Method for constructing shiitake mushroom genetic transformation system by using G418 resistance selection marker

Abstract

The invention belongs to the technical field of edible mushroom genetic engineering, and relates to a method for constructing a mushroom genetic transformation system by using a G418 resistance selection marker, which comprises the following steps: taking a mushroom strain Shenxiang 215 cultured in a PDA (potato dextrose agar) culture medium as a receptor to obtain hypha blocks; the method comprises the following steps: transferring a pLgnpt plasmid into agrobacterium tumefaciens GV3101; agrobacterium tumefaciens is inoculated into an IM liquid culture medium containing acetosyringone and MES, hypha blocks are subjected to ultrasonic treatment and co-incubation with the hypha blocks, then the hypha blocks are transferred to an IM solid culture medium laid with filter paper, and dark culture is carried out; and transferring the hyphae subjected to dark culture to a PDA resistant plate culture medium containing G418 and Cef for resistance screening to obtain the shiitake transformant. The method not only verifies the applicability of the novel selection marker in flammulina velutipes, but also constructs a multi-marker technology platform parallel to the existing hygromycin system, and lays a foundation for subsequent complex operations such as multi-gene superposition editing, gene loop construction and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of edible fungus genetic engineering, and in particular relates to a method for constructing a shiitake mushroom genetic transformation system by applying a G418 resistance screening marker. Background Art

[0002] mushroom( Lentinula edodes ) As the world's second largest commercially cultivated edible fungus, it has shown important application potential in the fields of food, medicine and health products due to its high protein and low fat nutritional characteristics, as well as the enrichment of bioactive ingredients such as lentinan and ergosterol.

[0003] Driven by the need for industrial upgrading, molecular breeding technology, with its advantages for targeted improvement, has become a key path to breaking through the bottlenecks of traditional breeding. Although hybridization and mutagenesis have advanced shiitake mushroom variety improvement, inherent drawbacks such as the random nature of trait integration and long screening cycles have severely limited breeding efficiency. Molecular breeding can achieve precise trait improvement, but it is highly dependent on genetic transformation systems. Therefore, the development of efficient genetic transformation systems has become a core technological breakthrough for achieving precise integration of exogenous genes, targeted improvements in yield, stress resistance, and the synthesis of active substances.

[0004] Currently, genetic transformation techniques for Lentinus edodes primarily include protoplast-PEG, electroporation, biolistic ...

[0005] The existing screening markers are of a single type and cannot meet the urgent demand for multiple screening markers in multi-gene coordinated regulation and synthetic biology research, so new resistance screening markers need to be developed urgently. Summary of the Invention

[0006] The present invention provides a method for constructing a G418 resistance screening marker in the genetic transformation of Lentinus edodes, which provides a new option for solving the defects of the hygromycin system.

[0007] The present invention provides a method for constructing a G418 resistance screening marker in the genetic transformation of Lentinus edodes, comprising the following steps:

[0008] (1) Using Lentinus edodes strain Shenxiang 215 as a recipient, culture was performed in PDA medium to obtain mycelial blocks;

[0009] (2) Transforming the pLgnpt plasmid into Agrobacterium GV3101; the pLgnpt plasmid is obtained by ligating the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 to the pDHt-Bar plasmid;

[0010] (3) inoculating Agrobacterium into an IM liquid culture medium containing acetosyringone and MES, and co-culturing the mycelial block obtained in step (1) after ultrasonic treatment, and then transferring it to an IM solid culture medium covered with filter paper and culturing in the dark;

[0011] (4) The mycelium after dark culture in step (3) was transferred to a PDA resistance plate culture medium containing G418 and Cef for resistance screening to obtain Lentinus edodes transformants.

[0012] Furthermore, the culturing time of Lentinus edodes strain Shenxiang 215 in step (1) is 10 days.

