Feature sequence, marker primer and identification method of fig variety salad
By developing characteristic sequences and molecular-specific marker primer combinations for fig varieties, and using SLAF-seq technology and PCR amplification electrophoresis detection, the problem of identification between fig varieties was solved, and rapid, stable and specific variety identification was achieved.
Patent Information
- Application Number
- CN202410258874.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-07
- Publication Date
- 2025-09-09
AI Technical Summary
Existing technologies make it difficult to conduct accurate and rapid molecular-level identification between fig varieties, resulting in inconveniences in variety identification, promotion, and communication in production.
Characteristic sequences and molecular-specific marker primer combinations were developed for the fig variety salad. Molecular markers were developed for 23 materials using SLAF-seq technology, and more than 1,000 pairs of primers were designed. Specific identification was achieved through PCR amplification and electrophoresis detection.
The rapid, stable and specific identification of fig salad varieties was achieved, sample requirements were reduced, the detection was convenient and intuitive, and the complex steps of high-resolution electrophoresis and sequencing were avoided.
Smart Images
Figure CN120608069A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a characteristic sequence of a fig variety salad, a molecular specific marker primer combination, and a method for specifically identifying the fig variety salad by utilizing the molecular specific marker primer combination. Background Art
[0002] Fig Ficus carica Ficus genus, Moraceae Ficus Figs are deciduous shrubs or small trees native to the Mediterranean coast. They were first cultivated throughout Xinjiang, my country, and are now being introduced and cultivated in many locations across my country. They are characterized by high yields and rapid returns. Currently, over 20 varieties have performed well in this field, including 'Bojihong,' 'Sala,' and 'Masyi Taufin.' Figs contain a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, which have been shown to treat sore throats, fight tumors, lower blood sugar and blood lipids, and enhance immunity. Consequently, market demand for figs is increasing. While fig cultivars vary significantly in shape, size, color, and flavor, individual plant differences are minimal. Furthermore, the naming of hybrids between some fig cultivars can be confusing. This situation hinders variety identification, promotion, communication, and the development of new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a characteristic sequence of a fig variety salad, a molecular specific marker primer combination, and a method for specifically identifying a fig variety salad using the molecular specific marker primer combination; The technical solution adopted in the present invention is: The characteristic sequence groups of fig variety salad are as follows: 1) 8254_58: 5'-CCGAACACTCCTCAACATCATCAGCAAAACGCATAGCCTTGAAAACGTTGAAGGTAACCTGTTGGTCGTGAACTCTCATGGTCAATTCACCCTTCTGCACATCTATCAAGGTCCTGCCAGTAGCCANNN NNNNNNNACTTTGGAAGGGCATTATGTGACCTAGGAGCAAGTATAAATCTGATGCCCATGTCTATCTTTAAAAAGCTGGGAATTAGGGAAGCAAGACCCACTACAGTCACTTTGCAATTAGCAGACAGGTCAT -3' 2) 117112_45: 5'-CCGAATTGACTCTTGATCCTCCAACGACGAGCACTGAACCAGAAGATTGGTGGACACTTATGGTTGACGGAGCATCCAATGTCAAAGGTTCTGGCATAGGAGTGTACTGCAGGTCCCCCGATGGCGNNN NNNNNNNACCTGGTTTACAATGAGCTGCGAGTCGCTTTGGATCTTCAAACGTCGAGCCCCCAGCGTTTTTGCCAGCCGTAGTCCAACGATCAAGGCTTCGTATTCAGCTTCATTGTTGGAGGCATTGAATCCT -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
[0004] The present invention also relates to a molecular specific marker primer set for fig variety salad, wherein the primer sequence is: 1) 8254_58 primer set: 8254_58LF GAGCAAGTATAAAATCTGATGCCC 8254_58RR TAATTGCAAAGTGACTGTAGTGG 8254_58SF AGCCTTGAAAACGTTGAAGGTAAT 2) 117112_45 primer set: 117112_45LF GAGTCGCTTTGGATCTTCAAAC 117112_45RR AACAATGAAGCTGAATACGAAGC 117112_45SFCGACGAGCACTGAACCAGAAA The source of the above two sets of primers: Molecular markers were developed for 23 materials using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology to obtain molecular markers across the entire genome. In this project, an average of 118,891 SLAF tags were developed for each sample, and the average sequencing depth of the sample SLAF tags was 10.12x. A total of 72.00Mb Reads were obtained in the experiment. Through bioinformatics analysis, 166,254 SLAF