Non-coding RNA sequence for enhancing killing effect of metarhizium anisopliae on bemisia tabaci
By using non-coding RNA to regulate the gene expression of whiteflies, weakening their defense capabilities, and enhancing the killing effect of Metarhizium anisopliae on whiteflies, the problem of the slow action of Metarhizium anisopliae was solved, providing a new biological control strategy.
Patent Information
- Application Number
- CN202510758479.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-09
AI Technical Summary
In the existing technology, the insecticidal effect of Metarhizium anisopliae on Bemisia tabaci is slow, making it difficult to quickly control the pest population when the pest breaks out. In addition, Bemisia tabaci has become resistant to chemical pesticides, and new biological control methods are urgently needed.
Specific non-coding RNA sequences (Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205) were used to regulate gene expression in Bemisia tabaci, weaken its defense capabilities, and enhance the infection efficiency of Metarhizium anisopliae. Non-coding RNA mimics were prepared by designing specific primers, annealing PCR templates, and performing in vitro transcription. The mimics were then used in combination with a Metarhizium anisopliae spore suspension to infect Bemisia tabaci.
It significantly improves the killing effect of Metarhizium anisopliae on whiteflies, and improves the speed and effectiveness of pest control by affecting the immune defense, energy metabolism and signal transduction functions of whiteflies.
Smart Images
Figure CN120608062A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological control, and in particular to a non-coding RNA for biological control of Bemisia tabaci and its application. Background Art
[0002] Bemisia tabaci, a member of the Aleyrodidae family in the order Hemiptera, is one of the most devastating herbivorous pests worldwide. It harms plants by sucking nutrients from plants and secreting honeydew, causing sooty mold and spreading plant viral diseases. Chemical pesticides effectively control agricultural pest outbreaks and are an effective way to ensure agricultural production safety. However, long-term use of chemical pesticides has led to increasing insecticide resistance in pests. For example, Bemisia tabaci in central and eastern my country has developed collective and cross-resistance to neonicotinoid pesticides such as imidacloprid, thiamethoxam, and nitenpyram. China aims to achieve a pesticide utilization rate of over 43% by 2025, with reducing chemical pesticide use and increasing its effectiveness becoming a mandatory target. Therefore, there is an urgent need to explore alternative, green control methods to reduce chemical pesticide use.
[0003] Insect pathogenic fungi are an important part of biological pest control, such as Metarhizium anisopliae, which has the advantages of a wide range of insecticides, environmental friendliness, and no resistance. It also has endophytic and symbiotic relationships in plants and is called endophytic insect pathogenic fungi (EIPF). It is widely used in a variety of agricultural pests such as Coleoptera, Orthoptera, and Lepidoptera. Preliminary laboratory studies have found that Metarhizium anisopliae has a stronger lethality against whiteflies, especially those carrying toxins, and affects the composition of microbial and symbiotic bacterial communities in whiteflies. However, the slow speed of action of Metarhizium anisopliae and the role of the insect's own physiological defense function make it difficult to quickly control the pest population during an outbreak. How to improve the insecticidal effect of Metarhizium anisopliae is an urgent problem that needs to be solved.
[0004] In recent years, the regulatory role of non-coding RNA (such as miRNA and long non-coding RNA) in insect-pathogen interactions has gradually been revealed. These molecules affect the sensitivity of insects to pathogenic microorganisms by targeting and regulating host immune-related genes, energy metabolism pathways or signal transduction networks. However, the screening of non-coding RNAs related to fungal defense in whiteflies and their mechanisms of action have not yet been clarified, and biological control strategies based on non-coding RNA regulation are still lacking. How to use non-coding RNA to weaken the defense capabilities of whiteflies and synergistically improve the infection efficiency of Metarhizium anisopliae is a technical bottleneck that urgently needs to be broken through. Summary of the Invention
[0005] The purpose of the present invention is to provide a non-coding RNA and application for biological control of whiteflies, which weakens the defense ability of whiteflies against Metarhizium anisopliae by regulating the gene expression of whiteflies, thereby improving the efficiency of fungal infection, and solving the problem that Metarhizium anisopliae has slow control effect on whiteflies under natural conditions.