[0013] Furthermore, in the step (2), genomic DNA of Lentinus edodes is used as a template and a primer pair with sequences of SEQ ID NO.3 and SEQ ID NO.4 is used to amplify SEQ ID NO.1.

[0014] Furthermore, the construction process of the pLgnpt plasmid in step (2) is as follows:

[0015] The pDHt-Bar vector was double-digested with BamHI / BcuI endonucleases to obtain the linearized pDHT vector;

[0016] SEQ ID NO.1 and SEQ ID NO.2 were seamlessly cloned and ligated with the linearized pDHT vector to obtain the pLgnpt plasmid.

[0017] Furthermore, the method for obtaining Agrobacterium GV3101 containing the pLgnpt plasmid in step (3) is as follows:

[0018] Agrobacterium GV3101 was added to the plasmid pLgnpt described in claim 4. The culture was placed on ice for 30 minutes, quickly frozen in liquid nitrogen for 5 minutes, and then in a 37°C water bath for 5 minutes. Immediately, the culture was placed on ice for 2 minutes. 1 ml of LB liquid was added and the culture was incubated at 28°C at 150 rpm for 3 hours. The culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. A 100 μl aliquot was retained and spread onto a solid LB plate, air-dried, and incubated upside down at 28°C for 2-2.5 days. Three to five individual colonies were re-streaked onto a solid LB plate and incubated at 28°C at 220 rpm for 2 days to obtain Agrobacterium GV3101 containing the pLgnpt plasmid.

[0019] Furthermore, the PDA-resistant plate culture medium in step (4) contains G418 25ug / ml + Cef 450ug / ml.

[0020] The invention provides an application of the construction method provided by the invention in the construction of a G418 resistance screening marker in the genetic transformation of Lentinus edodes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] Genetic transformation of Lentinus edodes faces challenges due to low transformation efficiency and immature technical systems. Currently, approximately 90% of Lentinus edodes genetic transformation research, both domestically and internationally, relies on hygromycin B (hyg) as a selection marker. However, its application has significant drawbacks: high concentrations cause rapid browning and death of mycelium, making regeneration difficult; low concentrations, while reducing browning rates, significantly increase false positive rates, leading to a surge in subsequent screening workload. Furthermore, the sensitivity of strains to hygromycin fluctuates significantly between batches, resulting in poor experimental reproducibility. This application demonstrates for the first time the feasibility of using the G418 (Geneticin) resistance gene nptII as an alternative selection marker in Lentinus edodes, providing a new option to address the limitations of the hygromycin system. This breakthrough not only validates the applicability of this novel selection marker in Flammulina velutipes but also establishes a multi-marker technology platform that is parallel to the existing hygromycin system, paving the way for subsequent complex operations such as multi-gene stacking editing and gene circuit construction. The G418 selection system can be extended to other edible fungi (such as Flammulina velutipes and King Oyster Mushroom), providing a universal platform for functional genomics and molecular breeding of edible fungi. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a sensitivity analysis chart of Lentinus edodes Shenxiang 215 to G418 in Example 1;

[0024] Figure 2 The diagram of the construction of the pLgnpt vector in Example 1, wherein (A) is the legpd fragment; (B) is the nptII and nos terminator fragments; (C) is the electrophoresis diagram of the pLgnpt vector verification using M13F / M13R;

[0025] Figure 3 This is a map of the construction of the pLgnpt vector in Example 1, wherein the pLgnpt vector is driven by the Lentinus edodes gpd promoter legpd to express the resistance gene nptII, and the resistance gene expression element is terminated by the nos terminator;

[0026] Figure 4 The pLgnpt vector was used to transform Shenxiang 215 in Example 1. The wild-type strain Shenxiang 215 was used as a control. It did not grow on the PDA plate containing G418 on the resistant plate. The colonies growing around it were suspected transformants.

