Plasmodiophora brassicae Pb034 gene and application thereof in prevention and control of clubroot of cruciferae crops
By targeting and silencing the Pb034 gene of root knot fungus through RNA interference technology, the limitations of existing prevention and control methods have been overcome, and efficient prevention and control of root knot disease in cruciferous crops has been achieved, thereby enhancing the resistance of crops.
Patent Information
- Application Number
- CN202511121513.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-08-12
AI Technical Summary
Existing chemical control, biological control and disease-resistant variety breeding methods have limitations in preventing and controlling clubroot disease in cruciferous crops. Chemical pesticides pollute the environment, biological control is restricted by environmental conditions, and the effectiveness of disease-resistant varieties is limited.
RNA interference technology is used to target the RNA interference fragment or double-stranded RNA of the Pb034 gene of the root knot fungus, and recombinant expression vectors and transgenic technology are used to silence the expression of the Pb034 gene in plants, thereby achieving the prevention and control of root knot disease.
Enhance the resistance of cruciferous crops to clubroot, reduce the expression level of the Pb034 gene, significantly reduce clubroot symptoms, and provide long-lasting and efficient prevention and control effects.
Smart Images

Figure CN120608074A_ABST
Abstract
Description
Technical Field
[0001] The field of agricultural plant pathology and plant protection technology, particularly a root knot fungus gene Pb034 Application in preventing and controlling clubroot disease in cruciferous crops. Background Art
[0002] Cruciferous crops, including rapeseed, cabbage, kale, radish, mustard, etc., play an important role in global agriculture and are an important part of the human food supply chain and agricultural economy. Plasmodiophora brassicae Woronin Clubroot, caused by the common thorny disease (Chronic Kernel Soil), can harm nearly all cruciferous crops. Clubroot causes root enlargement, deformity, and rot, severely impairing the crop's ability to absorb water and nutrients, ultimately leading to premature plant failure, reduced yields, and even total crop failure. Currently, over 3.2 million hectares of land in my country are affected annually, accounting for over one-third of the cruciferous crop planting area. Yield losses average 20-30%, and in severely affected fields, total crop failure can occur, resulting in tens of billions of yuan in economic losses annually.
[0003] Existing control methods, such as chemical and biological control, and the breeding of disease-resistant varieties, all have significant limitations. Long-term use of chemical pesticides can lead to resistance and environmental pollution. Biological control methods are limited by environmental conditions, and the effectiveness of disease-resistant varieties is limited by the rapid evolution of pathogens. Therefore, the development of new technologies for clubroot control is imperative.
[0004] RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism mediated by double-stranded RNA (dsRNA). It specifically degrades complementary messenger RNA (mRNA) to inhibit target gene expression. In recent years, the application of RNAi technology in plant disease control has rapidly developed, particularly with strategies such as host-induced gene silencing (HIGS) and spray-induced gene silencing (SIGS). Because these methods can specifically silence pathogen genes, they can avoid harm to beneficial insects or soil microorganisms caused by broad-spectrum pesticides. Furthermore, HIGS is endogenously expressed, allowing plants to continuously produce dsRNA, unaffected by ultraviolet light and rainfall. This eliminates the need for frequent external pesticide applications, slowing the development of resistance. Furthermore, RNA molecules are easily degraded by the natural environment, eliminating the risk of chemical residues. Due to these advantages, RNAi has become a key area of focus for green pesticides and precision breeding. Summary of the Invention
[0005] In view of this, the present invention provides a key target for the prevention and treatment of clubroot disease in cruciferous crops by inhibiting the root knot fungus Pb034The expression of genes can improve the resistance of cruciferous crops to clubroot disease, providing a new technical means for improving the resistance of cruciferous crops to clubroot disease and for long-term and efficient prevention and control.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: In one aspect, the present invention provides Pb034 Gene sequence, the gene Pb034 The nucleotide sequence is shown in SEQ ID NO.1.