[0006] To achieve the above objectives, the present invention provides non-coding RNA sequences for biological control of Bemisia tabaci, including the following:
[0007] Scaffold_40_27855, the nucleotide sequence of which is shown in SEQ ID NO. 1;
[0008] Scaffold_1010_211, the nucleotide sequence of which is shown in SEQ ID NO. 2;
[0009] miR-9-5p, the nucleotide sequence of which is shown in SEQ ID NO. 3;
[0010] miR-205, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0011] Furthermore, the present invention also provides the use of the above-mentioned non-coding RNA in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci.
[0012] Furthermore, the present invention provides a method for preparing a simulant that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci, comprising the following steps:
[0013] S1. Designing specific primers for the non-coding RNA, wherein the primers comprise an enhancer sequence, a T7 promoter sequence, and a target gene-specific sequence;
[0014] S2, using primers, synthesize non-coding RNA template 1 and template 2 by annealing PCR;
[0015] S3, mixing template 1 and template 2, adding T7 in vitro transcriptase for in vitro transcription;
[0016] S4. Purify the transcription product to obtain a double-stranded RNA mimic.
[0017] Furthermore, the specific primers in step S1 include:
[0018] Primer pair for Scaffold_40_27855: the upstream primer sequence of template 1 is shown as SEQ ID NO.5 and the downstream primer sequence of template 1 is shown as SEQ ID NO.6, the upstream primer sequence of template 2 is shown as SEQ ID NO.7 and the downstream primer sequence of template 2 is shown as SEQ ID NO.8;
[0019] Primer pair for Scaffold_1010_211: the upstream primer sequence of template 1 is shown as SEQ ID NO.9 and the downstream primer sequence of template 1 is shown as SEQ ID NO.10, the upstream primer sequence of template 2 is shown as SEQ ID NO.11 and the downstream primer sequence of template 2 is shown as SEQ ID NO.12;
[0020] Primer pair for miR-9-5p: the upstream primer sequence of template 1 is shown as SEQ ID NO. 13, the downstream primer sequence of template 1 is shown as SEQ ID NO. 14, the upstream primer sequence of template 2 is shown as SEQ ID NO. 15, and the downstream primer sequence of template 2 is shown as SEQ ID NO. 16;
[0021] Primer pair for miR-205: the upstream primer sequence of template 1 is shown as SEQ ID NO.17 and the downstream primer sequence of template 1 is shown as SEQ ID NO.18, the upstream primer sequence of template 2 is shown as SEQ ID NO.19 and the downstream primer sequence of template 2 is shown as SEQ ID NO.20.
[0022] Furthermore, the reaction system of step S2 includes: 10× Annealing Buffer, upstream and downstream primers, and sterile water; the reaction procedure is: denaturation at 95° C. for 2 min, and gradient annealing from 95° C. to 22° C. at 0.1° C. / s.
[0023] Furthermore, the reaction condition of step S3 is incubation at 37° C. for 4 h.
[0024] Furthermore, the specific operation of step S4 is as follows: enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution and chloroform solution are added to the in vitro transcription product in sequence, mixed and centrifuged to obtain the supernatant, anhydrous ethanol is added at -20°C overnight, the supernatant is centrifuged to obtain the supernatant, the precipitate is washed with 75% alcohol, and sterile dried.
[0025] Furthermore, the present invention also provides a simulant for enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, which is prepared by the above-mentioned preparation method.
[0026] Furthermore, the present invention also provides the use of the above-mentioned simulant in preparing a product that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci.
[0027] Furthermore, the present invention also provides a method for controlling whiteflies, comprising the following steps:
[0028] S1. feeding Bemisia tabaci with the simulant according to claim 8;
[0029] S2. Using distilled water to collect Metarhizium anisopliae spores and prepare a spore suspension;
[0030] S3. Use the spore suspension of Metarhizium anisopliae to infect Bemisia tabaci fed with simulants to enhance the killing effect of Metarhizium anisopliae on Bemisia tabaci.