[0027] Figure 5 This is the electrophoresis diagram for PCR verification of the resistant transformants obtained by Shenxiang 215 mediated by the pLgnpt vector in Example 1;

[0028] Figure 6 The construction process and map of the pFgnpt vector in Experimental Example 1;

[0029] Figure 7 The pFgnpt vector was used to transform Lentinus edodes transformants obtained in Experimental Example 1. (A) is the primary screening plate for transformants, (B) is the secondary screening plate for transformants, and (C) is the third screening plate for transformants.

[0030] Figure 8 The effect of different promoters driving nptII vectors on the transformation efficiency of Lentinus edodes in Experimental Example 1, wherein pLgnpt: a vector driving nptII expression with Lentinus edodes gpd promoter; pFgnpt: a vector driving nptII expression with Flammulina velutipes gpd promoter;

[0031] Figure 9 This is the electrophoresis diagram for PCR verification of the resistant transformants of Lentinus edodes obtained by the pFgnpt vector in Experimental Example 1. DETAILED DESCRIPTION

[0032] Example 1

[0033] 1. Analysis of the sensitivity of Lentinus edodes strains to G418

[0034] PDA resistance plate culture medium containing different concentrations of G418 (0ug / ml, 6.25ug / ml, 12.5ug / ml, 25ug / ml, 50ug / ml, 100ug / ml) was prepared under sterile conditions; the experimental material used was the Shiitake mushroom cultivar Shenxiang 215 (preserved and provided by the Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, Innovation and Breeding Laboratory). Shiitake mushroom strain 215 with a colony diameter of 5-6cm was selected and inoculated in the center of the plate using the punch inoculation method. Three replicates were set up for each group, and a plate without G418 was used as a control. The culture dishes were then placed in a constant temperature incubator at 25°C in the dark for 10 days. The growth of the strain under different antibiotic concentrations was compared and observed to analyze the strain's resistance to G418.

[0035] like Figure 1 As shown in the figure, by observing the growth of Shenxiang 215 at different G418 concentrations, 12.5ug / ml G418 inhibited the growth of the strain, while at a concentration of 25ug / ml G418, Shiitake Shenxiang 215 basically did not grow. Therefore, 25ug / ml G418 was used as the screening concentration.

[0036] Among them, PDA culture medium: purchased from BD

[0037] 2. Construction of pLgnpt plasmid

[0038] Using the Lentinus edodes genome as a template, the primer pair LegpdF / LegpdR3 with sequences of SEQ ID NO.3 and SEQ ID NO.4 was used to amplify the Lentinus edodes gpd promoter legpd with sequence SEQ ID NO.1; using the p1GN-35S plasmid (donated by Professor Fan Yanhua of Southwest University) as a template plasmid, the primer pair NPTF1 / NPTR was used to amplify the sequence of the nptII resistance gene and the nos terminator sequence; the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0039] The amplification system was as follows: 25 μl of 2× Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / l primer, 50 ng of genomic DNA template, and water added to a 50 μl system;

[0040] PCR reaction parameters: 95°C (3 min); 35 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (2 min); 72°C (10 min);

[0041] pDHt-Bar (a gift from Dr. Wang Chengshu, Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences) was cloned with BamHI / BcuI. Chen YX, Feng P, Shang YF, Xu YJ, Wang CS*. 2015. Biosynthesis of non-melanin pigment by a divergent polyketide synthase in Metarhiziumrobertsii. Fungal Genetics and Biology, 81: 142-149.) was double-enzyme digested and the pDHT vector backbone was recovered to obtain a linearized pDHT vector; the legpd promoter (560 bp), nptII resistance gene and nos terminator sequence (1000 bp) were seamlessly cloned and connected with the linearized pDHT vector. The kit used was the EZ-HiFi seamless cloning kit (GenStar, T196) from Beijing Kangrun Chengye Biotechnology Co., Ltd., and the ligation product was transformed into Escherichia coli competent cells TOP10 (Shanghai Weidi Biotechnology Co., Ltd.). Single colonies were picked and colony PCR was performed on M13F / M13R using universal primers. Single colonies with correct bands were selected for sequencing, and the plasmid with correct sequencing was named pLgnpt. Figure 2 、 3 shown.