[0007]
[0008] Another aspect of the present invention provides a method for silencing Pb034 Gene expression biological material, the biological material comprising a target comprising a targeting Pb034 An RNA interference fragment or double-stranded RNA of a gene, wherein the RNA interference fragment includes a target gene fragment and a reverse complementary fragment of the target gene fragment, the nucleotide sequences of the target gene fragment and its reverse complementary fragment are respectively shown in SEQ ID NO.6-7, and the nucleotide sequences of the sense chain and antisense chain of the double-stranded RNA are respectively shown in SEQ ID NO.6-7.
[0009] Furthermore, the biological material includes at least one of a recombinant expression vector, a transgenic cell line or a recombinant bacterium.
[0010] The third aspect of the present invention provides the root knotweed fungus as described above Pb034 Gene or as described above for silencing Pb034 Application of gene-expressed biomaterials in the prevention and control of clubroot in cruciferous crops.
[0011] It should be noted that the control process of the present invention includes two aspects: prevention and treatment. That is, before the root knot fungus infection, the Pb034 Gene expression biomaterials that stably express targeted root knot fungi in plant cells Pb034 RNA interference fragments of genes can prevent root knot infection; they can also be transferred to silence genes after root knot infection. Pb034 Gene expression biological materials can interfere with gene expression in a timely manner and block the infection process of root knot fungi.
[0012] Furthermore, the application method includes: Pb034 Transforming cruciferous crops with gene-expressing biomaterials to reduce Pb034 Gene expression level.
[0013] Further, reduce Pb034 The expression level of the gene includes the following steps: targeting the Pb034 The RNA interference fragment of the gene was connected to the silencing expression vector to obtain Pb034 A gene silencing vector is used to transform cruciferous crops using the Agrobacterium-mediated method; wherein the RNA interference fragment includes a target gene fragment and a reverse complementary fragment of the target gene fragment, and the nucleotide sequences of the target gene fragment and its reverse complementary fragment are shown in SEQ ID NO.6-7, respectively.
[0014] Furthermore, the Pb034 The construction method of gene silencing vector includes: Pb034The gene nucleotide sequence (as shown in SEQ ID NO.1) was used as a template, and the primers shown in SEQ ID NO.2-3 were used to amplify the target fragment S1. The PBI121Bar-RNAi vector was digested with BamH I to obtain a linearized vector. The target fragment S1PBI121Bar-RNAi was homologously recombined with the linearized vector to obtain the recombinant vector PBI121Bar-RNAi-S1. The sequence shown in SEQ ID NO.1 was used as a template, and the primer pair shown in SEQ ID NO.4-5 was used to amplify the target fragment S2. The recombinant vector PBI121Bar-RNAi-S1 was digested with Sac I to obtain a linearized vector. The target fragment S2 was homologously recombined with the linearized vector PBI121Bar-RNAi-S1 to obtain Pb034 Gene silencing vectors.
[0015] Further, reduce Pb034 The expression level of a gene involves the following steps: Targeting the Pb034 The double-stranded RNA of the gene, the delivery vector and the RNase inhibitor are mixed, and a solution is prepared with RNase-free water, and the plant roots are irrigated with the solution. The nucleotide sequences of the sense and antisense strands of the double-stranded RNA are shown in SEQ ID NO.6-7 respectively.
[0016] Commonly used RNA delivery vectors are applicable to the present invention, and are not particularly limited thereto. In specific embodiments, the delivery vector is, for example, an amino-modified dendritic macroporous silica nanomaterial or lipofectin. RNase inhibitors are used to inhibit the natural degradation of RNA in the environment and can be conventional RNase inhibitors, such as RNaseOUT and DEPC.
[0017] Furthermore, the root knotweed fungus Pb034 Genes may be silenced Pb034 The application of gene-expressed biological materials in preventing and controlling clubroot disease in cruciferous crops is characterized in that the method for synthesizing the double-stranded RNA comprises: using the primer pair shown in SEQ ID NO.8-9 and adopting T7 RNA in vitro transcription technology to synthesize the double-stranded RNA.
