Metarhizium anisopliae JXASS-01 strain and application of extract of metarhizium anisopliae JXASS-01 strain in pest control

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a metarhizium anisopliae JXASS-01 strain and application of an extract of the metarhizium anisopliae JXASS-01 strain in pest control. The Metarhizium anisopliae # imgabs0 # sp. JXASS-01 is preserved in the China Center for Type Culture Collection on June 8, 2022, the address is No. 299 on eight road, Wuchang District, Wuhan, Hubei Province, and the preservation number is CCTCC NO: M 2022833. The Metarhizium anisopliae # imgabs0 # sp. The metarhizium anisopliae extract has a good killing effect on cotton bollworms and prodenia litura, does not have a series of defects of chemical pesticides, and can realize sustainable treatment on lepidoptera pests.

Description

Technical Field

[0001] The present application belongs to the field of microbial technology, and specifically relates to the application of a Metarhizium anisopliae JXASMS-01 strain and its extract in pest control. Background Art

[0002] Entomopathogenic fungi are parasitic microorganisms that can directly invade insects, rapidly proliferate within them, and cause the death of infected insects. They primarily infect and kill insects and other animals. Entomopathogenic fungi contain numerous potent secondary metabolites, which are rich sources of bioactive chemicals such as polyketides, non-ribosomal peptides, and terpenes. These metabolites have the potential to act as antifeedants and insecticides, effectively overcoming the dependence of fungal agents on specific environments and improving their efficacy and stability. Secondary metabolites of entomopathogenic fungi have been shown to be effective natural alternatives to chemical pesticides. Summary of the Invention

[0003] The purpose of the present invention is to address the deficiencies of the prior art and provide a strain of Metarhizium anisopliae JXASMS-01 and its extract for use in pest control, specifically adopting the following technical solutions: In the first aspect, the present invention provides a strain of Metarhizium anisopliae JXASMS-01, wherein the Metarhizium anisopliae ( Metarhizium sp . ) JXASMS-01 was deposited in the China Center for Type Culture Collection on June 8, 2022, at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit number being CCTCC NO: M 2022833.

[0004] Metarhizium anisopliae JXASMS-01 belongs to the kingdom Fungi, phylum Ascomycota, family Claviceps ( Clavicipitaceae ), a new species of the genus Metarhizium.

[0005] The ITS sequence of the Metarhizium anisopliae JXASMS-01 is shown in SEQ ID No: 1; the MzIGS3 sequence of the Metarhizium anisopliae JXASMS-01 is shown in SEQ ID No: 2.

[0006] SEQ ID No: 1: 。

[0007] SEQ ID No:2: GGTAAGTATGCGATGGTCTCTACCATGTGCCTGACAGCAATTACGACATTGAGGGAGTTGCTCACATCGAAGACGTTGACGTCAAGGACGCGGAAGGAATCTCTGCGCCGCCAGATCACCAGCGCAAGGAAAGTGTTACTGCATGAGATCCTACTCTCGACATGTATAAGTGCAATACGGAATGATGAGCGACTTGAGTTTCGAAAGGCGTTGGAGTTACTTTGTCGTTGGAATAAACACCAGGATACACTATAGAGATACATTCGCATAGGCATTCGATAGCTCTCCGTATTCTTGGAATTAATTTATTGCGGTAGTCATCTGAATCTTTCCCTTGAATCGTTTTAAACTGAAACTGCAGATTGCACGTCATCTTTTTGAACGTTGCCCGAGGCAAATCTTGCACGGAATCCAAACCGACTACGGCTTTACAAACCGCACTTCGTATAAAGAGCAGTTTGAGCGCCTGGTATAACCGGCGAGACATGAGGGATGTAAATCAAGCCGTAGTCGGTATCCACTAGCTTGTAGATTGTAGGACTGCAGGTACATCATCACATGGCCTTTCATCAAAGTCGAACACGAAATCTGCAGTAGCAAGCAGAAAGAGGGATGGGCCTTGGAGCTTGCGCATTTCACATCTGACCTGCTGGTATAAAGACGACGGTTCATTGCCTCTTGCGTGTCCCACTCGGCCATGTACTGACAAGGCAATCCCAAGCAAACTATCGCCTGTGCTGTTGCAGCAGAGCAGGCCGAGCGAGATATGCCCAGACGTTCGTTACATACGCCTAGTTCTGTCGGTTGCTTGAGCCGTTCGCAAGCATTGACTCAAGTACGGTGAGCCAGGTATCGGACCGTATTTCTGCGTCATGTATACGCCTTGGTTTTAAAAAATTCCCGACGAATGCATATTCCCCAAAGGTAAAAGCAGAAGCGGGGGTCGACTCTGGTGTTCAAAAGATAAATGGTACATATTTTGGTCTATTATATCATACAG。

[0008] In a second aspect, the present invention provides a Metarhizium anisopliae JXASMS-01 extract, wherein the Metarhizium anisopliae JXASMS-01 extract comprises the Metarhizium anisopliae JXASMS-01.