[0042] The specific steps for E. coli transformation and PCR verification are as follows:

[0043] Thaw 100 μL of competent E. coli TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) on ice for 10 minutes; add the ligation product, mix gently, and place on ice for 30 minutes. Heat shock in a 42°C water bath for 90 seconds, then quickly cool in an ice-water mixture for 5 minutes. (Uni-clean bench) add 1 mL of LB liquid (antibiotic-free) and incubate at 37°C at 180 rpm for 1 hour. Centrifuge the culture at 5000 rpm for 5 minutes. (Uni-clean bench) discard the supernatant and retain 100 μL (mix thoroughly by pipetting) to plate an LB plate containing kanamycin (kan). Incubate inverted at 37°C for 12-18 hours. Streak eight single colonies onto an LB plate containing kanamycin (kan) and verify by colony PCR using the M13F / M13R primers on the vector. The M13F / M13R primer sequences are the same as above.

[0044] The amplification system consisted of 10 μl of 2× Premix Taq Version (TAKARA, RR901A), 1 μl of each 10 μmol / l primer, and colonies, then water was added to a 20 μl volume. PCR parameters were: 95°C (3 min); 30 cycles of 95°C (30 sec), 58°C (30 sec), 72°C (2 min); and 72°C (15 min). Three samples of the target size were selected for sequencing after electrophoresis on 1.2% agarose gel.

[0045] 3. Agrobacterium inoculation with pLgnpt vector genetic transformation

[0046] Take out the Agrobacterium GV3101 competent cell (purchased from Shanghai Weidi Biotechnology Co., Ltd.) stored at -80°C, thaw on ice for 10 minutes, add 1ul pLgnpt plasmid, mix well by pipetting, ice bath for 30 minutes, quick freeze in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, immediately ice bath for 2 minutes, add 1ml LB liquid (clean bench), culture at 28°C, 150rpm for 3 hours; centrifuge at 5000rpm for 5 minutes, pour out the supernatant (clean bench), keep 100ul, take half of it and coat it on LB resistance solid plate (containing 12.5μg / mL rifampicin (rif) and 50μg / mL kan), blow dry, culture upside down at 28°C for 2-2.5 days. Take 3-5 single colonies, re-streak them onto LB resistance solid plate (containing 12.5μg / mL rif and 50μg / mL kan), culture at 28°C, 220rpm for 2 days, and take colonies for PCR verification (clean bench).

[0047] Rifampicin and kanamycin were purchased from Sangon Biotech.

[0048] PCR amplification system: 10 μl of 2× Premix Taq Version (TAKARA, RR901A), 0.5 μl each of primers M13F / M13R, and a bacterial colony as template, with water added to a 20 μl volume. The M13F / M13R amplification fragment is approximately 1 kb. Amplification protocol: initial denaturation at 95°C for 5 min, followed by 30 cycles of: 95°C for 30 s, 56°C for 30 s, 72°C for 1 min, and extension at 72°C for 10 min.

[0049] The composition of the LB resistance solid plate is: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0050] 4. Agrobacterium-mediated genetic transformation of Lentinus edodes

[0051] Agrobacterium culture:

[0052] Inoculate Agrobacterium GV3101 containing the pLgnpt vector into 3 mL LB (kan + rif), incubate at 28°C, 200 rpm, and culture for 14-20 h. In a clean bench, take 2 mL of Agrobacterium culture solution and place it in a centrifuge tube. Incubate at 12,000 rpm for 2 min. Discard the supernatant and add 1 mL of IM liquid medium to resuspend the bacteria. Pipette 500 μL of the culture solution and add it to 5 mL of IM liquid medium. Incubate at 28°C, 200 rpm, and culture for 4 h. Adjust GV3101 to OD600 = 0.3.