[0031] Therefore, the non-coding RNA of the present invention that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci has the following beneficial effects:
[0032] (1) The present invention provides four non-coding RNA sequences, Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205. Snapgene is used to design and synthesize specific primers for sequence templates 1 and template 2 of the four non-coding RNAs, respectively. Templates 1 and 2 are synthesized by annealing PCR, and mimics of the four non-coding RNAs, Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205, are synthesized by T7 in vitro transcription.
[0033] (2) After feeding the mimics of Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205 of the present invention, the physiological functions of the whitefly are disturbed, and the genes related to the immune defense, energy metabolism, signal transduction and other functions in the whitefly are affected, thereby enhancing the insecticidal effect of the green muscardine fungus on the whitefly, providing a new strategy for the biological control of the whitefly.
[0034] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 Schematic diagram for the synthesis of four non-coding RNA mimics;
[0036] Figure 2 Agarose gel electrophoresis detection of four non-coding RNA mimics and GFP siRNA. Band 1 is Scaffold_40_27855 mimic; Band 2 is Scaffold_1010_211 mimic; Band 3 is miR-9-5p mimic; Band 4 is miR-205 mimic; Band 5 is GFP siRNA;
[0037] Figure 3A in the middle is the expression level of Bemisia tabaci after feeding on Scaffold_40_27855 mimic for two days, B is the expression level of Bemisia tabaci after feeding on Scaffold_1010_211 mimic for two days, C is the expression level of Bemisia tabaci after feeding on miR-9-5p for two days, and D is the expression level of Bemisia tabaci after feeding on miR-205 mimic for two days;
[0038] Figure 4 A in the middle is the 7-day mortality of whiteflies fed with Scaffold_40_27855 mimics after being infected with Metarhizium anisopliae, B is the 7-day mortality of whiteflies fed with Scaffold_1010_211 mimics after being infected with Metarhizium anisopliae, C is the 7-day mortality of whiteflies fed with miR-9-5p mimics after being infected with Metarhizium anisopliae, and D is the 7-day mortality of whiteflies fed with miR-205 mimics after being infected with Metarhizium anisopliae.
[0039] Figure 5 A shows the morphological characteristics of Bemisia tabaci infected for 3 days, B and C show the morphological characteristics of Bemisia tabaci infected for 5 days, and D, E, and F show the morphological characteristics of Bemisia tabaci infected for 7-10 days. DETAILED DESCRIPTION
[0040] The technical solution of the present invention is further illustrated below by means of the accompanying drawings and examples. Unless otherwise defined, the technical terms or scientific terms used in the present invention should have the usual meanings understood by persons with ordinary skills in the field to which the present invention belongs. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods for which the specific conditions are not specified in the following examples are generally measured in accordance with national standards. The experimental instruments, equipment and reagents not indicated in the following examples are all commercially available raw materials.
[0041] Unless otherwise defined or indicated, all technical and scientific terms used in this invention have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein may be applied to the methods of the present invention. It should be noted that, unless there is a conflict, the embodiments and features of the embodiments of the present invention may be combined with each other.
[0042] The preparation method and components of the artificial liquid feed used in the examples, and the collection and culture method of Metarhizium anisopliae, can be found in the 2023 master's thesis of Wang Donghuai and Zhu Chaoqiang at Henan Agricultural University.
