Method for identifying aquilaria agallocha and aquilaria sinensis by using DLAT gene

By identifying DLAT gene differences through whole genome sequencing and SNP detection, the problem of identifying agarwood and white agarwood was solved, the genotype identification of agarwood and white agarwood was realized, and the scientific nature of agarwood quality evaluation was improved.

CN120608138APending Publication Date: 2025-09-09SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510983695.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-11-25
Filing Date
2025-07-17
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively use the genome level to study the differences between agarwood and white agarwood, making it difficult to identify the differences in their fragrance components through genotypic differences.

Method used

Through whole genome sequencing, DNA extraction, DNA library construction, high-throughput sequencing, SNP detection and Hp and Fst analysis, the differences in DLAT genes in Aquilaria sinensis and Aquilaria sinensis were identified, and the DLAT genotypes TT and CC were used to identify Aquilaria sinensis and Aquilaria sinensis.

Benefits of technology

The accurate identification of agarwood and white agarwood based on genotype differences has been achieved, improving the scientificity and reliability of agarwood quality evaluation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608138A_ABST
    Figure CN120608138A_ABST
Patent Text Reader

Abstract

The invention discloses a method for identifying aquilaria agallocha and aquilaria sinensis by using a DLAT gene. Aquilaria agallocha and aquilaria sinensis are identified on the basis that the DLAT genotype of the Aquilaria agallocha is TT and the DLAT genotype of the aquilaria sinensis is CC. A No.1879 basic group of a DLAT gene coding region of agilawood aquilaria sinensis and aquilaria sinensis is taken as a target site, a PCR and Sanger sequencing method is adopted, a PCR amplification product of the DLAT gene is subjected to Sanger sequencing, if the genotype of the DLAT is TT, the product is agilawood aquilaria sinensis, and if the genotype of the DLAT is CC, the product is aquilaria sinensis. According to the method for identifying the agilawood agilawood and the aquilaria sinensis through the DLAT gene, high-throughput sequencing is carried out on the agilawood agilawood and the aquilaria sinensis, genotype detection analysis is carried out in a whole genome range, and it is found that the DLAT gene has significant difference between the agilawood agilawood and the aquilaria sinensis, and the gene function is clear. The method is used for identifying the germplasm of the agilawood agilawood and the aquilaria sinensis by utilizing the genotype difference of the agilawood agilawood and the aquilaria sinensis and adopting PCR amplification and Sanger sequencing methods
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular to a method for using DLAT gene to identify agarwood and white agarwood. Background Art

[0002] Analysis of the composition of agarwood from the Chinese agarwood variety revealed that its primary components are 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenylethyl)chromone. These two components are the main components of wild agarwood under current standards and are crucial for the fine grading of agarwood quality. Common white agarwood does not produce as much or as quickly as this "agarwood" variety, and it contains no or very little 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenylethyl)chromone. However, the agarwood produced from common white agarwood contains higher levels of 5,6,7,8-tetrahydro-2-(-phenylethyl)chromone (agarwood tetraol) than agarwood from these agarwood-producing cultivations. According to the 2020 Chinese Pharmacopoeia, agarwood tetraol is the primary active ingredient in agarwood used as a medicinal herb.

[0003] In terms of chemical composition, many studies have found that agarwood is rich in 2-[2-(4-methoxy)phenethyl]chromone and 2-(2-phenethyl)chromone. Currently, evaluating the grade of agarwood based on these two characteristic components has gradually become a trend in agarwood quality research.

[0004] Research has shown that the chemical components of agarwood primarily include sesquiterpenes, 2-(2-phenylethyl) chromone derivatives, and aromatic compounds. 2-(2-phenylethyl) chromone derivatives are one of the main components of agarwood and can be divided into four types based on their skeleton structure: 5,6,7,8-tetrahydro-2-(2-phenylethyl) chromone, 5,6,7,8-diepoxy-2-(2-phenylethyl) chromone, 2-(2-phenylethyl) chromone, and 5,6-epoxy-2-(2-phenylethyl) chromone. The chromone content of agarwood is not only an indicator of its quality but is also closely related to its medicinal value and aroma.

[0005] While there are studies on the agarwood genome, there are currently no published studies or patents on the genomic differences between agarwood and common white agarwood. It is unclear whether agarwood and white agarwood are genetically distinct, or whether differences in the genotypes of specific functional genes lead to differences in the final agarwood composition. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above-mentioned shortcomings of the prior art and provide a method for identifying Aquilaria sinensis and Aquilaria sinensis using DLAT genes. Specific development process: 1. Extraction of Genomic DNA from Agarwood Table 1 Agarwood whole genome sequencing materials .

[0007] The agarwood samples shown in Table 1 were selected for whole genome sequencing. The agarwood genome was extracted using the polysaccharide and polyphenol kit method from Tiangen Biotechnology. The specific experimental process is as follows: Step 1) Take 100 mg of fresh Aquilaria sinensis leaves and place them in a sterilized and dried mortar. Add an appropriate amount of liquid nitrogen and grind thoroughly into powder.