[0053] Infection and co-cultivation:

[0054] Take shiitake mushrooms cultured on PDA medium for 7-10 days, punch a hole with a 200µl pipette tip to remove hyphae near the edge, and inoculate this into IM liquid medium. After sonication (53kHz, 1 minute), mix with Agrobacterium cultured for 4 hours. Continue shaking for 2 hours at 25°C, 50 rpm. Discard the Agrobacterium, transfer the hyphae to IM solid medium covered with filter paper, and use hyphae without Agrobacterium as a control. Incubate in the dark at 25°C for 3 days.

[0055] Screening culture:

[0056] Pour 20-30 ml of sterile water containing 600 μg / ml Cef into the co-culture plate and soak for 30 minutes. Then, transfer the shiitake mycelial mass to a PDA plate containing 25 μg / ml G418 and 450 μg / ml Cef and incubate at 25°C until resistant colonies appear. Subsequently, select the resistant colonies and transfer them to a PDA plate containing 25 μg / ml G418 for secondary screening.

[0057] Obtaining G418-resistant transformants

[0058] Transformant Selection Principle: G418 (Geneticin) is an aminoglycoside antibiotic that irreversibly binds to the 30S ribosomal subunit, interfering with protein synthesis and inducing programmed cell death in non-transformed cells. The neomycin phosphotransferase II gene (nptII) encodes a phosphorylation-modifying enzyme that specifically detoxifies G418, conferring stable resistance to transformed cells.

[0059] When PDA medium containing 25ug / ml G418 resistance is used as the screening medium, when the pLgnpt plasmid is integrated into the genome and the expression of the nptII gene is initiated, the suspected transformants will grow on the resistance plate, and the strains that have not been transformed with the pLgnpt plasmid cannot grow.

[0060] like Figure 4 As shown: Through Agrobacterium-mediated genetic transformation, a total of 67 mycelial blocks were transformed, and 22 G418-resistant transformants were obtained after three screenings, with a transformation efficiency of 32.83%.

[0061] IM liquid medium (1 L): 400 ml 2.5× MM saline solution / L, 5 ml glycerol / L, 1.8 g / L glucose (add 200 μmol / L acetosyringone and 40 mmol / L MES before use), store in the dark.

[0062] IM solid medium (1 L): 400 ml 2.5× MM saline solution / L, 5 ml glycerol / L, 0.9 g / L glucose, 15 g / L agar powder (add 200 μmol / L acetosyringone and 40 mmol / L MES before use), autoclave at 121°C for 15 min.

[0063] 2.5×MM salt solution (liquid, 1 L): KH2PO4 3.625 g, K2HPO4 5.125 g, MgSO47H2O 1.250 g, NaCl 0.375 g, CaCl22H2O, 0.165 g, FeSO4.7 H2O 0.0062 g, (NH4)2SO4 1.250 g, water 1 L.

[0064] 5. G418 transformant screening and mitosis verification

[0065] The resulting resistant transformant strain of Shenxiang 215 was transferred to the corresponding resistance culture medium and subcultured three times, with the recipient strain Shenxiang 215 as a control, and cultured in the dark at 25°C for 5-7 days. Transformants were selected and transferred to PDA culture medium plates. After five consecutive transfers, they were transferred to PDA (selective medium containing G418 (25ug / ml) for culture. Transformants growing on PDA resistance plates were selected, their genomes were extracted using the CTAB method, and PCR verification was performed. The untransformed recipient strain 215 was used as a control.

[0066] Transformant identification: Genomes of stable resistant colonies during mitosis were extracted. Transformant A, generated using the npt-specific primers YZnpt3F / YZnpt3R, was able to amplify the target fragment of approximately 845 bp, whereas the wild-type strain was unable to do so. PCR verification was performed using the internal reference primers YZlgpdF2 / YZlgpdR2.