[0009] In a third aspect, the present invention provides a method for preparing the above-mentioned Metarhizium anisopliae JXASMS-01 extract, comprising the following steps: The green anisopliae JXASMS-01 was cultured in a liquid culture medium containing starch and 0.3% sucrose solution. After the culture was completed, a solid phase culture was obtained, which was soaked in ethyl acetate overnight, extracted, filtered, rotary evaporated, dried, and finally dissolved in dimethyl sulfoxide to obtain an extract of the green anisopliae JXASMS-01.

[0010] As a further preferred embodiment, the 0.3% sucrose solution contains 0.005% chloramphenicol.

[0011] In a fourth aspect, the present invention provides the use of the above-mentioned Metarhizium anisopliae JXASMS-01 and / or its fermentation liquid and / or its extract in the preparation of agricultural pest control agents.

[0012] In a fifth aspect, the present invention provides an agricultural pest control agent containing the above-mentioned Metarhizium anisopliae JXASMS-01 and / or its fermentation liquid and / or its extract.

[0013] As a further preferred embodiment, the agricultural pests include Lepidoptera pests.

[0014] As a further preferred embodiment, the lepidopteran pests include Spodoptera litura and / or cotton bollworm.

[0015] As a further preferred embodiment, the concentration of the Metarhizium anisopliae JXASMS-01 extract in the agricultural pest control agent is 10 mg / mL.

[0016] The beneficial effects of the present invention are: The present invention provides a strain of Metarhizium anisopliae JXASMS-01. The data results of the examples of the present invention show that its metabolites have a good killing effect on both Spodoptera litura and cotton bollworm, and do not have a series of disadvantages of chemical pesticides, and can achieve sustainable control of these lepidopteran pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Shown is the phenotype of the greater wax moth larvae infected with the green knife fungus.

[0019] Figure 2 Shown are the colonies and microscopic morphology of Metarhizium anisopliae JXASMS-01; among them, a in the figure is the front morphology of the strain; b in the figure is the back morphology of the strain; c in the figure is the microscopic morphology of the strain. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0021] Example 1 Screening and identification of Metarhizium anisopliae JXASMS-01 (CCTCC NO: M 2022833): (1) Isolation, screening and purification of strains: The present invention is separated from the tea garden soil in Nanchang County, Nanchang City, Jiangxi Province, specifically: A certain amount of soil was placed in a transparent plastic bowl. Ten 4-5 instar larvae of the Greater Glyptostroboides wax moth, freshly pretreated with high temperature (to prevent them from forming webs), were placed in each soil sample. The containers were inverted daily throughout the experiment to ensure adequate contact between the moth and the soil. The soil samples were maintained at 23 ± 2°C in the dark and observed daily. Dead larvae were surface-disinfected and individually placed in Petri dishes lined with moistened sterile filter paper. The experiment lasted approximately 14 days, until most larvae had matured. After mycelium or spores had grown, a few spores or hyphae of the entomogenous fungus from infected larvae were gently picked with an inoculating loop and plated onto plates containing PDA medium (50 µg / mL chloramphenicol and 100 µg / mL streptomycin sulfate). The plates were then incubated in the dark at 25 ± 1°C in a fungus incubator. Molecular and morphological identification was performed after mycelium had grown.

[0022] Figure 1 Shown is the phenotype of a dead Greater Glyptostroboides larvae infected with this strain. Note: After 8 days of contact with soil, the Greater Glyptostroboides larvae die. Subsequently, the larvae harden and develop white hyphae, which later produce green spores. Mycelia are isolated and cultured on PDA medium.

[0023] Figure 2Shown are the colonies and microscopic morphology of this strain. Note: Colonies grown on potato dextrose medium appear fuzzy and initially white. Sporulation begins in the center, with dark green spores and a pale yellow underside. The hyphae are septate, transparent, and smooth, with conidiophores often bearing 2-3 phialides.

[0024] (2) Identification of strains Molecular biological identification was performed using PCR amplification using the universal internal transcribed spacer (ITS) primers ITS5 (SEQ ID No: 3) 5′-GGAAGTAAAAGTCGTAACAAGG-3′ and ITS-4 (SEQ ID No: 4) 5′-TCCTCCGCTTATTGATATGC-3′, and the upstream primer (SEQ ID No: 5) 5′-GTGGCTCCTGACCATGGTTGC-3′ and downstream primer (SEQ ID No: 6) 5′-GCGGGGGAGCCGACTTGGA-3′ of the MzIGS3 gene. Sequences were compared using BLAST comparison in the National Center for Biotechnology Information (NCBI) database.

