Feature sequence, marker primer and identification method of fig variety strawberry
By developing characteristic sequences and molecular-specific marker primer combinations for fig varieties of strawberries, and using SLAF-seq technology and PCR amplification electrophoresis detection, the problem of identification between fig varieties was solved, and rapid and reliable variety identification was achieved.
Patent Information
- Application Number
- CN202410258869.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-07
- Publication Date
- 2025-09-09
AI Technical Summary
Existing technologies make it difficult to achieve accurate and rapid molecular-level identification between fig varieties, resulting in inconveniences in variety identification, promotion and communication in production.
The characteristic sequence and molecular specific marker primer combination of fig variety strawberry were developed, molecular markers of 23 materials were developed using SLAF-seq technology, more than 1,000 pairs of primers were designed, and specific identification was achieved through PCR amplification and electrophoresis detection.
The rapid, reliable and specific identification of fig varieties of strawberries was achieved, the sample requirements were reduced, the detection was convenient and intuitive, and the complexity of existing methods was avoided.
Smart Images
Figure CN120608068A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a characteristic sequence of a fig variety strawberry, a molecular specific marker primer combination, and a method for specifically identifying the fig variety strawberry by utilizing the molecular specific marker primer combination. Background Art
[0002] Fig Ficus carica Ficus genus, Moraceae Ficus A deciduous shrub or small tree native to the Mediterranean coast, it was first cultivated throughout Xinjiang, my country, and is now being introduced and cultivated in many locations across my country. It boasts high yields and rapid returns. Currently, over 20 varieties have performed well in this field, including 'Bojihong,' 'Strawberry,' and 'Masyi Taufin.' The fig fruit contains a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, with benefits such as treating sore throats, fighting tumors, lowering blood sugar and lipids, and boosting immunity. Consequently, market demand for figs is growing. While the fruit shape, size, color, and flavor of different fig cultivars vary significantly, the differences between individual plants are minimal. Furthermore, the naming of hybrids between some fig cultivars can be confusing, hindering cultivar identification, promotion, communication, and the development of new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a characteristic sequence of a fig variety strawberry, a molecular specific marker primer combination, and a method for specifically identifying the fig variety strawberry using the molecular specific marker primer combination; The technical solution adopted in the present invention is: The characteristic sequence group of the fig variety strawberry is as follows: 1) 28401_32: 5'-CCAAGATCTTTGAGAGCAAAGGTAGAGTTGAGCTTGCCAATTAGGCGATGTAAGAACTGAGGATTATTGCCCGTGAGAATGATATCGTCCACATATACTAAGAGAAGCACGATAATAGAGCCAGTANNN NNNNNNNCCTCAAACAGTCCCCACGGGCGTGGTTCACTAAGTTAAGCTCATGTTTACTCTCTTGGGGTTTCATTGCCTCTCGAGCTGATGCTTCACTGTTTTTCTTCTCTACTGGCTCTATTATCGTGCTTCT -3' 2) 57284_45: 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCAACACCCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNN NNNNNNNCCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
[0004] The present invention also relates to a molecular specific marker primer set for the fig variety strawberry, wherein the primer sequence is: 1) 28401_32 primer set: 28401_32LF AAGCTCATGTTTACTCTCTTGGG 28401_32RR AAGCACGATAATAGAGCCAGTAG 28401_32SF TCTTTGAGAGCAAAGGTAGAGTTGAW 2) 57284_45 primer set: 57284_45LF ACGAATCTAGGTAAGCTGACTTC 57284_45RRGATGCCTAAGTCAGTTCGAGAG 57284_45SF GCCGAAAACGCTTCCGGT The two primer sets described above were derived from molecular marker development using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology on 23 accessions, generating genome-wide molecular markers. An average of 118,891 SLAF tags were developed per sample in this project, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated. Bioinformatics analysis identified 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, for a total of 72,678 population SNPs. Based on these analysis results, over 1,000 primer pairs were designed and screened and validated in 23 samples, generating DNA fragments specific to the fig variety strawberry. Specific fragments for the selected primer combinations were not obtained for other fig varieties. It should be noted that the molecular marker primer combinations described in this invention are limited to fig variety identification, meaning that the samples tested are limited to figs.
