A method for constructing a mouse model of inducing acute inflammatory anemia
By constructing a mouse model of acute inflammatory anemia through a single Poly(I:C) stimulation, the problems of complex model construction and high time cost in existing technologies have been solved. This approach enables rapid and stable model construction with clear time points, supporting drug screening and mechanism research.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
- Filing Date
- 2025-08-08
- Publication Date
- 2026-05-12
AI Technical Summary
Current technologies cannot quickly and stably construct mouse models of acute inflammatory anemia, and lack clear time points for acute inflammatory anemia, which affects the efficiency of drug screening and pathogenesis research.
A mouse model of acute inflammatory anemia was established 36 hours after a single Poly(I:C) stimulation. C57BL/6J mice were injected intraperitoneally with Poly(I:C) at a dose of 12 mg/kg to simulate anemia caused by acute disease. Peripheral blood monocyte ratio, red blood cell concentration, hemoglobin concentration and other indicators were monitored.
We have achieved rapid and stable construction of an acute inflammatory anemia model, clarified 36 hours as the threshold for acute anemia, provided a precise time point, and laid the foundation for drug screening and mechanism research.
Smart Images

Figure CN120616838B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to a method for constructing a mouse model that induces acute inflammatory anemia. Background Technology
[0002] Inflammatory anemia (AI), a common type of anemia, severely impacts patients' health and quality of life. Among AI patients, 71% have acute infections, 12% have cancer, and 16% have chronic infections or autoimmune diseases. Based on different pathogenesis and etiologies, inflammatory anemia can be classified into several types, with acute inflammatory anemia being the most common clinically. It is usually triggered by acute inflammatory responses such as infection, trauma, or surgery, and typically occurs suddenly within 24-48 hours. Its characteristic feature is its rapid onset; if not addressed promptly and effectively, it can lead to serious consequences such as multiple organ dysfunction. Therefore, in-depth research into the pathogenesis of acute inflammatory anemia and the development of effective therapeutic drugs are of significant clinical importance.
[0003] Existing methods for constructing anemia models include gene editing, chemical or physical induction, but they have significant limitations in constructing models for acute inflammatory anemia, such as complexity, high time costs, and phenotypic instability. For example, gene-edited anemia models primarily simulate hereditary anemia, whose pathogenesis is drastically different from infectious inflammatory anemia, thus failing to provide a suitable model basis for acute inflammatory anemia research. Using LPS to induce anemia models requires repeated stimulation (e.g., more than 7 days) to elicit a chronic inflammatory anemia phenotype, which is time-consuming and subject to numerous confounding factors. Furthermore, chronic inflammatory anemia depends on hepcidin accumulation and EPO resistance, while acute anemia is primarily characterized by acute erythrocyte destruction and a sudden drop in hemoglobin levels; their pathological mechanisms differ. Currently, there is a lack of a rapid and stable method for constructing such acute inflammatory anemia models to clarify the timeline of acute inflammatory anemia, providing strong support for rapid drug screening and in-depth research into the pathogenesis of acute inflammatory anemia.
[0004] Against this backdrop, developing an effective method for constructing a mouse model to induce acute inflammatory anemia has significant clinical implications and application value. Summary of the Invention
[0005] To address the limitations of existing technologies in rapidly and stably constructing acute inflammatory anemia models and the lack of clearly defined time points for acute inflammatory anemia, this invention provides a mouse model construction method that differs from existing technologies by inducing acute inflammatory anemia through a single Poly(I:C) induction and time window control.
[0006] To achieve the above objectives, the specific technical solution provided by the present invention is as follows:
[0007] The first aspect of the present invention provides a method for constructing a mouse model of induced acute inflammatory anemia, the method comprising the steps of administering Poly(I:C) to mice once, and the model is constructed 36 hours later.
[0008] In this invention, acute inflammatory anemia refers to a secondary anemia state caused by acute diseases (such as infection, trauma, surgery, etc.), and its core mechanism is related to acute inflammatory response, immune activation, or tissue damage. This type of anemia has a rapid onset, characterized by a short-term decrease in hemoglobin concentration, and often fluctuates with the progression of the primary disease. The pathophysiological processes mainly involve myelosuppression mediated by inflammatory cytokines, decreased hemoglobin gene expression, and accelerated red blood cell destruction.