[0025] According to the sequence comparison results, the MzIGS3 sequence of the green anisopliae isolated in the present invention has only 95.60% similarity with Metarhizium sp. (MG384204.1) in the current database. The strain of the present invention was identified as a new species of the genus Green anisopliae and named according to the international nomenclature. Metarhizium sp. JXASMS-01.

[0026] Example 2 Metarhizium anisopliae JXASMS-01 (CCTCC NO: 2022833) was prepared using ethyl acetate. The specific steps are as follows: The mycelium of Metarhizium anisopliae described in Example 1 was selected and placed on PDA culture medium, where it was cultured for multiple generations to obtain a purified Metarhizium strain. The purified Metarhizium anisopliae was cultured under solid-state conditions on a medium consisting of starch and a 0.3% sucrose solution (containing 0.005% chloramphenicol) at room temperature for 4 weeks. The expanded solid-phase cultures were combined and soaked in ethyl acetate overnight, followed by extraction twice. The mycelium containing organic solvents was filtered through filter paper (Whatmann No. 1); finally, the separated ethyl acetate extract was dried at room temperature using a rotary vacuum evaporator, and the fungal extract was dissolved in dimethyl sulfoxide (DMSO) to prepare a concentrated fungal secondary metabolite solution for later use.

[0027] Example 3 The toxicity of the extract of Metarhizium anisopliae JXASMS-01 (CCTCC NO: 2022833) to cotton bollworm and Spodoptera litura was determined by the artificial feed mixed drug stomach poison method. The fungal extract concentrate of Example 2 was diluted to 10 mg / mL with 0.05% Tween water, 1 g of artificial feed was weighed and thoroughly mixed with 100 μL of the diluted crude extract, and after being fully absorbed, it was cut into small particles and evenly distributed into cell culture plates. A pre-starved 2-instar Spodoptera litura or cotton bollworm larva was placed in each well of the cell plate. The mortality was recorded every day, and the experiment was terminated when no adult insects emerged from all treatments. 20 insects were treated for each treatment, and the experiment was repeated 3 times. 10% DMSO was used as the control group in this embodiment. The mortality rate of cotton bollworms treated with green muscardine extract was 52.63%, and the mortality rate of Spodoptera litura was 29.17%, of which the mortality rate of the control group was 8.33%.

[0028] The embodiments of the present application are described above in conjunction with the accompanying drawings. Specific examples are used herein to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the core idea of ​​the present application, but the present application is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present application, ordinary technicians in this field can also make many forms without departing from the scope of protection of the purpose of the present application and the claims, all of which are within the protection of the present application.

Claims

1. A strain of Metarhizium anisopliae JXASMS-01, characterized in that: The green anisopliae ( Metarhizium sp.) JXASMS-01 was deposited in the China Center for Type Culture Collection on June 8, 2022, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit number being CCTCC NO: M 2022833.

2. The Metarhizium anisopliae JXASMS-01 according to claim 1, characterized in that The ITS sequence of the Metarhizium anisopliae JXASMS-01 is shown in SEQ ID No: 1; the MzIGS3 sequence of the Metarhizium anisopliae JXASMS-01 is shown in SEQ ID No:

2.

3. A Metarhizium anisopliae JXASMS-01 extract, characterized in that The Metarhizium anisopliae JXASMS-01 extract includes the Metarhizium anisopliae JXASMS-01 described in claim 1.

4. A method for preparing the Metarhizium anisopliae JXASMS-01 extract according to claim 3, characterized in that: The following steps are involved: The green anisopliae JXASMS-01 was cultured in a liquid culture medium containing starch and 0.3% sucrose solution. After the culture was completed, a solid phase culture was obtained, which was soaked in ethyl acetate overnight, extracted, filtered, rotary evaporated, dried, and finally dissolved in dimethyl sulfoxide to obtain the green anisopliae JXASMS-01 extract.

5. The preparation method according to claim 4, characterized in that The 0.3% sucrose solution contains 0.005% chloramphenicol.

6. Use of the Metarhizium anisopliae JXASMS-01 and / or its fermentation liquid and / or its extract according to claim 1 in the preparation of agricultural pest control agents.

7. An agricultural pest control agent, characterized in that: Contains the Metarhizium anisopliae JXASMS-01 according to claim 1 and / or its fermentation liquid and / or its extract.

8. The agricultural pest control agent according to claim 7, characterized in that The agricultural pests include Lepidoptera pests.

9. The agricultural pest control agent according to claim 8, characterized in that The lepidopteran pests include Spodoptera litura and / or cotton bollworm.

10. The agricultural pest control agent according to claim 9, characterized in that The concentration of the Metarhizium anisopliae JXASMS-01 extract in the agricultural pest control agent is 10 mg / mL.

Images