[0018] Furthermore, the present invention provides a method for preventing and controlling clubroot disease in cruciferous crops, which is used for silencing Pb034 Transformation of Cruciferous Crops by Gene Expression Biomaterials.
[0019] The present invention has the following beneficial effects compared to the prior art: The present invention provides a method for enhancing the resistance of cruciferous crops to clubroot disease, using host-induced gene silencing technology or exogenous dsRNA delivery technology to silence key target genes of clubroot fungi. Pb034 Expression can enhance the resistance of cruciferous plants to clubroot disease; it provides a key technology for the prevention and control of clubroot disease in cruciferous crops, and has broad agricultural application prospects and market value. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Schematic diagram of the expression level of the Pb034 gene in root cells of Arabidopsis thaliana at different growth stages when infected with root knot fungi; RS is dormant spores, MP is mid-primary infection stage, IS is early secondary infection stage, MS is mid-secondary infection stage, and LS is late secondary infection stage; FPKM is fragments per kilobase of transcript per million mapped reads; Figure 2 This is the structure diagram of Pb034 protein; Figure 3 This is the map of the pBI121Bar-RNAi vector; Figure 4 for Pb034 Schematic diagram of the construction of gene silencing vector; Figure 5 Targeted silencing of root knot fungi based on host-induced gene silencing technology Pb034 Disease survey diagram of transgenic Arabidopsis thaliana after inoculation with different physiological races of root knot fungus; Figure A is Pb034 Figure 1 shows the gene expression analysis; Figure B shows the actual image of Arabidopsis root swelling; Figure C shows the disease index survey; Figure 6 To target clubroot fungi through root irrigation Pb034 Gene silencing using dsRNA technology Pb034 Gene transgenic Arabidopsis plant disease survey map; Figure A is Pb034 Figure A is a gene expression analysis chart; Figure B is a disease index survey chart; Figure C is a root knot fungus biomass survey chart. DETAILED DESCRIPTION
[0021] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0022] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.
[0023] For a better understanding of the present invention and not to limit the scope of the present invention, all numbers expressing amounts, percentages, and other numerical values used in the present invention should be understood as being modified by the word "approximately" in all cases. The term "approximately" has its ordinary meaning, used to indicate that a value includes the inherent variation of error of the device or method used to determine the value, or includes values close to the stated value, for example, within 10% of the stated value (or range of values). Therefore, unless otherwise indicated, the numerical parameters listed in the specification and the appended claims are approximate values and may vary depending on the desired properties sought to be obtained.
[0024] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, scientific and technical terms used shall have the meanings commonly understood by those skilled in the art. To make the above-mentioned objects, features and advantages of the present invention more clearly understood, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.
[0025] Example 1 Plasmodium gene Pb034 Highly expressed at all infection stages To explore the genes of Pb034 The biological function of the gene and its potential application value in disease prevention and control were systematically analyzed in this study based on transcriptome data. The root knot fungus strain used was the physiological race 4 collected from Jishou City, Hunan Province. Two-week-old Arabidopsis seedlings were used as materials, and the concentration was 10 6 The roots were inoculated with a suspension of resting spores of Rhizoctonia solani containing 100 dormant spores / strain to ensure the consistency and repeatability of infection. Sample collection covered all key stages of Rhizoctonia solani infection, including resting spores (RS), mid primary (MP), initial secondary (IS), mid secondary (MS) and late secondary (LS). The results showed that the root cells of Arabidopsis thaliana Pb034 The gene expression was continuously up-regulated during the infection process of root knot fungus, and was significantly enhanced at the end of the secondary infection ( Figure 1), suggesting that this gene may play a key role in the establishment of infection and progression of root knot fungus. This discovery provides a basis for in-depth analysis of Pb034 This study laid the foundation for its functional mechanism and its use as a potential target for disease prevention and control.
