward primer (5'-3') of MNP 1 SEQ ID NO.1:

[0086] CAAGATGGCATCTTCTTGGGAA;

[0087] Reverse primer (5'-3') SEQ ID NO.2: GATGATGGAGAAAGCCGTATGTAC; Forward primer (5'-3') SEQ ID NO.3: GAAATAGACACTGCCGTCAACTTC;

[0088] Reverse primer (5'-3') SEQ ID NO.4: TCGATAAGCAAGTTGGTCTCCAA; Forward primer (5'-3') SEQ ID NO.5: TTTTCAACCTGGAGACGAAGATTGA; Reverse primer (5'-3') SEQ ID NO.6: AACAATCGCAATCGATACCAAGAC; Forward primer (5'-3') SEQ ID NO.7: GTAAACATTGAGGCTATCATACCGC;

[0089] Reverse primer (5'-3') SEQ ID NO.8: GGGTATATCATTCGCTAGATGCAGA; Forward primer (5'-3') SEQ ID NO.9: GTCAATCATGAAGTGGCTGAAGTG;

[0090] Reverse primer (5'-3') SEQ ID NO.10: AGAATACCTGGACAAGAAAGCTGTC; Forward primer (5'-3') of MNP 6 SEQ ID NO.11: GTATAAAGCCCACAGCCTTCTTACT;

[0091] Reverse primer (5'-3') SEQ ID NO.12: AACACGATGACAAGATCCATATCT; Forward primer (5'-3') SEQ ID NO.13: CATTGACAGGAACAGCAACACC;

[0092] Reverse primer (5'-3') SEQ ID NO.14: GAGAAAAAGTTCTATGAACCAGCCC; Forward primer (5'-3') SEQ ID NO.15: CATAGCATAGGTGGATAAAATGCGG; Reverse primer (5'-3') SEQ ID NO.16: GTCTTGAAGATGGCAACCAATCTG.

[0093] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X129 includes the following steps:

[0094] (1) Extract total genomic DNA from the mycelia of all the samples of *Flammulina velutipes* to be tested;

[0095] (2) Using the total genomic DNA as a template, PCR amplification was performed using primers as described in MNP 1 to MNP 8;

[0096] (3) Sequencing each amplification product separately to obtain sequencing data;

[0097] (4) Based on the sequencing data, determine the genotype of 8 loci in each enoki mushroom sample to be tested. If the genotype corresponding to the 8 loci is a heterozygous sequence, then the enoki mushroom to be tested is the X129 variety; otherwise, the enoki mushroom to be tested is a non-X129 variety.

[0098] In some embodiments, the identification method for the enoki mushroom (Flammulina filiformis) variety X129 involves using a kit to extract total genomic DNA from the mycelia of all enoki mushroom samples to be tested.

[0099] In some embodiments, the PCR amplification system in the identification method for the enoki mushroom (Flammulina filiformis) variety X129 includes:

[0100] 0.2 μM 4 μL primer set;

[0101] 20 ng / μL~30 ng / μL DNA template 4 μL;

[0102] GenoPlexs 3×T Master Mix 10μL;

[0103] ddH2O 12μL.

[0104] In some embodiments, the PCR amplification reaction program is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 20 s, 60°C annealing for 4 min, 15 cycles; 72°C extension for 4 min; 10°C storage.

[0105] In some embodiments, the identification method for the Flammulina filiformis variety X129 uses an Illumina Next Seq550 for sequencing each amplification product.

[0106] One embodiment of this application also provides the application of the enoki mushroom (Flammulina filiformis) variety X129 described in any of the above embodiments in enoki mushroom breeding.

[0107] One embodiment of this application also provides the application of the enoki mushroom (Flammulina filiformis) variety X129 described in any of the above embodiments in food production.