[0009] In this invention, Poly(I:C) (Polyinosinic acid-polycytidylic acid) is also known as (PolyI:C), and its Chinese aliases include polycytidylic acid, polyinosinic acid, polyinosinic acid-polycytidylic acid, and polyinosinic acid-polycytidylic acid. Its CAS number is 42424-50-0.
[0010] Furthermore, the dosage of Poly(I:C) is 12 mg / kg.
[0011] Furthermore, the method of administration of Poly(I:C) is intraperitoneal injection.
[0012] Furthermore, the mouse in question is a C57BL / 6J mouse.
[0013] The second aspect of the present invention provides a mouse model obtained by the construction method described in the first aspect of the present invention.
[0014] In some embodiments, the detection results of the mouse model, compared with wild-type mice, show changes in at least one of the following indicators: increased proportion of peripheral blood mononuclear cells, decreased red blood cell concentration, decreased hemoglobin concentration, increased spleen weight, decreased hemoglobin gene expression, increased innate immune gene expression, and decreased erythroid regulatory gene expression.
[0015] In this invention, "increase" or "decrease" refers to a change in the expression level of the above-mentioned indicators in the detection results of the mouse model obtained by the construction method described in the first aspect of this invention, compared to wild-type mice, by at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.
[0016] In this invention, innate immune genes, as part of the innate immune system, can act as intracellular and extracellular signaling molecules to regulate immune responses. In specific embodiments of this invention, innate immune genes include Rsad2, Isg15, Ifit1, and Oas1a.
[0017] In this invention, erythroid regulatory genes refer to key genes that regulate erythrocyte production and differentiation. They ensure normal erythrocyte development and function by regulating the expression of erythrocyte-specific genes. In specific embodiments of this invention, erythroid regulatory genes include Eklf, Gata1, Nfe2, and Ldb1.
[0018] The third aspect of this invention provides the application of the mouse model obtained by the construction method described in the first aspect of this invention in the study of the pathogenesis of acute inflammatory anemia.
[0019] The fourth aspect of this invention provides the application of the mouse model obtained by the construction method described in the first aspect of this invention in screening drugs for the treatment of acute inflammatory anemia.
[0020] The fifth aspect of this invention provides a method for screening drugs for the treatment of acute inflammatory anemia. The method includes the following steps: administering the drug to be screened to a mouse model obtained by the construction method described in the first aspect of this invention; detecting at least one of the following indicators: peripheral blood mononuclear cell ratio, erythrocyte concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression level, innate immune gene expression level, and erythroid regulatory gene expression level; comparing the detection results of mice treated with the drug to be screened and mice not treated with the drug to be screened, and assessing whether the drug to be screened is a treatment for acute inflammatory anemia.
[0021] In some embodiments, if, compared with mice not treated with the selected drug, the mice treated with the selected drug show changes in at least one of the following indicators: decreased peripheral blood mononuclear cell ratio, increased erythrocyte concentration, increased hemoglobin concentration, decreased spleen weight, increased hemoglobin gene expression, decreased serum EPO level, decreased serum TNF-α and IL-6 levels, decreased expression of innate immune genes, and increased expression of erythroid regulatory genes, then the selected drug has a therapeutic effect on acute inflammatory anemia and is a candidate treatment drug for acute inflammatory anemia; if the test results remain unchanged or are contrary to the above results, then the selected drug is not a candidate treatment drug for acute inflammatory anemia.
[0022] Furthermore, the drugs to be screened include protein analogs, antibodies, DNA, RNA, and small molecule compounds.
[0023] Furthermore, the sources of the small molecule compounds are selected from: newly synthesized or existing databases; wherein existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), traditional Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases from different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), and food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet). Databases include: toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry directories (Greenpharma, AnalytiConDiscovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases deduplicated using MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), and databases deduplicated using NMR data (NMRShiftDB, NAPROC-13), etc.
[0024] Furthermore, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and linker DNA.
[0025] Furthermore, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, catalytically active RNA, and various viral RNAs.
[0026] Furthermore, the drugs to be screened include various pharmaceutically acceptable salt forms.
[0027] Furthermore, the drugs to be screened include drugs used alone or drug combinations.
[0028] Furthermore, the pharmaceutical composition refers to a combination of the drug to be screened and a pharmaceutically acceptable carrier.