[0026] Further protein sequence and structural annotation revealed that the protein is an α-1,2-mannosyltransferase with a typical Glyco_transf_15 domain, suggesting that it may participate in the pathogenic process by modifying cell wall components. Figure 2 As shown in the figure, the pLDDT (predicted Local Distance Difference Test) score indicates the confidence of each amino acid residue in the predicted protein structure, ranging from 0 to 100, with higher scores indicating a more reliable structure. The 88.46 shown in the figure is the average confidence score for all residues.
[0027] Example 2 Targeted silencing based on host-induced gene silencing (HIGS) technology Pb034 The transgenic plants showed significantly enhanced resistance to clubroot disease To verify Pb034 The disease control potential of this embodiment is to construct a targeted silencing Pb034 The original vector of the silencing expression vector is the pBI121Bar-RNAi vector stored in our laboratory, and its host bacteria is Escherichia coli. Figure 3 See Figure 4 , Pb034 The gene silencing vector construction process specifically includes: using the sequence shown in SEQ ID NO.1 as a template, using the primer pair shown in SEQ ID NO.2-3 to amplify the target fragment S1; using BamHI to cut the PBI121Bar-RNAi vector to obtain a linearized vector; homologously recombining the target fragment S1 and the linearized vector PBI121Bar-RNAi to obtain a recombinant vector PBI121Bar-RNAi-S1; using the sequence shown in SEQ ID NO.1 as a template, using the primer pair shown in SEQ ID NO.4-5 to amplify the target fragment S2; using Sac I to cut the recombinant vector PBI121Bar-RNAi-S1 to obtain a linearized vector; homologously recombining the target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 to obtain Pb034 Gene silencing vector. Restriction enzyme digestion confirmed correct vector construction. The 35S promoter and NOS terminator carried on the vector drive expression of the RNA interference fragment.
[0028] The sequence information of the above design is as follows: S1-F: AACACGGGGGACTCTAGA GGATCC CGTGAACCTCATGCGACGTA (SEQ ID NO.2); S1-R: TTACCAAGCTGGGGTACC GGATCC CTGGCATCTCATCGTCCAGG (SEQ ID NO.3); S2-F: GCTGGGTTCGAAGTCGAC GAGCTC CTGGCATCTCATCGTCCAGG (SEQ ID NO.4); S2-R: GAACGATCGGGGAAATTC GAGCTC CGTGAACCTCATGCGACGTA (SEQ ID NO. 5).
[0029] Among them, in SEQ ID NO.2-5, the underlined part is the vector homology arm, the italic part is the enzyme cutting site, and the bold part is the specific amplification Pb034 Gene primers.
[0030] RNA interference fragment S1: CGTGAACCTCATGCGACGTATGGGCGATGACGAATGGAGTCGTGCGGTCACGCCGCTTCCCGTGTTGCGAACGGGACGCACGCTCTGGACCAGGATCGCTGACGCTGTTCGCAGAGCCGATCTGGAACATGTTCCCGAGTTCGAAGTTGATCTGTCAGGGGATCCAGGCTGTCAGAACGCGCACGCTCCGAACCCATGGGTGTTTGCCGTGTCGATGGCG CCGGAAGCGATCGATCGAGCGCGTTGGCAAACCTTCATGGCGAACGTCCCGAGGACGGCACCCGAGGCGTTGCTTCATGGTGGGCGTGGCATCGTTCTGTCGGGCGGCAGGCTGTCCCATCTGCATACCGTCGTCATCACCATCACTAGGCTTCGAAATCTGGGATGCAGACTCCCTATTGAACTCTGGTTCCTGGACGATGAGATGCCA (SEQ IDNO.6); RNA interference fragment S2: TGGCATCTCATCGTCCAGGAACCAGAGTTCAATAGGGAGTCTGCATCCCAGATTTCGAAGCCTAGTGATGGTGATGACGACGGTATGCAGATGGGACAGCCTGCCGCCCGACAGAACGATGCCACGCCCACCATGAAGCAACGCCTCGGGTGCCGTCCTCGGGACGTTCGCCATGAAGGTTTGCCATTGCCAACGCGCTCGATCGATCGCTTCCGGCGCC ATCGACACGGCAAACACCCATGGGTTCGGAGCGTGCGCGTTCTGACAGCCTGGATCCCCTGACAGATCAACTTCGAACTCGGGAACATGTTCCAGATCGGCTCTGCGAACAGCGTCAGCGATCCTGGTCCAGAGCGTGCGTCCCGTTCGCAACACGGGAAGCGGCGTGACCGACCGACTCCATTCGTCATCGCCCATACGTCGCATGAGGTTCACG (SEQ IDNO.7).