[0108] In this application, the *Flammulina velutipes* variety X129, after factory-scale bottle cultivation, achieved an average yield of 555g / bottle (1500mL), higher than the parent varieties X69 (545g / bottle) and X70 (500g / bottle). Its growth cycle was 1 day faster than the parent control X69 and 2 days slower than X70. The caps of *Flammulina velutipes* variety X129 are thick, with an average diameter of 6.73mm, an average thickness of 1.64mm, and an average height of 4.23mm; the stipes have an average diameter of 3.5mm and an average length of 16.6mm. The fruiting bodies of *Flammulina velutipes* variety X129 are off-white; the caps are small, round, thick, and inwardly curled, with a mountain-shaped apex in longitudinal section; the stipes are relatively thick, and the fruiting bodies develop uniformly. Compared to the parent variety X69, the caps are slightly larger, have better inward curling, are less prone to opening, and are slightly yellowish in color; compared to the parent variety X70, the stipes are thicker, have fewer lateral buds, are more compact, and are lighter in color. The enoki mushroom variety X129 possesses excellent traits, meets diverse market demands, and is suitable for year-round bottle cultivation in industrial settings, demonstrating promising prospects for application and promotion. The MNP fingerprint spectrum of enoki mushroom variety X129 exhibits specificity and particularity for identifying this variety, providing reliable and accurate results. Compared to morphological identification, it offers advantages such as intuitive visualization, minimal error, and immunity to environmental factors.

[0109] Example 1

[0110] A method for identifying the enoki mushroom variety X129, which uses a molecular fingerprint composed of 8 specific MNP marker sites for identification, specifically including the following steps:

[0111] Test materials: A total of 216 Enoki mushroom strains were tested, including strain X129, the parent strain, and the main cultivated variety.

[0112] (1) Mycelial culture: The enoki mushroom strain X129 was transferred to potato dextrose agar (PDA) solid medium and cultured at 19°C for 7 days before mycelial culture was collected.

[0113] (2) Total genomic DNA extraction: Total genomic DNA was extracted from the above-mentioned Flammulina velutipes mycelial samples using a kit. The purity of the DNA in the Flammulina velutipes mycelial samples was determined using a spectrophotometer. The concentration of 1 μL of the DNA in the Flammulina velutipes mycelial samples was determined using a Qubit fluorescence quantitative analyzer. The concentration of the sample DNA was adjusted to be between 30 ng / μL and 50 ng / μL.

[0114] (3) Multiplex polymerase chain reaction (PCR): The MNP marker sites of the extracted Flammulina velutipes strain X129 were amplified by multiplex PCR to obtain multiplex PCR amplification products.

[0115] (3-1) The multiplex PCR amplification system is as follows: total volume 30 μL, including: 4 μL primer set (each primer concentration is 0.2 μM), 4 μL (concentration 20 ng / μL~30 ng / μL) total genomic DNA of the *Flammulina velutipes* mycelial sample to be tested, 10 μL GenoPlexs 3×TMaster Mix (manufacturer: Shijiazhuang Borui Biotechnology Co., Ltd.), 12 μL ddH2O, shake and mix well to obtain the mixture for PCR amplification.

[0116] (3-2) PCR amplification reaction program: 95℃, 3 min; (95℃, 20 s; 60℃, 4 min) × 15 cycles; 72℃, 4 min; store at 10℃. Purify the multiplex PCR amplification products.

[0117] (4) Construction of high-throughput sequencing libraries and sequencing: Perform high-throughput sequencing on the high-throughput sequencing libraries obtained from multiplex PCR amplification according to the operating instructions of the high-throughput sequencing kit and high-throughput sequencer. The average coverage of the high-throughput sequencing was set to be greater than 700-fold, and the sequencing length was not less than 300 bp.

[0118] (4-1) Constructing a high-throughput sequencing library: Add 10 μL GenoPlexs3×TMaster Mix, 2 μL 5 μM P5 primer, 2 μL 5 μM P7 barcode primer (the primer contains the sample barcode) and 16 μL ddH2O to the multiplex PCR amplification product, vortex to mix and centrifuge briefly.

[0119] Multiplex PCR amplification reaction program: 95℃, 3 min; (95℃, 15 s; 58℃, 15 s; 70℃, 30 s) × 8 cycles; 72℃, 5 min; store at 10℃. After purification of the amplification products, a sequencing library is obtained.

[0120] (4-2) Sequencing: High-throughput sequencing was performed using an Illumina Next Seq550 sequencer to sequence the sequencing library and obtain sequencing data of the *Flammulina velutipes* mycelial samples to be tested. For detailed sequencing steps, please refer to the instruction manual of the sequencer.

[0121] (5) Data alignment: The sequencing data of *Flammulina velutipes* strain X129 were homologously aligned to the DNA sequences of MNP marker sites on the *Flammulina velutipes* reference genome, and the average coverage fold of the detected marker sites was statistically analyzed. The genotypes of the detected MNP marker sites were recorded as all detected alleles of that site. The detected alleles refer to the detected DNA fragment consisting of the first to last base of the marker, and different detected alleles are separated by " / ".