[0008] Step 2) Transfer the ground powder to a 1.5 mL sterile centrifuge tube. Quickly add 400 μL of Buffer GPS to the tube. Add 10 μL of RNase and vortex to mix. Then place the tube in a thermostatic metal bath at 65°C for 15 minutes. During the heating process, invert the tube every five minutes to ensure complete dissolution of the sample.

[0009] Step 3) Add 100 μL of Buffer GPA to the centrifuge tube, vortex for 1 minute, and then centrifuge at 12,000 rpm for 5 minutes. Place the filter column CS in the collection tube in advance and transfer the supernatant from the centrifugation to the filter column CS. Centrifuge at 12,000 rpm for 1 minute and transfer the filtrate from the collection tube to a new centrifuge tube. If the filtrate is too viscous, add an appropriate amount of Buffer GPA, vortex to mix thoroughly, and place the centrifuge tube on ice for 5 minutes before centrifuging again.

[0010] Step 4) Add anhydrous ethanol in an equal volume to the filtrate and mix thoroughly.

[0011] Step 5) Place the adsorption column CR2 in the collection tube in advance. Transfer the mixed solution and the resulting flocs to the RNase-Free adsorption column CR2. Centrifuge at 12,000 rpm for 1 min. Discard the filtrate and return the RNase-Free adsorption column CR2 to the collection tube.

[0012] Step 6) Add anhydrous ethanol to the protein solution RD according to the recommended amount on the packaging box. Then, aspirate 550 μL of protein solution RD and add it to the RNase-Free adsorption column CR2. Centrifuge at 12,000 rpm for 1 min. Discard the filtrate and return the RNase-Free adsorption column CR2 to the collection tube.

[0013] Step 7) Add anhydrous ethanol to the rinse solution PW according to the recommended amount on the packaging. Then, pipette 700 μL of rinse solution PW into the RNase-Free Column CR2. Centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and return the RNase-Free Column CR2 to the collection tube. Repeat this step twice.

[0014] Step 8) Centrifuge at 12,000 rpm for 2 min, discard the collection tube, and transfer the RNase-Free adsorption column CR2 to a new centrifuge tube. Let it dry at room temperature for 5-10 min.

[0015] Step 9) Pipette 50-100 μL of elution buffer TB and add it to the RNase-Free adsorption column CR2. Incubate at room temperature for 5 minutes and centrifuge at 12,000 rpm for 2 minutes. The resulting solution in the centrifuge tube is the agarwood genomic DNA.

[0016] Step 10) Store the extracted DNA in a -20°C freezer to prevent degradation.

[0017] 2. Quality determination of agarwood genomic DNA The quality of the extracted agarwood genomic DNA was determined by 1% agarose gel electrophoresis, with electrophoresis band images captured using a Bio-RAD Gel DocXR gel image acquisition and analysis instrument. The concentration and purity of the extracted DNA were determined using a Thermo SCIENTIFIC NanoDrop 1000 nucleic acid analyzer.

[0018] 3. DNA Library Construction and High-Throughput Sequencing After passing the test, paired-end sequencing libraries with 350-bp inserts were constructed using the standard Illumina DNA library construction process. After library construction, quality control was performed using qPCR and an Agilent 2100 Bioanalyzer. DNA libraries that passed the quality control were sequenced using the Illumina Novaseq 6000 high-throughput sequencing platform, using a paired-end 150-bp sequencing strategy.

[0019] 4. Sequence Alignment and SNP Detection Sequence alignment was performed using bwa software using a paired-end alignment strategy. Sequencing data were aligned to the published Aquilaria sinensis genome (NCBI accession number: GCA_005392925.1). SNP detection was performed using deepvariant software.

[0020] 5. Hp and Fst Analysis and Selection of Coding Gene Loci Hp and Fst analysis, Hp represents pooled heterozygosity score: (Carl-JohanRubin et al. 2010), where represents the sum of the maximum genotypes in the observation window, corresponding to Indicates the sum of the minimum genotype. The range of Hp is 0 to 0.5. When Hp is equal to 0.5, it means and When the Hp value is equal, it means that the two genotypes in the population are equal, and when the Hp value is equal to 0, it means that there is only one genotype.

[0021] Fst (fixation coefficient) was calculated using the R language software package hierfstat (version: 0.5-11). The Fst value ranges from 0 to 1, where 0 indicates that the genotype is not fixed at all and the base ratios in different populations are the same (corresponding to Hp of each population being equal to 0.5). An Fst value of 1 indicates that the genotypes of the two populations are completely different (corresponding to Hp of each population being equal to 0, and the genotypes of the two populations being different).

[0022] Therefore, the SNP sites with Hp values ​​equal to 0 in the Aquilaria sinensis population and Hp values ​​equal to 0 in the Aquilaria sinensis population and corresponding Fst values ​​of 1 were selected as target sites, as shown in Table 2, and the gene function annotations of the SNP sites are shown in Table 3.