[0029] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, to a reasonable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, and that meet a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, and amino acid copolymers. Such carriers are well known to those skilled in the art.
[0030] Advantages and beneficial effects of the present invention:
[0031] 1) This invention can induce a significant decrease in red blood cell count and hemoglobin level by a single Poly(I:C) stimulation for 36 hours, accurately simulating the time window of acute anemia.
[0032] 2) This invention is the first to clearly define 36 hours as the threshold for acute anemia, providing a precise time point for drug screening and mechanism research in acute inflammatory anemia.
[0033] 3) The construction of the acute inflammatory anemia mouse model in this invention lays a good foundation for the study of the mechanism of acute inflammatory anemia. Attached Figure Description
[0034] Figure 1 This diagram illustrates the method for constructing a mouse model of acute inflammatory anemia and provides statistical charts of blood routine results. In the diagram, a represents the method for constructing the mouse model of acute inflammatory anemia; b represents the percentage of mononuclear cells in the peripheral blood of mice; c represents the red blood cell concentration; and d represents the hemoglobin concentration.
[0035] Figure 2 This is a statistical chart of spleen weight in a mouse model of acute inflammatory anemia.
[0036] Figure 3 This is a statistical graph showing the expression level of hemoglobin genes (Hbb-b1 / bs / bt) in a mouse model of acute inflammatory anemia.
[0037] Figure 4 This is a statistical graph showing the serum EPO levels in mice with acute inflammatory anemia.
[0038] Figure 5 This is a statistical graph showing the serum levels of inflammatory factors TNF-α and IL-6 in mice with acute inflammatory anemia.
[0039] Figure 6This is a statistical graph showing the expression levels of innate immune genes (Rsad2, Isg15, Ifit1, Oas1a) in bone marrow-derived erythroid cells of a mouse model of acute inflammatory anemia.
[0040] Figure 7 This is a statistical graph showing the expression levels of erythroid regulatory genes (Eklf, Gata1, Nfe2, Ldb1) in bone marrow-derived erythroid cells from a mouse model of acute inflammatory anemia. Detailed Implementation
[0041] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0042] Example 1: Determining the key time points for constructing a mouse model of acute inflammatory anemia
[0043] I. Experimental Materials
[0044] 1. Species and Source of Experimental Animals: C57BL / 6J wild-type mice used in the experiments were purchased from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences. All experimental mice were cultured in the SPF-grade animal laboratory of the Laboratory Animal Research Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, and the feed was provided by the Animal Center of the Academy of Military Medical Sciences. The animal culture room adopted a 12-hour light-dark cycle, i.e., lighting from 7:00 to 19:00 daily, and no lighting from 19:00 to 7:00 the next day. The animal experiments involved in this institute have undergone ethical review by the Laboratory Animal Center of Peking Union Medical College, with ethical review number ACUC-A02-2015-001.
[0045] 2. Reagents and consumables: Poly(I:C) powder (Merck, product code sigma-Aldrich P1530), Anti-Ter119 MicroBeads (Miltenyi Biotec, product code 130-049-901), magnetic columns (Miltenyi Biotec, product code 130-042-201), magnetic racks (Miltenyi Biotec, product code 130-042-108), rapid RNA extraction kit for cells (Yishan Biotechnology, product code RN001), and PrimeScript IV 1st strand cDNA Synthesis Mix reverse transcription reagent (TAKARA, product code 6215A).
[0046] II. Experimental Methods
[0047] 1. Intraperitoneal injection of Poly(I:C) into mice
[0048] Male mice aged 8-10 weeks in good condition were used for the experiment. Mice were randomly divided into three groups: experimental group 1 (Poly(I:C) injection for 12 hours), experimental group 2 (Poly(I:C) injection for 36 hours), and control group (PBS injection), with 5 mice in each group. Poly(I:C) powder was weighed, dissolved in PBS to prepare a 2 mg / ml stock solution, mixed thoroughly, sterilized using a 0.22 μm filter membrane, and aliquoted at -20℃. Intraperitoneal injection was performed using a 1 ml insulin syringe at a point 5 mm lateral to the midline in the lower abdomen of the mice. The Poly(I:C) injection dose for the experimental group was 12 mg / kg, and the control group received an equal volume of PBS. Samples were collected 12 hours and 36 hours after injection for subsequent experiments.