[0031] By inflorescence dipping method Pb034 The gene silencing vector was used to transform Columbia-0 Arabidopsis thaliana. Transgenic plants were screened for the herbicide resistance gene (bar) carried by the vector. Harvested Arabidopsis seeds were evenly sown in 10 cm × 20 cm bread boxes and grown under artificial light for one week before the first herbicide screening. 80 µL of 10% glufosinate ammonium dissolved in 500 mL of deionized water was shaken and evenly sprayed onto the plant leaves using a spray bottle, ensuring complete wetting. The spraying was repeated one week later; surviving plants were designated as T1 transgenic plants. The T2 generation screening procedure was essentially the same, except that seeds were sown in small pots for cultivation. For T3 generation screening, to more accurately assess homozygosity of progeny, nine seeds were evenly sown in each pot and sprayed as described above. All surviving progeny were considered homozygous. Ultimately, two homozygous transgenic lines (L1 and L2) were successfully obtained.
[0032] After inoculation with a suspension of spores of six different physiological races of R. rufipogonidum, root samples were collected on the eighth day for qPCR. The specific experimental procedures were as follows: total RNA was extracted using Solarbio TriQuick Reagent (Cat. No. R1100), and genomic DNA contamination was removed with Beyotime DNase I (Cat. No. D7076). After RNA precipitation, the RNA was dissolved in RNase-free water (Beyotime, Cat. No. R0022). cDNA was synthesized using 5× TS RT-Mix (Cat. No. RT-010-100), reacted at 50°C for 15 minutes, and inactivated at 85°C for 5 seconds. qPCR was performed using NobleRyder 2× Universal SYBR qPCR Master Mix (Cat. No. FQ-PCR05-1). A 20 μL reaction system contained 10 μL of the premix, 0.4 μL of 10 μM forward / reverse primers (final primer concentration 0.2 μM), and 1–2 μL of cDNA template. The program was run on the 7500 instrument: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 10 seconds / annealing and extension at 60°C for 30 seconds, and finally a melting curve was collected; the root knotweed actin gene was used as an internal reference gene, and the 2 -ΔΔCt Calculation Pb034 The relative expression level of the gene was determined to ensure that the melting curve showed a single peak and the amplification efficiency was between 90% and 110%.
[0033] Analysis confirmed that transgenic plants Pb034 Gene expression was significantly downregulated ( Figure 5 (A in the middle), the primers used to verify the expression are shown in SEQ ID NO.10-11.
[0034] Pb034-F: GGCAAACCTTCATGGCGAAC (SEQ ID NO. 10); Pb034-R: GGTGATGACGACGGTATGCA (SEQ ID NO. 11).
[0035] The disease index is investigated as follows: 30 days after inoculation with clubroot, Arabidopsis plants are uprooted, the roots are cleaned under running water, and the disease is surveyed. The number of diseased plants and the disease grade are counted, and the incidence rate and disease index are calculated. The disease index is calculated as follows: Disease index = ∑ (number of diseased plants at each grade × number of corresponding grades) / (total number of plants × 3) × 100. Clubroot disease is graded on a scale of 0-3: Grade 0: Normal root system with no disease symptoms; Grade 1: No clubroot on the taproot; a few small tumors form on less than 1 / 3 of the lateral roots; Grade 2: Clubroot forms on the taproot or tumors form on 1 / 3-2 / 3 of the lateral roots; Grade 3: Large tumors form on the taproot and more than 2 / 3 of the lateral roots.