tags were obtained, of which 6,575 were polymorphic SLAF tags, and a total of 72,678 population SNPs were obtained. Based on the analysis results, more than 1,000 pairs of primers were designed, which were screened and verified in 23 samples to obtain specific DNA fragments of the fig variety salad. Specific fragments of the selected primer combination could not be obtained for other fig varieties. It should be noted that the molecular specific marker primer combination of the present invention is limited to the identification of fig varieties, that is, the samples to be tested are limited to figs. The results of a random sampling of 5 plants of this variety showed that the characteristics of the salad variety fig are shown in the table: The present invention also relates to a method for rapidly identifying fig variety salad using the molecular specific marker primer combination, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 , Figure 2 shown.
[0005] The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, their reliability has been greatly improved; (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification. (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with ddH2O as the solvent. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, apply the sample to a 1.5% agarose gel, and electrophorese in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain with EB and photograph it on an automatic gel image analyzer. If a specific band appears in the electrophoresis result, the fig variety to be tested is salad; otherwise, it is not. BRIEF DESCRIPTION OF THE DRAWINGS
[0006] Figure 1Schematic diagram of the relative positions of the primers in the 8254_58 primer set within the fig DNA signature sequence fragment 8254_58; Figure 2 Schematic diagram of the relative positions of the primers in the 117112_45 primer set within the fig DNA signature sequence fragment 117112_45; Figure 3 Electrophoresis results of PCR amplification of 23 fig varieties using the 8254_58 primer set (varieties numbered 1-23 are: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-Yi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). The Takara DL2000 marker was used. Only one specific DNA band was amplified from the fig variety Sala, numbered 17, using the 8254_58 primer set. Figure 4 Electrophoresis results of PCR amplification of 23 fig varieties using the 117112_45 primer set (varieties numbered 1-23 are: 1. Brooke Red; 2. Grace; 3. Brunswick; 4. Early Yellow; 5. Mas-Yitaufen; 6. Strawberry; 7. B1011; 8. Huishankou; 9. Jinaofen; 10. Qinghua; 11. Hongyan; 12. Papa John's; 13. BNR; 14. Hardy; 15. BBR; 16. Baishan; 17. Sala; 18. Rockery; 19. Green Anti-1; 20. Dela; 21. Baiya; 22. California Black; 23. Baraunay). The Takara DL2000 marker was used. Only one specific DNA band was amplified from the fig variety Sala, numbered 17, using the 117112_45 primer set. DETAILED DESCRIPTION
[0007] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto: Example
[0008] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig varieties were collected and thoroughly ground with liquid nitrogen. Genomic DNA from the leaves was extracted using the CTAB method. After multiple extractions, the genomic DNA extract of the fig varieties was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test the integrity, purity, and concentration. The brightness of the bands was determined for subsequent PCR amplification. The DNA extract was stored in a refrigerator at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 1) 8254_58 primer set: 8254_58LF GAGCAAGTATAAAATCTGATGCCC 8254_58RR TAATTGCAAAGTGACTGTAGTGG 8254_58SF AGCCTTGAAAACGTTGAAGGTAAT 2) 117112_45 primer set: 117112_45LF GAGTCGCTTTGGATCTTCAAAC 117112_45RR AACAATGAAGCTGAATACGAAGC 117112_45SFCGACGAGCACTGAACCAGAAA Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and electrophorese it in 1×TAE buffer at 5 V / cm. After the electrophoresis is completed, stain it in an aqueous solution containing 0.5 μg / ml EB for 30 minutes, and then stain it on a Bio-rad Gel imaging systemGel Doc took photos; According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 ; Electrophoresis results showed that only one specific DNA band was amplified from the fig salad variety numbered 17 using the 8254_58 primer set, and only one specific DNA band was amplified using the 117112_45 primer set. This demonstrates that the molecularly specific marker primer pairs developed by the present invention are highly stable and specific for early identification of fig salad varieties.