[0049] 2. Peripheral blood routine test of adult rats
[0050] Prepare anticoagulant blood collection tubes: One day in advance, add 1.5ml of PBS containing EDTA-2Na or heparin to centrifuge tubes, dry at 56℃, and label. Take the mice to be tested and inject them with sodium pentobarbital according to their weight, while preparing instruments. After the mice become dazed, hold the mouse upside down with your left hand and gently press the skin to induce eye congestion. Use surgical forceps in your right hand to quickly remove the eyeballs and simultaneously collect blood using centrifuge tubes. When the blood flow is slow, gently press the mouse's abdominal and thoracic cavities to increase the blood volume collected. Quickly invert the collected blood to mix it thoroughly to ensure the anticoagulant's effect. Send the blood samples to the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences for routine blood index testing. The time from collection to testing should be within 5 hours, and the temperature should be maintained at 4-10℃ during transportation.
[0051] 3. Spleen removal from mice
[0052] The mice were euthanized by cervical dislocation and disinfected with 75% alcohol. The lower abdominal skin was lifted with surgical forceps, and a 1 cm transverse incision was made with scissors, cutting along the midline towards the xiphoid process to remove the spleen. The spleen was supported by filter paper moistened with pre-cooled PBS, and the pancreatic tissue was gently dissected to prevent adhesions. The spleen was weighed using a 0.01% electronic balance after zeroing.
[0053] 4. Mouse bone marrow-derived erythroid cells (Ter119) + Cell isolation
[0054] Using surgical forceps, the skin of the mouse's groin was grasped, and the skin was cut along the groin line to harvest the femur below the pelvis. After fixing the injection needle, the muscles on the femur were dissected using surgical forceps and gauze to obtain a relatively clean femur. The ends of the tibia were carefully cut off to allow the needle of a 1 ml syringe to be inserted into the tibia. PBS was used to rinse the tibial cavity, and the rinsing fluid was collected (Note: Rinse the cavity until it becomes clear or whitish). Bone marrow cells in the rinsing fluid were dispersed with a pipette, filtered through a 40 μm filter membrane, and centrifuged at 300 g for 10 min. After resuspending in 1 ml PBS, the cells were counted and incubated in a 1.5 ml centrifuge tube with mouse TER119 magnetic beads (Anti-Ter119 MicroBeads). After incubation at 4-8℃ in the dark for 15 min, the cells were washed twice with pre-cooled PBS / 2 mM EDTA / 0.5% BSA, 1 ml each time. After centrifugation, the magnetic column was rinsed with 500 μl PBS / 2mM EDTA / 0.5% BSA, and the resuspended cells were then passed through the column. The magnetic column was washed three times with 500 μl PBS / 2mM EDTA / 0.5% BSA, and then the adsorbed TER119 cells were expelled from the column using 500 μl PBS / 2mM EDTA / 0.5% BSA. + Cells were collected by centrifugation.
[0055] 5. Extraction, reverse transcription, and real-time quantitative PCR (qPCR) of total cellular RNA.
[0056] Total RNA was extracted from erythroid cells using a rapid cellular RNA extraction kit. The collected erythroid cells (approximately 5 x 10⁻⁶ cells) were then... 6Resuspend cells in 1 ml PBS, centrifuge at 1000 rpm, 4°C for 5 min, and discard the supernatant. Add 500 μl Lysis buffer, and lyse the cells by forcefully pipetting 10 times or vortexing for 10 seconds. Add an equal volume (500 μl) of anhydrous ethanol, mix thoroughly, and transfer in two portions to an RNA centrifugation adsorption column. Centrifuge at 12000 g, room temperature for 1 min, and discard the liquid. At this point, the RNA has bound to the membrane in the center of the column. After discarding the effluent, turn the collection tube upside down and use absorbent paper to remove any remaining liquid from the collection tube opening. Add 500 μl wash buffer to the column, centrifuge at 12000 g, 4°C for 1 min, discard the effluent, and use absorbent paper to remove any remaining liquid from the collection tube opening. Centrifuge at 12000 g, 4°C for 1 min to thoroughly remove any remaining waste liquid. Discard the collection tube, transfer the centrifugation column to an RNase-free 1.5 ml EP tube, and allow it to air dry for 2 min. Add 30 μL of Elution Buffer to the membrane in the center of the centrifuge column, incubate at room temperature for 2 min, centrifuge at 12000g and 4℃ for 1 min to obtain the RNA solution, and determine the concentration and purity of the RNA using a Nanodrop UV spectrophotometer. Store the extracted RNA in a -80℃ freezer.