[0023] Table 2 Statistics of Hp and Fst values ​​of SNP sites .

[0024] Table 3 Gene function annotation of SNP sites .

[0025] Comparison of DLAT gene differences between Aquilaria sinensis and Kynam Figure 1 shown.

[0026] Based on the above development results, the present invention provides a method for using DLAT genes to identify agarwood and white agarwood, specifically: The identification of Aquilaria sinensis and Aquilaria sinensis was based on the DLAT genotype of Aquilaria sinensis being TT and the DLAT genotype of Aquilaria sinensis being CC.

[0027] Furthermore, the identification method is: using base 1879 of the DLAT gene coding region of Aquilaria sinensis and Aquilaria sinensis as the target site, using PCR and Sanger sequencing methods, and performing Sanger sequencing on the DLAT gene PCR amplification product. If the DLAT genotype is TT, it is Aquilaria sinensis; if the DLAT genotype is CC, it is Aquilaria sinensis.

[0028] Furthermore, the primers used for PCR amplification of the DLAT gene were identified as Pri-F and Pri-R, with primer lengths of 19 bp and 19 bp, respectively, an amplification length of 379 bp, sequences of ATTGGCATTCGGTCCTTGT and ATAGAATCCTCCGGCCACTA, and an annealing temperature of 58°C.

[0029] Furthermore, the identification method is used for the identification of germplasm of Aquilaria sinensis.

[0030] The present invention has the beneficial effect of using the DLAT gene in the method for identifying agarwood and white agarwood. By performing high-throughput sequencing on agarwood and white agarwood and performing genome-wide genotype detection and analysis, it was found that the DLAT gene has significant differences between agarwood and white agarwood, and the gene function is relatively clear. Utilizing these genotypic differences, PCR amplification and Sanger sequencing are used to identify agarwood and white agarwood germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a comparison diagram of the differences between Aquilaria sinensis and Kynam in the DLAT gene of the present invention; Figure 2 is the electrophoresis diagram of the PCR products of the present invention; Figure 3 It is a peak diagram result display of the SNP site of the present invention. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below with reference to the examples. A method for using DLAT gene to identify agarwood and white agarwood is specifically implemented as follows: 1) List of primers for PCR and sequencing experiments. The primers are shown in Table 4.

[0033] Table 4 Primer list .

[0034] 2) PCR amplification Reagents and consumables: DNA polymerase: 2*Taq MasterMix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number: CW0682L); Primer; RNase-free water.

[0035] 3) PCR reaction system, as shown in Table 5.

[0036] Table 5 PCR reaction system .

[0037] 4) PCR reaction conditions are shown in Table 6.

[0038] Table 6 PCR reaction conditions .

[0039] 5) PCR product detection.

[0040] Glue concentration: 1.1% glue concentration, 160V voltage, 30min.

[0041] Marker: M is DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., product number CW0632M.

[0042] The DM2000 DNA Marker consists of six DNA fragments: 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. A 3 μl sample was directly electrophoresed. The 750 bp DNA fragment weighed approximately 90 ng, appearing as a bright band. The remaining bands weighed approximately 30 ng. The electrophoresis pattern of the PCR product is shown in Figure 1. Figure 2 shown.

[0043] 6) Sanger sequencing.

[0044] Sanger sequencing of the DLAT gene PCR amplification products revealed that the DLAT genotype of Aquilaria sinensis was TT and that of Aquilaria sinensis was CC. The sequencing results are shown in Table 7.

[0045] Table 7 SNP site genotype statistics .

[0046] The peak plot results of the SNP site are shown as follows Figure 3 shown.

[0047] The above content is only used to illustrate the technical solution of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention made by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for identifying Aquilaria sinensis and Aquilaria sinensis using DLAT genes, characterized in that: The identification of Aquilaria sinensis and Aquilaria sinensis was based on the DLAT genotype of Aquilaria sinensis being TT and the DLAT genotype of Aquilaria sinensis being CC.

2. The identification method according to claim 1, wherein: The method comprises the following steps: using base 1879 of the DLAT gene coding region of Aquilaria sinensis and Aquilaria sinensis as a target site, adopting a PCR and Sanger sequencing method, and performing Sanger sequencing on the PCR amplification product of the DLAT gene. If the DLAT genotype is TT, the Aquilaria sinensis is aquilaria sinensis; if the DLAT genotype is CC, the Aquilaria sinensis is aquilaria sinensis.

3. The identification method according to claim 2, wherein: The primers used for PCR amplification of the DLAT gene were named Pri-F and Pri-R, with primer lengths of 19 bp and 19 bp respectively, and the amplified length was 379 bp. The sequences were ATTGGCATTCGGTCCTTGT and ATAGAATCCTCCGGCCACTA, and the annealing temperature was 58°C.

4. The identification method according to claim 1 is used for identifying the germplasm of Aquilaria sinensis.