[0036] The results showed that the root swelling of the transgenic lines ( Figure 5 Middle B) and disease index (after t test) ( Figure 5 Figure C) was significantly lower than that of the control group, indicating that the targeted Pb034 The HIGS technology can give plants the ability to resist clubroot. This result is the first time to verify at the functional level Pb034 feasibility as a key target for disease control.
[0037] Example 3 External application of silencing Pb034 dsRNA significantly enhances plant clubroot resistance To verify whether double-stranded RNA (dsRNA) targeting Pb034 has the effect of preventing and controlling clubroot disease, the T7RNAi in vitro transcription system (Nanjing Novozymes Biotech Co., Ltd.) was used to synthesize the target Pb034 The dsRNA (sequences are shown in SEQ ID NOs. 6-7), and the primer sequences used for in vitro transcription synthesis of dsRNA are shown in SEQ ID NOs. 8-9. The sequences involved are as follows: dsRNA-F: TAATACGACTCACTATAGGGCGTGAACCTCATGCGACGTA (SEQ ID NO.8); dsRNA-R: CCCTATAGTGAGTCGTATTACTGGCATCTCATCGTCCAGG (SEQ ID NO.9); Under artificial light culture conditions, 1 mL of 1×10 6 / mL of a spore suspension of Physiological Rhizoctonia solani No. 4 from Jishou, Hunan. The dsRNA solution was prepared in RNase-free H2O to a final concentration of 40 nmol / L. Amino-modified dendritic macroporous silica nanomaterials (Cat. No. 778949) were added to a final concentration of 0.5 mg / mL, along with an RNase inhibitor (RNaseOUT™, Cat. No. 10777019) to a final concentration of 1 U / μL. The solution was allowed to stand on ice for 30 minutes before use. Mix thoroughly before application. Using a pipette, 1 mL of the solution was slowly dripped onto the roots of each Arabidopsis plant. The dsRNA solution was applied three times: on days 2, 4, and 6 after inoculation with the Rhizoctonia solani. A blank control group was maintained.
[0038] The experimental results showed that 8 days after inoculation with root knot fungus, Pb034 The gene expression level decreased by 54.6% compared with the control group ( Figure 6 Figure A); 25 days after inoculation, the root sentiment index and root knotweed biomass of the treated Arabidopsis thaliana decreased by 65.7% and 53.4%, respectively ( Figure 6 Middle B picture, Figure 6 The above results indicate that exogenous administration of targeted Pb034 The dsRNA can effectively silence key genes of pathogens, significantly inhibit the infection process of root-knot fungus, and has good prevention and control potential.
[0039] In summary, the present invention has verified for the first time from a functional level Pb034 Feasibility as a key target for disease prevention and control. Pb034 The dsRNA can effectively block the infection process of root knot fungus by specifically silencing key pathogen genes. It demonstrates promising potential for field application and provides an innovative technical path for the development of environmentally friendly RNA biopesticides.
Claims
1. A root knotweed fungus Pb034 gene, characterized in that The nucleotide sequence of the Pb034 gene is shown in SEQ ID NO.
1.
2. A biomaterial for silencing Pb034 gene expression, characterized in that: The biological material contains an RNA interference fragment or double-stranded RNA targeting the Pb034 gene; wherein the RNA interference fragment includes a target gene fragment and a reverse complementary fragment of the target gene fragment, the nucleotide sequences of the target gene fragment and its reverse complementary fragment are respectively shown in SEQ ID NO.6-7, and the nucleotide sequences of the sense chain and antisense chain of the double-stranded RNA are respectively shown in SEQ ID NO.6-7.
3. The biomaterial for silencing Pb034 gene expression according to claim 2, characterized in that: The biological material is at least one of a recombinant expression vector, a transgenic cell line and a recombinant bacterium.