[0057] Total RNA from cells was reverse transcribed into cDNA using PrimeScript IV 1st strand cDNA Synthesis Mix. The total amount of reverse transcribed RNA (2 μg) was diluted to 14 μl with DEPC water. Then, 4 μl of 5×PrimeScript IV cDNA Synthesis Mix and 2 μl of Random 6 mers (50 μM) were added to prepare a total reverse transcription system of 20 μl. After mixing, the system was placed in a metal bath and the reaction program was set as follows: 30℃ for 10 min, 42℃ for 15 min, and 95℃ for 5 min to inactivate the enzyme. The mixture was then cooled on ice and stored at -20℃.
[0058] 20 μl of 2 μg reverse transcription product was diluted to 5 ng / μl cDNA with 380 μl ddH2O to serve as a template for subsequent real-time quantitative PCR. The qPCR system was prepared as follows: for each reaction, 2 μl of cDNA was used as template, 10 μl of SYBR Green Master Mix, 1 μl each of forward and reverse primers (10 μM), and 6 μl of distilled water were added, and the mixture was mixed and centrifuged. Samples were added to 96-well plates, with three replicates per sample tube. A BioRad CFX96 real-time quantitative PCR instrument was used. The qPCR reaction program was: 95℃ for 10 s, 60℃ for 30 s, and 72℃ for 30 s for 40 cycles, followed by melting curve determination.
[0059] The forward primer sequence for Ms Hbb-b1 / bs / bt (mice adult hemoglobin gene) used in qPCR experiments was TTTAACGATGGCCTGAATCACTT (SEQ ID NO:1), and the reverse primer sequence was CAGCACAATCACGATCATATTGC (SEQ ID NO:2). The forward primer sequence for Ms GAPDH (mice internal reference gene) was TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO:3), and the reverse primer sequence was AGGTCGGTGTGAACGGATTTG (SEQ ID NO:4). mRNA levels were reflected by the cycle number (CT) value, and the relative quantitative internal reference was the mRNA expression level of the GAPDH gene.
[0060] III. Experimental Results
[0061] Figure 1 In the diagram, 'a' represents the construction of an acute inflammatory mouse model. Mice were injected intraperitoneally with Poly(I:C) for 12 hours (experimental group 1) and 36 hours (experimental group 2), and samples were taken for testing.
[0062] Figure 1 Tables b, c, and d, and Tables 1-3 show the results of routine peripheral blood tests in mice. Table 1 represents the control group, Table 2 represents experimental group 1, and Table 3 represents experimental group 2. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, and n=5. Results are as follows... Figure 1 As shown in b, c, and d, compared with the control group, the proportion of monocytes in experimental groups 1 and 2 was significantly increased. The red blood cell content in experimental group 1 was not significantly different from that in the control group, while the red blood cell concentration and hemoglobin concentration in experimental group 2 were significantly decreased, which is consistent with the acute anemia phenotype.
[0063] Table 1. Blood routine test results of the control group
[0064]
[0065]
[0066] Table 2. Blood routine test results of experimental group 1
[0067]
[0068]
[0069] Table 3. Blood routine test results of experimental group 2
[0070]
[0071]
[0072] Figure 2 The changes in spleen weight in mice were shown. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, n=5. There was no significant difference in spleen weight between the control group and experimental group 1; however, the spleen weight in experimental group 2 was significantly increased (P = 0.0039), indicating that the acute inflammatory response led to significant splenic congestion and enlargement, consistent with immune activation and extramedullary hematopoietic stress.
[0073] Figure 3 The expression levels of hemoglobin genes (Hbb-b1 / bs / bt) in mouse bone marrow-derived erythroid cells were displayed. P-values were calculated using Students' t test, and data are expressed as mean ± standard error (n=5). The overall expression levels of the hemoglobin gene clusters (Hbb-b1, Hbb-bs, Hbb-bt) in adult mice were detected and normalized using GAPDH as an internal reference. Results showed that compared with the control group, there was no significant difference in hemoglobin gene expression in experimental group 1, while hemoglobin gene expression in experimental group 2 was significantly inhibited (P < 0.0001), with the relative expression level decreasing to approximately 0.4. This suggests that inflammatory factors accelerate the inhibition of erythropoiesis by suppressing the expression of key genes in erythroid differentiation.