[0122] Using Bowtie2 (version 2.1.0) software, the sequencing data of the *Flammulina velutipes* mycelial samples were aligned to the *Flammulina velutipes* reference genome to obtain the DNA sequence of the MNP markers for each mycelial sample. The alignment results were saved in SAM (The Sequence Alignment / Map format). The eight MNP marker sites and primer information for *Flammulina velutipes* variety X129 are shown in Table 1.

[0123] Table 1. List of 8 MNP marker sites and primer information for Flammulina velutipes variety X129

[0124]

[0125] Multiplex PCR amplification and sequencing were performed on 216 enoki mushroom varieties. The sequencing data showed that at eight MNP loci, the genotype corresponding to X129 in all 216 varieties was heterozygous, while the genotypes corresponding to the remaining MNP loci were homozygous. This indicates a significant difference in the DNA fingerprinting between X129 and its parents and the main cultivated varieties.

[0126] (6) Calculation of genetic similarity: Based on the principle that different strains of *Flammulina velutipes* are considered to have differences if there is at least one SNP difference in the alleles of the same MNP marker locus, the number of differentially expressed MNP markers in pairwise comparisons of different *Flammulina velutipes* strains was counted, and marker loci that can significantly distinguish any *Flammulina velutipes* strain were screened based on the differentially expressed MNP marker loci. When the genetic similarity (GS) between the *Flammulina velutipes* mycelial sample to be tested and the control sample is less than 97%, it is determined to be "different strains".

[0127] Genetic similarity GS = n / N × 100%, where N is the number of MNP loci co-amplified by the test strain and variety X129, and n is the number of MNP loci with the same genotype among the MNP loci co-amplified by the test strain and variety X129. The genetic similarity results between the enoki mushroom variety X129 and 215 other enoki mushroom strains are shown in Table 2.

[0128] Table 2. Genetic similarity (GS) between enoki mushroom variety X129 and 215 other enoki mushroom strains.

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] As shown in Table 2, the highest genetic similarity between the *Flammulina velutipes* cultivar X129 and the other 215 *Flammulina velutipes* strains was 89.44%, and the lowest was 0%. The genetic similarity with the parent X69 (test number: JZG221224126) was 82.46%, with the parent X70 (test number: JZG221224127) at 80.00%, and with the main cultivated variety (test number: JZG220608004) at 81.34%. These results indicate significant genetic differences between the *Flammulina velutipes* cultivar X129 and its parents, the main cultivated variety, and other *Flammulina velutipes* strains. This demonstrates that the MNP marker locus constructed in this paper can effectively identify the *Flammulina velutipes* cultivar X129.

[0136] Example 2

[0137] This embodiment is used for a comparative cultivation experiment of the enoki mushroom variety X129 obtained in Example 1 for industrial production.

[0138] Comparative testing strains: X129, main production varieties

[0139] Test site: Shandong Xuerong Biotechnology Co., Ltd. (hereinafter referred to as Shandong Xuerong Company).

[0140] Experimental setup: The inoculum strains for the experiments were prepared uniformly and cultivated in factory-scale bottle culture (1500mL, 353g / bottle (dry substrate)) according to the production management methods of Shandong Xuerong Company. Specific cultivation information is shown in Table 3.

[0141] Table 3. Multi-batch variety comparison cultivation experiment

[0142]

[0143] As shown in Table 3, among them:

[0144] (1) The average growth cycle of the enoki mushroom variety X129 is 25.5 days, while the average growth cycle of the main cultivated variety is 26.5 days. The growth cycle of the enoki mushroom variety X129 is 1 day shorter than that of the control main cultivated variety.

[0145] (2) The average yield per bottle of the enoki mushroom variety X129 was 555g, while the average yield per bottle of the main cultivated variety was 545g. The average yield per bottle of the enoki mushroom variety X129 was 1.83% higher than that of the control main cultivated variety (significant difference).

[0146] (3) In terms of commercial characteristics, the fruiting body cap of the enoki mushroom variety X129 is thicker than that of the control main cultivated variety, and it is not easy to open the cap. The stipe is thicker than that of the control main cultivated variety, and the firmness is more compact than that of the control main cultivated variety. After the root is cut, the cut surface is delicate and not easy to loosen, and it is resistant to storage.