4. Use of the root knotweed fungus Pb034 gene according to claim 1 or the biological material for silencing Pb034 gene expression according to any one of claims 2 to 3 in preventing and controlling clubroot disease in cruciferous crops.
5. The use of the root knotweed fungus Pb034 gene or the biological material for silencing Pb034 gene expression in preventing and controlling clubroot disease in cruciferous crops according to claim 4, characterized in that: The biological materials used to silence the expression of the Pb034 gene are transformed into cruciferous crops to reduce the expression level of the Pb034 gene.
6. Use of the root knotweed fungus Pb034 gene or the biological material for silencing Pb034 gene expression in preventing and controlling clubroot disease in cruciferous crops according to claim 4, characterized in that: Reducing the expression level of the Pb034 gene includes the following steps: The RNA interference fragment targeting the Pb034 gene is connected to a silencing expression vector to obtain a Pb034 gene silencing vector, and the cruciferous crop is transformed using the Agrobacterium-mediated method; wherein the RNA interference fragment includes a target gene fragment and a reverse complementary fragment of the target gene fragment, and the nucleotide sequences of the target gene fragment and its reverse complementary fragment are shown in SEQ ID NO.6-7, respectively.
7. Use of the root knotweed fungus Pb034 gene or the biological material for silencing Pb034 gene expression in preventing and controlling clubroot disease in cruciferous crops according to claim 6, characterized in that: The construction method of the Pb034 gene silencing vector comprises: Using the sequence shown in SEQ ID NO.1 as a template, the primer pair shown in SEQ ID NO.2-3 was used to amplify the target fragment S1; The PBI121Bar-RNAi vector was digested with BamH I to obtain a linearized vector; The target fragment S1 and the linearized vector PBI121Bar-RNAi were homologously recombined to obtain the recombinant vector PBI121Bar-RNAi-S1; Using the sequence shown in SEQ ID NO.1 as a template, the target fragment S2 was amplified using the primer pair shown in SEQ ID NO.4-5; The recombinant vector PBI121Bar-RNAi-S1 was digested with Sac I to obtain a linearized vector; The target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 were homologously recombined to obtain the Pb034 gene silencing vector.
8. Use of the root knotweed fungus Pb034 gene or the biological material for silencing Pb034 gene expression in preventing and controlling clubroot disease in cruciferous crops according to claim 4, characterized in that: Reducing the expression level of the Pb034 gene includes the following steps: The double-stranded RNA targeting the Pb034 gene, a delivery vector and an RNase inhibitor are mixed, and a solution is prepared with RNase-free water, and the plants are irrigated with the roots. The nucleotide sequences of the sense and antisense strands of the double-stranded RNA are shown in SEQ ID NO.6-7, respectively.
9. Use of the root knotweed fungus Pb034 gene or the biological material for silencing Pb034 gene expression in preventing and controlling clubroot disease in cruciferous crops according to claim 8, characterized in that: The method for synthesizing the double-stranded RNA comprises: using the primer pair shown in SEQ ID NO. 8-9 and adopting T7 RNA in vitro transcription technology to synthesize the double-stranded RNA.
10. A method for preventing and controlling clubroot of cruciferous crops, characterized in that: The biological material with silenced Pb034 gene expression is transformed into cruciferous crops, and the nucleotide sequence of the gene is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Application of cruciferous crop GSL5 gene in clubroot resistance improvement and product development
CN117604030A
Plasmodiophora brassicae effector Pb78 and application thereof in prevention and treatment of Plasmodiophora brassicae infection
CN119552231A
Chinese cabbage clubroot susceptibility related gene BrSWEET14a as well as construction method and application thereof
CN119552881A
Application of plasmodiophora brassicae infected early chitin in prevention and control of cruciferae clubroot
CN119592560A
Plant plasmodiophoromycete responsive promoter and use thereof
WO2024239535A1