[0005] The results of a random sampling of 5 plants of this variety showed that the characteristics of the strawberry variety fig are shown in the table: The present invention also relates to a method for rapidly identifying fig varieties of strawberries using the molecular specific marker primer combination, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 , Figure 2 As shown; The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, the reliability is greatly improved; (2) The detection is convenient and intuitive, and the presence or absence of band combinations can be directly determined by observing the bands through ordinary electrophoresis, while the SSR marker method requires further analysis or sequencing by high-resolution electrophoresis after amplification; (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the PCR Buffer in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with the solvent being ddH2O. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, apply the sample to a 1.5% agarose gel, and electrophorese in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain with EB and photograph it on an automatic gel image analyzer. If a specific DNA band appears in the electrophoresis result, the fig variety to be tested is strawberry; otherwise, it is not. BRIEF DESCRIPTION OF THE DRAWINGS
[0006] Figure 1 Schematic diagram of the relative positions of the primers in the 28401_32 primer set within the fig DNA signature sequence fragment 28401_32; Figure 2 Schematic diagram of the relative positions of the primers in the 57284_45 primer set within the fig DNA signature sequence fragment 57284_45; Figure 3 PCR amplification results of 23 fig varieties using the 28401_32 primer set (varieties numbered 1-23 are: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-yi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). The marker was the Takara DL2000 marker. Only one specific DNA band was amplified from the fig variety numbered 6, Strawberry, using the 28401_32 primer set. Figure 4 PCR amplification results of 23 fig varieties using the 57284_45 primer set (variety numbers 1-23 represent: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-yi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). The Takara DL2000 marker was used. Only one specific DNA band was amplified from the fig variety numbered 6, Strawberry, using the 57284_45 primer set. DETAILED DESCRIPTION
[0007] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto: Example
[0008] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig varieties were collected and thoroughly ground with liquid nitrogen. Genomic DNA from the leaves was extracted using the CTAB method. After multiple extractions, the genomic DNA extract of the fig varieties was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test the integrity, purity, and concentration. The brightness of the bands was determined for subsequent PCR amplification. The DNA extract was stored in a refrigerator at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 1) 28401_32 primer set: 28401_32LF AAGCTCATGTTTACTCTCTTGGG 28401_32RR AAGCACGATAATAGAGCCAGTAG 28401_32SF TCTTTGAGAGCAAAGGTAGAGTTGAW 2) 57284_45 primer set: 57284_45LF ACGAATCTAGGTAAGCTGACTTC 57284_45RRGATGCCTAAGTCAGTTCGAGAG 57284_45SF GCCGAAAACGCTTCCGGT Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and run electrophoresis in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain it in an aqueous solution containing 0.5 μg / ml EB for 30 minutes, and then photograph it on the Bio-rad gel imaging system Gel Doc; According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 ; Electrophoresis results revealed that only the strawberry fig variety numbered 6 amplified a specific DNA band using the 28401_32 primer set, and also a specific DNA band using the 57284_45 primer set. The remaining strawberry fig varieties showed no similar pattern, nor did they produce any other non-target bands. This demonstrates that the molecularly specific marker primer pairs developed by the present invention are highly stable and specific for early identification of strawberry fig varieties.
Claims
1. The characteristic sequence of the fig variety strawberry, which is composed of two coexisting specific DNA fragments, has the following sequence: 1）28401_32： 5'-CCAAGATCTTTGAGAGCAAAGGTAGAGTTGAGCTTGCCAATTAGGCGATGTAAGAACTGAGGATTATTGCCCGTGAGAATGATATCGTCCACATATACTAAGAGAAGCACGATAATAGAGCCAGTANNN NNNNNNNCCTCAAACAGTCCCCACGGGCGTGGTTCACTAAGTTAAGCTCATGTTTACTCTCTTGGGGTTTCATTGCCTCTCGAGCTGATGCTTCACTGTTTTTCTTCTCTACTGGCTCTATTATCGTGCTTCT -3' 2）57284_45： 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCAACACCCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNN NNNNNNNCCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
2. A primer set for detecting the characteristic sequence of the fig variety strawberry according to claim 1, wherein the primer set is composed of the following primer sequences: 1) 28401_32 primer set: 28401_32LF:AAGCTCATGTTTACTCTCTTGGG 28401_32RR:AAGCCACGATAATAGAGCCAGTAG 28401_32SF:TCTTTTGAGAGCAAAGGTAGAGTTGAW 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 57284_45RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.
3. A method for rapidly identifying a fig variety strawberry using the molecular specific marker primer set of claim 2, comprising extracting genomic DNA from leaves of the fig variety strawberry to be tested as a template, performing PCR amplification using the characteristic sequence primers in groups, and performing electrophoresis detection on the amplified products. If the electrophoresis results show that the 28401_32 primer set only amplifies one specific DNA band, and the 57284_45 primer set also only amplifies one specific DNA band, then the fig variety to be tested is a fig variety strawberry; otherwise, it is not; the primer set is composed of the following primer sequences: 1) 28401_32 primer set: 28401_32LF:AAGCTCATGTTTACTCTCTTGGG 28401_32RR:AAGCCACGATAATAGAGCCAGTAG 28401_32SF:TCTTTTGAGAGCAAAGGTAGAGTTGAW 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 57284_45RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.
4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30-40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.
5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA from the fig leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) 3 μL of the amplified product from step 2) was mixed with 1 μL of 0.25% bromophenol blue buffer and spotted on a 1.5% agarose gel. The gel was electrophoresed in 1× TAE buffer at 5 V / cm. After electrophoresis, the gel was stained with EB and photographed on an automated gel image analyzer. If the electrophoresis results showed the characteristic band described in claim 3, the fig variety under test was strawberry; otherwise, the fig variety was not.