[0043] Example 1 Synthesis of double-stranded RNA mimics
[0044] 1. Primer design:
[0045] The specific primers for synthesizing four non-coding RNA templates, Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205, were designed as follows: Snapgene software was used to design specific primers for the four non-coding RNA sequences, Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205. Taking Scaffold_40_27855 as an example, the DNA sequence was designed with reference to the original sequence SEQ ID NO.1 of Saffold_40_27855. An "enhancer" sequence (GATCAC) and a "T7 promoter" sequence (TAATACGACTCACTATAGGG (SEQ ID NO.30)) were added to the front end of the DNA sequence of Saffold_40_27855, and two free T bases (TT) were added to the end, which was the upstream primer SEQ ID NO.5 of template 1, and its complementary chain was the downstream primer SEQ ID NO. NO.6; an "enhancer" sequence (GATCAC) and a "T7 promoter" sequence (TAATACGACTCACTATAGGG) were added to the front end of the 3'-5' reverse sequence of the DNA primer, and two free T bases (TT) were added to the end, which was the upstream primer SEQ ID NO.7 of template 2, and its complementary chain was the downstream primer SEQ ID NO.8; the design method of Scaffold_1010_211, miR-9-5p, and miR-205 was the same as that of Saffold_40_27855. The specific primers designed with reference to the sequence SEQ ID NO.2 of Scaffold_1010_211 were (template 1: SEQ ID NO.9, SEQ ID NO.10; template 2: SEQ ID NO.11, SEQ ID NO.12), and the specific primers designed with reference to the sequence SEQ ID NO.3 of miR-9-5p were (template 1: SEQ ID NO.13, SEQ ID NO.14; template 2: SEQ ID NO.15, SEQ ID NO.16), and the specific primers for the reference miR-205 sequence SEQ ID NO.4 were (Template 1: SEQ ID NO.17, SEQ ID NO.18; Template 2: SEQ ID NO.19, SEQ ID NO.20).
[0046] Table 1 Non-coding RNA sequences
[0047] Non-coding RNA name noncoding RNA sequences SEQ ID NO Scaffold_40_27855 UUGAUCAACUGAAGAACAUGGG SEQ ID NO.1 Scaffold_1010_211 GACUGGGAGUUGUGGCGCGCUCCUG SEQ ID NO.2 miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA SEQ ID NO.3 miR-205 UCCUUCAUUCCACCGGAGUCUG SEQ ID NO.4
[0048] Table 2 Specific primers of Scaffold_40_27855
[0049]
[0050] Table 3 Specific primers of Scaffold_1010_211
[0051]
[0052] Table 4 Specific primers for miR-9-5p
[0053]
[0054] Table 5 Specific primers for miR-205
[0055]
[0056] 2. Template synthesis:
[0057] The received sequences were added to the corresponding volume of sterile ddH2O according to the attached instructions to prepare a solution with a concentration of 100 μM. Taking Scaffold_40_27855 as an example, 9 μl of the upstream and downstream primers of template 1 were mixed with 2 μl of 10× Annealing Buffer and then PCR amplified. The PCR conditions were denaturation at 95°C for 2 min and annealing at 95°C-22°C at 0.1°C / s. The PCR product was template 1 of Scaffold_40_27855. 9 μl of the upstream and downstream primers of template 2 were mixed with 2 μl of 10× Annealing Buffer. After the buffer was mixed, PCR amplification was performed under the following conditions: denaturation at 95°C for 2 min and annealing at 95°C-22°C at 0.1°C / s. The PCR product was template 2 of Scaffold_40_27855. The template synthesis methods for Scaffold_1010_211, miR-9-5p, and miR-205 were the same as those for Scaffold_40_27855.
[0058] 3. In vitro transcription:
[0059] The mixture of Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, miR-205 template 1 and template 2 prepared above was prepared into a reaction system according to the instructions attached to the T7 in vitro transcriptase (T7 High Yield RNA Synthesis Kit) and incubated at 37° C. for 4 h.
[0060] 4. Purification:
[0061] To the in vitro transcription product, 300 μl of enzyme-free water, 30 μl of 3M sodium acetate solution, 150 μl of water-saturated phenol solution and 150 μl of chloroform solution were added in sequence, centrifuged at 13200 rpm for 15 minutes, and the supernatant was collected. 600 μl of anhydrous ethanol was added to the supernatant, refrigerated at -20°C overnight, and then centrifuged again at 13200 rpm for 15 minutes, and the supernatant was discarded. The precipitate was washed with 75% alcohol and dried on a sterile workbench to obtain mimics of Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205. Their RNA sequences were the same as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, but their structures were double-stranded RNA, as shown in FIG. Figure 1 The synthesized mimic was verified by agarose gel electrophoresis, as shown in Figure 1 As shown, M: Maker; 1: GFP siRNA (19bp); 2: Scaffold_40_27855; 3: Scaffold_1010_211; 4: miR-9-5p; 5: miR-205.