[0147] The results show that X129 has excellent overall performance, meets the requirements of the industrialized cultivation and production model of enoki mushrooms and the market quality demand, and has huge market potential.

[0148] The enoki mushroom variety X129 and the main production variety underwent multiple cultivation trials, and the results are shown in Table 4.

[0149] Table 4 Results of multiple batch cultivation trials

[0150]

[0151] Note: '**' indicates P<0.01, meaning the difference is extremely significant; '*' indicates P<0.05, meaning the difference is significant; ' / ' indicates no significant difference.

[0152] Example 3

[0153] This embodiment provides a cultivation method for the enoki mushroom variety X129.

[0154] The cultivation method for enoki mushroom variety X129 includes the following steps:

[0155] (1) Ingredients: The cultivation material is accurately measured according to the formula requirements, and the materials are thoroughly mixed. Water is added until the moisture content reaches 67.5%-69.5% and the pH value is 6.5-7.0. The stirring time is adjusted according to seasonal changes to prevent the mixture from becoming rancid. Stirring continues until bottling is completed.

[0156] (2) Bottling: Use 1500mL high-temperature resistant plastic bottles to complete the bottling process on a bottling machine. The bottles should be packed tightly at the top and loosely at the bottom, with a filling difference of less than 50g between bottles. The filling height should be 1cm to 1.5cm from the bottle shoulder, and a hole should be punched in the middle to the bottom of the bottle. The bottle cap should be put on immediately after filling.

[0157] (3) Sterilization: After bottling, high-pressure high-temperature sterilization should be carried out immediately, maintaining 100℃ for 60 minutes, and then raising the temperature to 121℃ and maintaining it for 60 minutes. All microorganisms and spores in the culture medium must be completely killed.

[0158] (4) Cooling: After sterilization, the bottles and baskets are pushed into the cooling room to cool to below 22°C. The cooling room and inoculation room are equipped with purification devices and refrigeration equipment.

[0159] (5) Inoculation: Liquid culture inoculation. The temperature inside the bottle should be controlled below 22℃ during inoculation, and microscopic examination should be used to ensure that the liquid culture is uncontaminated and vigorous before it can be used for inoculation and cultivation. The inoculation volume of liquid culture is 35mL to 37mL of bacterial solution per cultivation bottle, of which the wet weight of mycelium is about 1.15g / 10mL and the viable cell count is about 18300cfu / mL.

[0160] (6) Cultivation: The temperature of the cultivation room is controlled at 16℃~18℃, the humidity is maintained at about 80%, and the CO2 concentration is controlled at 2000ppm~3000ppm. The cultivation time is 20d~22d.

[0161] (7) Scratching: After the cultivation is completed, the fully developed cultivation bottles are scratched with a scratching machine. The scratching depth should be 1cm to 1.5cm. Remove the old mycelium blocks on the surface, keep the substrate surface flat, add water, and then enter the growth chamber for fruiting.

[0162] (8) Fruiting body growth: 7-8 days after mycelium recovery and bud emergence, the temperature is controlled at 14℃-16℃, relative humidity at 95%-100%, CO2 concentration at less than 2000ppm, and no light is required; after bud emergence, the temperature is adjusted according to the growth of the mushroom body, controlled within the range of 4℃-15℃, relative humidity at 85%-95%, CO2 concentration at 2000ppm-8000ppm, and light intensity at 5Lux-20Lux.

[0163] (9) Harvesting and packaging: Harvest when the height of the mushroom body reaches the height of the sleeve paper, the cap is not open, and the diameter of the cap is 0.5cm to 1cm. When harvesting, pick the whole bunch of enoki mushrooms, cut off the bottom culture medium with a knife, pack them and put them into a cold storage. The temperature of the cold storage is controlled at 3℃ to 5℃.

[0164] In the above embodiments, the descriptions of each embodiment have different focuses. For parts not described in detail in a certain embodiment, please refer to the relevant descriptions in other embodiments.

[0165] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0166] The above-described embodiments are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A type of enoki mushroom ( Flammulina filiformis X129, characterized in that, This strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 6, 2025, with accession number CGMCC No. 42022.