[0067] The PCR amplification system consisted of 10 μl of 2× Premix Taq Version (TAKARA, RR901A), 0.5 μl of each 10 μmol / l primer, and 5 μl of genome, diluted with water to a 20 μl volume. PCR reaction parameters were: 95°C (3 min); 35 cycles of 95°C (30 sec), 58°C (30 sec), 72°C (2 min), and 72°C (10 min).

[0068] Using the specific primers for the glyceraldehyde-3-phosphate dehydrogenase gapdh of Lentinus edodes as the internal reference gene, both the transformant and the wild-type strain were able to amplify a fragment of about 288 bp, indicating that the data amplified using the Lentinus edodes genome is reliable. This result indicates that the exogenous nptII gene has been integrated into the Lentinus edodes 215 genome. Figure 5 shown.

[0069] Experimental Example 1

[0070] In the genetic transformation of edible fungi, the promoter will affect the genetic transformation efficiency. In order to evaluate the effect of different promoters driving the expression of the resistance gene nptII on the genetic transformation efficiency, an nptII resistance expression vector driven by the Flammulina velutipes gpd promoter was constructed, and G418-resistant transformants were obtained through Agrobacterium-mediated transformation of Lentinus edodes.

[0071] pFgnpt vector construction

[0072] The genome of Flammulina velutipes Dan3 (provided by the Improved Variety Innovation and Breeding Laboratory, Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences) was used as a template, and the primer pair FfgpdF / FfgpdR was used to amplify the Flammulina velutipes gpd promoter Ffgpd (including the first intron of the gpd gene). The p1GN-35S plasmid (gifted by Professor Fan Yanhua of Southwest University) was used as a template, and the primer pair nptF / nptR was used to amplify a fragment fused to the nptII gene and the nos terminator.

[0073] The amplification system consisted of 25 μl of 2× Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / l primer, and 1 μl of genomic DNA template (10 ng / μl), with water added to a 50 μl volume. PCR reaction parameters were: 95°C (5 min), 30 cycles of 95°C (30 sec), 58°C (30 sec), 72°C (30 sec), and 72°C (15 min). Electrophoresis on 1.2% agarose gel yielded an approximately 820-bp Ffgpd fragment and a 1000-bp nptII / nos terminator fusion fragment.

[0074] pDHT-bar was double-digested with BamHI / BcuI endonucleases to recover the pDHT vector backbone and obtain a linearized pDHT vector. The Ffgpd promoter, npt and nos terminator fusion fragment were seamlessly cloned and connected with the linearized pDHT vector (EZ-HiFi Seamless Cloning Kit, GenStar, T196). The ligation product was transformed into Escherichia coli and verified by colony PCR using primer pair M13F / M13R. The plasmid was extracted from the sample verified to be correct by PCR and named pFgnpt. The results are as follows: Figure 6 shown.

[0075] The pFgnpt vector was introduced into Agrobacterium GV3101, and G418-resistant transformants were obtained through the above-mentioned Agrobacterium-mediated genetic transformation of Lentinus edodes.

[0076] Results: A total of 62 mushrooms were transformed using the pFgnpt vector, and 7 G418-resistant transformants were obtained after three screenings ( Figure 7 ), with a transformation efficiency of 11.3%. Using the glyceraldehyde-3-phosphate dehydrogenase gapdh as an internal reference and the nptII-specific primers pnF / pnR, the resulting transformant strain was able to amplify the target fragment of approximately 845 bp, while the wild-type strain was unable to do so. This result indicates that the exogenous nptII gene has been integrated into the edodes genome. Figure 8 shown.

[0077] The above results indicate that nptII can be used as a genetic selection marker gene for shiitake mushrooms using G418 as a selection agent. Different promoters driving nptII expression can affect genetic transformation efficiency. Among them, the transformation efficiency mediated by the construction of nptII driven by the endogenous Legpd of shiitake mushrooms is better than that mediated by the resistance of nptII driven by Ffgpd of Flammulina velutipes ( Figure 9 ).