[0062] Example 2 Detection of the expression level of mimics in Bemisia tabaci after feeding with mimics
[0063] 30 μg of the four non-coding RNA mimics (Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205) described in Example 2 were dissolved in 300 μl of artificial liquid diet and fed to 100 adult Bemisia tabaci using a membrane feeder. After two days of feeding, the treated group was fed a GFP siRNA-containing diet in the same manner as the control group. RNA from the treated and control groups was extracted using an RNA extraction kit. Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205 were reverse transcribed sequentially using the stem-loop method with the primers set forth in SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, and SEQ ID NO. 24. RT-PCR reactions were performed at 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min. qPCR was performed sequentially using primers shown in SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28 in combination with the universal downstream primer SEQ ID NO.29. The qPCR program was as follows: 95°C pre-denaturation for 5 min; 95°C for 10 s, 60°C for 30 s, 40 cycles; melting curve at 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. The expression levels of Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205 in Bemisia tabaci were detected. Figure 2 As shown, after feeding the mimics, the expression levels in whiteflies were significantly upregulated (Scaffold_40_27855: t = 4.626, df = 4, p < 0.01; Scaffold_1010_211: t = 5.685, df = 4, p < 0.01; miR-9-5p: t = 9.084, df = 44, p < 0.01; miR-205: t = 4.204, df = 4, p < 0.05).
[0064] Table 6 Reverse transcription primers
[0065]
[0066] Table 7 qPCR primers
[0067]
[0068]
[0069] Example 3 Detection of the survival rate of Bemisia tabaci after infection with Metarhizium anisopliae
[0070] The same treatment method as in Example 2 was used to re-feed 100 adult whiteflies and feed for 2 days as the treatment group. 100 adult whiteflies fed with the same concentration of GFP siRNA and the same time and fed for 2 days were used as the control group. Cucumber plants 10-15 cm tall with more than 3 true leaves were selected and sprayed evenly on the back of the leaves with 10 7 -10 8 The concentration of Metarhizium anisopliae was used, and after the leaf surface was clear of obvious water stains, the treated whiteflies were placed. The survival rate was recorded from 1 to 7 days, and the survival rate (%) = number of living whiteflies / 20×100%. Figure 3 As shown in Figure 2, the mortality rate of whiteflies fed with simulants after infection with Metarhizium anisopliae increased significantly (Scaffold_40_27855:χ 2 =26.791,p<0.01;Scaffold_1010_211:χ 2 =26.875,p<0.01;miR-9-5p:χ 2 =4.144, p<0.05; miR-205:χ 2 =15.153, p<0.01)
[0071] Example 4 Changes in External Morphological Characteristics of Bemisia tabaci after Infection with Metarhizium anisopliae
[0072] During the experiment, the external morphological changes of infected whiteflies were recorded, and the dead insects were taken every day to observe their external morphological changes under a microscope to confirm that the whiteflies were killed by Metarhizium anisopliae and not by other reasons. Figure 3 As shown in Figure 2, the worm body became rigid at 3, 5, and 7-10 days after infection ( Figure 3 Middle A), growing hyphae ( Figure 3 B, C), germinating spores ( Figure 3 The changes in morphological characteristics (D, E, and F) indicate that Bemisia tabaci was killed by Metarhizium anisopliae.
[0073] Therefore, the sequences of the four non-coding RNAs Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205 provided by the present invention play an important role in the process of Metarhizium anisopliae infecting Bemisia tabaci. After the expression levels of Scaffold_40_27855, Scaffold_1010_211, miR-9-5p, and miR-205 in Bemisia tabaci are increased, the functions of functional genes such as the immune defense, energy metabolism, and signal transduction of Bemisia tabaci are affected, resulting in a significant improvement in the insecticidal effect of Metarhizium anisopliae on Bemisia tabaci, providing a new and effective strategy for the biological control of Bemisia tabaci by "using bacteria to control insects."