2. The enoki mushroom as described in claim 1 ( Flammulina filiformis The identification method for X129 is characterized by, The identification method uses a molecular fingerprint composed of 8 specific MNP marker sites for identification. The primer sequences for the 8 specific MNP marker sites are shown below: Forward primer for MNP 1 (SEQ ID NO.1): CAAGATGGCATCTTCTTGGGAA; MNP 1 reverse primer SEQ ID NO.2: GATGATGGAGAAAGCCGTATGTAC; Forward primer for MNP 2, SEQ ID NO.3: GAAATAGACACTGCCGTCAACTTC; MNP 2 reverse primer SEQ ID NO.4: TCGATAAGCAAGTTGGTCTCCAA; Forward primer for MNP 3, SEQ ID NO. 5: TTTTCAACCTGGAGACGAAGATTGA; MNP 3 reverse primer SEQ ID NO.6: AACAATACGCAATCGATACCAAGAC; Forward primer for MNP 4, SEQ ID NO.7: GTAAACATTGAGGCTATCATACCGC; MNP 4 reverse primer SEQ ID NO.8: GGGTATATCATTCGCTAGATGCAGA; Forward primer for MNP 5, SEQ ID NO. 9: GTCAATCATGAAGTGGCTGAAGTG; MNP 5 reverse primer SEQ ID NO.10: AGAATACCTGGACAAGAAAGCTGTC; Forward primer for MNP 6 (SEQ ID NO. 11): GTATAAAGCCCACAGCCTTCTTACT; MNP 6 reverse primer SEQ ID NO.12: AACACGATGACAAGATCCATATCT; Forward primer for MNP 7, SEQ ID NO. 13: CATTGACAGGAACAGCAACACC; MNP 7 reverse primer SEQ ID NO.14: GAGAAAAAGTTCTATGAACCAGCCC; Forward primer for MNP 8, SEQ ID NO. 15: CATAGCATAGGTGGATAAAATGCGG; MNP 8 reverse primer SEQ ID NO.16: GTCTTGAAGATGGCAACCAATCTG; The identification process includes the following steps: (1) Extract total genomic DNA from the mycelia of all the samples of *Flammulina velutipes* to be tested; (2) Using the total genomic DNA as a template, PCR amplification was performed using primers as described in MNP 1 to MNP 8 respectively; (3) Sequencing each amplification product separately to obtain sequencing data; (4) Based on the sequencing data, determine the genotype of 8 specific MNP marker sites in each enoki mushroom sample to be tested; (5) Calculation of genetic similarity: Based on the principle that there is a difference of at least one SNP in the alleles of the same MNP marker locus among different Flammulina velutipes strains, the number of differential MNP markers in pairwise comparisons of different Flammulina velutipes strains was counted. Marker loci that can significantly distinguish any Flammulina velutipes strain were screened based on the differential MNP marker loci. The genetic similarity between the tested strain and Flammulina velutipes X129 was calculated. GS If the percentage is less than 97%, it is determined to be "different strains"; otherwise, it is determined to be "same strains". Genetic similarity GS =n / N×100%, where N is the number of MNP sites co-amplified by the test strain and enoki mushroom X129, and n is the number of MNP sites with the same genotype among the MNP sites co-amplified by the test strain and enoki mushroom X129.

3. The enoki mushroom according to claim 2 ( Flammulina filiformis The identification method for X129 is characterized by, In step (1), total genomic DNA was extracted from all the *Flammulina velutipes* mycelial samples to be tested using a kit.

4. The enoki mushroom according to claim 2 ( Flammulina filiformis The identification method for X129 is characterized by, In step (2), the PCR amplification system includes: 0.2 μM 4 μL primer set; 20 ng / μL~30 ng / μL DNA template 4 μL; GenoPlexs 3×T Master Mix 10μL; ddH2O 12 μL; The PCR amplification reaction program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 20 s, 60 °C annealing for 4 min, 15 cycles; 72 °C extension for 4 min; 10 °C storage.

5. The enoki mushroom according to any one of claims 2-4 ( Flammulina filiformis The identification method for X129 is characterized by, In step (3), Illumina Next Seq550 was used to sequence each amplification product separately.

6. The enoki mushroom as described in claim 1 ( Flammulina filiformis Application of X129 in Enoki Mushroom Breeding 7. The enoki mushroom as described in claim 1 ( Flammulina filiformis Application of X129 in food production.

Citation Information

Patent Citations

  • Pure white flammulina velutipes strain as well as molecular marker and application thereof

    CN117946862A

  • Flammulina velutipes variety with high sweet amino acid content as well as MNP molecular identification method and application of flammulina velutipes variety

    CN119040146A