[0078] Among them, the primer pair sequences and gene sequences used in the embodiments and experimental examples are as follows:

[0079] SEQ ID NO.1 Legpd sequence:

[0080] CGCATGTATCACGGAAAGGACTCGAACAGGGAGTTTTATCTATTTTTATTGGTCGATATCAGTCAGATTGTCAGTGCGTCAAAGTTGCATCCATAAGGCTACTACGGTGAAACCGGTGTATCCTGGGATATCATGAAATGGTTGTATGCAGAAGATAAGAATGAGAGTAGTTCTAGAACAACAAACCCAGGCCAGGGAGGAAGCTGTAGCATTTGCAAGACTTTGCAGGGCTTTTCAAAGGCACTTCCATCCAAAGCTCGAGCACGGTTCCAGGCAACCTTAGTCATGGGGCGATAGAACTGAAGAACGTTTGCTGATTGGCAGTCCATCCCAAAGGACTCGGCCAATAAATCCTACCCAATCGCAGGTCCGAGGTACTAAAGTGTTTTAAGGTCTAGACTTTTAGGGCTATTGTCGAAGTCACAACATCACGCAATCAAGATTTGACTGAAGCGCGATTATCTATAAAAGGATCAGTTGTGTTTTTCGTCCGCATCTTTTCCTTGTTCCACAACCTTCGATTCTAAATACACTCCAATCCATTGACTGCTTGAATTAAA

[0081] SEQ ID NO.2 Resistance gene nptII and nos terminator sequence:

[0082] GATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAACATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAgaattaattcggtacgctgaaatcaccagtctctctctacaaatctatctctctctattttctccataaataatgtgtgagtagtttcccgataagggaaattagggttcttatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatcc。

[0083] SEQ ID NO.3LegpdF:

[0084] CTGCAGCCCGGGGGATCCCGCATGTATCACGGAAAGGACTCG

[0085] SEQ ID NO.4LegpdR3

[0086] GAGAACCTGCGTGCAATCCATCTTTAATTCAAGCAGTCAATGGATTG

[0087] SEQ ID NO.5NPTF1

[0088] CAATCCATTGACTGCTTGAATTAAAGATGGATTGCACGCAGGTTCTC

[0089] SEQ ID NO.6NPTR

[0090] CGGCCGCTCTAGAACTAGTggattttggttttaggaattagaaa

[0091] SEQ ID NO.7M13F

[0092] CAGGGTTTTCCCAGTCACG

[0093] SEQ ID NO.8M13R

[0094] GAGCGGATAACAATTTCACAC

[0095] SEQ ID NO.9YZlgpdF2

[0096] GTCAATCTCGACTCTTATGACTCG

[0097] SEQ ID NO.10YZlgpdR2

[0098] GCACCAGTTGAAGAAGGGATGATG

[0099] SEQ ID NO.11YZnpt3F

[0100] GAGAGGCTATTCGGCTATGACT

[0101] SEQ ID NO.12YZnpt3R

[0102] CCCTTATCGGGAAACTACTCAC

[0103] SEQ ID NO.13 gapdh fragment sequence

[0104] GTCAATCTCGACTCTTATGACTCGCAACATGCTGTTGTAAGTATGACTGGCCCACCCTCTTTCTCGCAAAGTTCTGACCATACCTTAGATCTCCAATGCTTCTTGCACGACGAACTGCCTCGCACCTCTCGCCAAGGTTATCCACGACAAATTCGGTATCGTTGAGGCTCTGATGACTACCGTCCATGCCACCACCGCTACCCAGAAGACTGTTGATGGTCCTTCGAACAAAGATTGGCGTGGAGGTCGTTCTGTCAACGGAAACATCATCCCTTCTTCAACTGGTGC

[0105] SEQ ID NO.14 YZnpt3F / YZnpt3R amplification sequence 845bp:

[0106] GAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGAATTAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGG

[0107] SEQ ID NO.15FfgpdFd

[0108] CTGCAGCCCGGGGGATCCTAGACTCTTGGCTGGTACTG

[0109] SEQ ID NO.16FfgpdR

[0110] agaacctgcGTGCAATCCATCTCCAACTTTGACctgtaaaat

[0111] SEQ ID NO. 17nptF

[0112] attttacagGTCAAAGTTGGAGATGGATTGCACgcaggttct

[0113] SEQ ID NO. 18nptR

[0114] CGGCCGCTCTAGAACTAGTggattttggttttaggaa

[0115] SEQ ID NO.19Ffgpd fragment sequence

[0116]

[0117] Among them, the italic part is the first intron of the gene, the bold part is the promoter sequence of Flammulina velutipes gpd, and the combination of the italic bold part and the middle italic part is the gene sequence of gpd.

[0118] SEQ ID NO.20nptII gene and nos terminator sequence

[0119]

[0120]

[0121] Among them, the bold part is the nptII gene, the bold italic part is the XmnI endonuclease site, and the italic part is the nos terminator sequence.

[0122] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for constructing a genetic transformation system of Lentinus edodes, characterized in that: The following steps are involved: (1) Using Lentinus edodes strain Shenxiang 215 cultured in PDA medium as a recipient, a mycelial block was obtained; (2) Transforming the pLgnpt plasmid into Agrobacterium GV3101; the pLgnpt plasmid is obtained by ligating the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 to the pDHt-Bar plasmid; (3) inoculating Agrobacterium into an IM liquid culture medium containing acetosyringone and MES, and co-culturing the mycelial block obtained in step (1) after ultrasonic treatment, and then transferring it to an IM solid culture medium covered with filter paper and culturing in the dark; (4) The mycelium after dark culture in step (3) was transferred to a PDA resistance plate culture medium containing G418 and Cef for resistance screening to obtain Lentinus edodes transformants.

2. The construction method according to claim 1, characterized in that The culturing time of Lentinus edodes strain Shenxiang 215 in the step (1) is 10 days.

3. The construction method according to claim 1, characterized in that In the step (2), genomic DNA of Lentinus edodes is used as a template and a primer pair with sequences of SEQ ID NO.3 and SEQ ID NO.4 is used to amplify SEQ ID NO.

1.

4. The construction method according to claim 1, characterized in that The construction process of the pLgnpt plasmid in step (2) is as follows: The pDHt-Bar vector was double-digested with BamHI / BcuI endonucleases to obtain the linearized pDHT vector; SEQ ID NO.1 and SEQ ID NO.2 were seamlessly cloned and ligated with the linearized pDHT vector to obtain the pLgnpt plasmid.

5. The construction method according to claim 1, characterized in that The method for obtaining Agrobacterium GV3101 containing the pLgnpt plasmid in step (3) is as follows: Agrobacterium GV3101 was added to the plasmid pLgnpt described in claim 4. The culture was placed on ice for 30 minutes, quickly frozen in liquid nitrogen for 5 minutes, and then in a 37°C water bath for 5 minutes. Immediately, the culture was placed on ice for 2 minutes. 1 ml of LB liquid was added and the culture was incubated at 28°C at 150 rpm for 3 hours. The culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. A 100 μl aliquot was retained and spread onto a solid LB plate, air-dried, and incubated upside down at 28°C for 2-2.5 days. Three to five individual colonies were re-streaked onto a solid LB plate and incubated at 28°C at 220 rpm for 2 days to obtain Agrobacterium GV3101 containing the pLgnpt plasmid.

6. The construction method according to claim 1, characterized in that The PDA-resistant plate culture medium in step (4) contains G418 25ug / ml + Cef 450ug / ml.

7. Use of the construction method according to any one of claims 1 to 6 in the construction of a G418 resistance selection marker in the genetic transformation of Lentinus edodes.

Images