[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A non-coding RNA that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: Including one of the following: Scaffold_40_27855, the nucleotide sequence of which is shown in SEQ ID NO. 1; Scaffold_1010_211, the nucleotide sequence of which is shown in SEQ ID NO. 2; miR-9-5p, the nucleotide sequence of which is shown in SEQ ID NO. 3; miR-205, the nucleotide sequence of which is shown in SEQ ID NO.
4.
2. Use of the non-coding RNA as described in claim 1 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci.
3. A method for preparing a simulant that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The following steps are involved: S1. Design specific primers for the non-coding RNA according to claim 1, wherein the primers comprise an enhancer sequence, a T7 promoter sequence, and a target gene-specific sequence; S2, using primers, synthesize non-coding RNA template 1 and template 2 by annealing PCR; S3, mixing template 1 and template 2, adding T7 in vitro transcriptase for in vitro transcription; S4. Purify the transcription product to obtain a double-stranded RNA mimic.
4. The preparation method according to claim 3, characterized in that The specific primers in step S1 include: Primer pair for Scaffold_40_27855: the upstream primer sequence of template 1 is shown as SEQ ID NO.5 and the downstream primer sequence of template 1 is shown as SEQ ID NO.6, the upstream primer sequence of template 2 is shown as SEQ ID NO.7 and the downstream primer sequence of template 2 is shown as SEQ ID NO.8; Primer pair for Scaffold_1010_211: the upstream primer sequence of template 1 is shown as SEQ ID NO.9 and the downstream primer sequence of template 1 is shown as SEQ ID NO.10, the upstream primer sequence of template 2 is shown as SEQ ID NO.11 and the downstream primer sequence of template 2 is shown as SEQ ID NO.12; Primer pair for miR-9-5p: the upstream primer sequence of template 1 is shown as SEQ ID NO. 13, the downstream primer sequence of template 1 is shown as SEQ ID NO. 14, the upstream primer sequence of template 2 is shown as SEQ ID NO. 15, and the downstream primer sequence of template 2 is shown as SEQ ID NO. 16; Primer pair for miR-205: the upstream primer sequence of template 1 is shown as SEQ ID NO.17 and the downstream primer sequence of template 1 is shown as SEQ ID NO.18, the upstream primer sequence of template 2 is shown as SEQ ID NO.19 and the downstream primer sequence of template 2 is shown as SEQ ID NO.
20.
5. The preparation method according to claim 3, characterized in that The reaction system of step S2 includes: 10× Annealing Buffer, upstream and downstream primers, and sterile water; the reaction procedure is: denaturation at 95°C for 2 min, and gradient annealing from 95°C to 22°C at 0.1°C / s.
6. The preparation method according to claim 3, characterized in that The reaction conditions of step S3 are incubation at 37°C for 4 hours.
7. The preparation method according to claim 3, characterized in that The specific operation of step S4 is as follows: enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution and chloroform solution are added to the in vitro transcription product in sequence, mixed and centrifuged to obtain the supernatant, anhydrous ethanol is added at -20°C overnight, the supernatant is centrifuged to obtain the supernatant, the precipitate is washed with 75% alcohol, and sterile dried.
8. A simulant for enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The preparation method is adopted according to any one of claims 3 to 7.
9. Use of the simulant as claimed in claim 8 in the preparation of a product that enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci.
10. A method for controlling Bemisia tabaci, characterized in that: The following steps are involved: S1. feeding Bemisia tabaci with the simulant according to claim 8; S2. Using distilled water to collect Metarhizium anisopliae spores and prepare a spore suspension; S3. Use the spore suspension of Metarhizium anisopliae to infect Bemisia tabaci fed with simulants to enhance the killing effect of Metarhizium anisopliae on Bemisia tabaci.