Claims
1. The characteristic sequence of fig variety salad, which is composed of two coexisting specific DNA fragments, has the following sequence: 1）8254_58： 5'-CCGAACACTCCTCAACATCATCAGCAAAACGCATAGCCTTGAAAACGTTGAAGGTAACCTGTTGGTCGTGAACTCTCATGGTCAATTCACCCTTCTGCACATCTATCAAGGTCCTGCCAGTAGCCANNN NNNNNNNACTTTGGAAGGGCATTATGTGACCTAGGAGCAAGTATAAATCTGATGCCCATGTCTATCTTTAAAAAGCTGGGAATTAGGGAAGCAAGACCCACTACAGTCACTTTGCAATTAGCAGACAGGTCAT -3' 2）117112_45： 5'-CCGAATTGACTCTTGATCCTCCAACGACGAGCACTGAACCAGAAGATTGGTGGACACTTATGGTTGACGGAGCATCCAATGTCAAAGGTTCTGGCATAGGAGTGTACTGCAGGTCCCCCGATGGCGNNN NNNNNNNACCTGGTTTACAATGAGCTGCGAGTCGCTTTGGATCTTCAAACGTCGAGCCCCCAGCGTTTTTGCCAGCCGTAGTCCAACGATCAAGGCTTCGTATTCAGCTTCATTGTTGGAGGCATTGAATCCT -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
2. A primer set for detecting the characteristic sequence of the fig variety salad according to claim 1, wherein the primer set is composed of the following primer sequences: 1) 8254_58 primer set: 8254_58LF:GAGCAAGTATAAAATCTGATGCCC 8254_58RR:TAATTGCAAAGTGACTGTAGTGG 8254_58SF:AGCCTTGAAAACGTTGAAGGTAAT 2) 117112_45 primer set: 117112_45LF: GAGTCGCTTTGGATCTTCAAAC 117112_45RR:AACAATGAAGCTGAATACGAAGC 117112_45SF:CGACGAGCACTGAACCAGAAA.
3. A method for rapidly identifying fig salad varieties using the molecular specific marker primer set of claim 2, the method comprising: extracting genomic DNA from leaves of the fig salad variety to be tested as a template, performing PCR amplification using the primers grouped with the characteristic sequence, and performing electrophoresis on the amplified products. If the electrophoresis results show that the 8254_58 primer set amplifies only one specific DNA band, and the 117112_45 primer set also amplifies only one specific DNA band, then the fig variety to be tested is the fig salad variety; otherwise, it is not. The primer set comprises the following primer sequences: 1) 8254_58 primer set: 8254_58LF:GAGCAAGTATAAAATCTGATGCCC 8254_58RR:TAATTGCAAAGTGACTGTAGTGG 8254_58SF:AGCCTTGAAAACGTTGAAGGTAAT 2) 117112_45 primer set: 117112_45LF: GAGTCGCTTTGGATCTTCAAAC 117112_45RR:AACAATGAAGCTGAATACGAAGC 117112_45SF:CGACGAGCACTGAACCAGAAA.
4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30-40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.
5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA from the fig leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) 3 μL of the amplified product from step 2) was mixed with 1 μL of 0.25% bromophenol blue buffer and spotted on a 1.5% agarose gel. The gel was electrophoresed in 1× TAE buffer at 5 V / cm. After electrophoresis, the gel was stained with EB and photographed on an automated gel image analyzer. If the electrophoresis results showed the characteristic bands described in claim 3, the fig variety under test was salad; otherwise, it was not.