[0074] Example 2: Validation of an acute inflammatory anemia mouse model
[0075] I. Experimental Materials
[0076] Mouse Erythropoietin / EPO Quantikine ELISA Kit (R&D Systems, Product No. MEP00B), Mouse TNF-alpha Quantikine ELISA Kit (R&D Systems, Product No. MTA00B), Mouse IL-6 Quantikine ELISA Kit (R&D Systems, Product No. D6050B).
[0077] II. Experimental Methods
[0078] 1. Detection of serum EPO levels, inflammatory factors TNF-α, and IL-6 levels in mice
[0079] Thirty-six hours after intraperitoneal injection of Poly(I:C) or PBS, mice were anesthetized with sodium pentobarbital. Approximately 0.5 mL of whole blood was collected via the retro-orbital venous plexus and placed in anticoagulant tubes containing EDTA-2Na or heparin. The tubes were incubated at 4°C for 30 min, then centrifuged at 2000 g for 20 min at 4°C. The supernatant serum was separated, aliquoted, and stored at -80°C for later use, avoiding repeated freeze-thaw cycles. All reagents in the ELISA kit were equilibrated at room temperature for 30 min before the experiment. Reconstitute the lyophilized standards of EPO, TNF-α, and IL-6 separately with the corresponding Calibrator Diluent, let stand for 5 min, and then gently mix to obtain high-concentration stock solutions of 3000 pg / mL (EPO, IL-6) or 7000 pg / mL (TNF-α). Then, perform 2-fold serial dilutions with Calibrator Diluent (EPO and IL-6 starting from 300 pg / mL, TNF-α from 700 pg / mL), for a total of 7 concentration points, with a zero-concentration blank control. Gently invert and mix Mouse Epo Conjugate (EPO), Mouse TNF-α Conjugate (TNF-α), or Human IL-6 Conjugate (IL-6) to avoid foaming. Dilute 25x Wash Buffer Concentrate with deionized water to 1x working solution (e.g., 20 mL concentrate to 480 mL deionized water), mix well, and set aside. Mix Color Reagent A (H2O2) and Color Reagent B (TMB) in a 1:1 volume ratio. Use within 15 minutes and store protected from light. Take a 96-well antibody-coated microplate and add blank, standard, and sample wells. Add 50 μL of Assay Diluent to each well, followed by 50 μL of a series of standards or serum samples diluted 1:2 (using the corresponding Calibrator Diluent). Gently tap the plate frame for 1 minute to mix, then cover with a sealing film and incubate at room temperature on a horizontal microplate shaker for 2 hours. Discard the liquid in the wells. Add 400 μL of 1×Wash Buffer to each well, let stand for 30 seconds, then discard the liquid and blot dry. Repeat this process 4 times for a total of 5 times to ensure complete removal of residual liquid. Add 100 μL of the corresponding enzyme conjugate to each well, cover with a new sealing film, and incubate at room temperature with shaking for 2 hours. Wash 5 times again as in step 4 and blot dry. Add 100 μl of freshly prepared Substrate Solution to each well and incubate at room temperature in the dark for 30 min. The color in the wells will gradually change from colorless to blue. Add 100 μl of Stop Solution to each well in the order of adding the chromogenic solution, and gently tap the plate frame to mix thoroughly. The blue color will immediately turn yellow. Measure the absorbance at 450 nm using a microplate reader within 30 min, and correct the wavelength to 540 nm or 570 nm. Fit a standard curve and calculate the concentration of each sample.If the sample is diluted, the result is multiplied by the dilution factor.
[0080] 2. Detection of mouse bone marrow-derived erythroid cells (Ter119) + Expression levels of innate immune genes and erythroid regulatory genes in cells
[0081] The specific experimental steps for extracting total RNA from cells, reverse transcription, and qPCR are the same as above. The primer sequences used for qPCR are as follows:
[0082]
[0083] III. Experimental Results
[0084] Figure 4 Serum EPO levels were displayed in a mouse model of acute inflammatory anemia. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, n=4. Results showed that serum EPO levels were significantly higher in the Poly(I:C) 36 h group compared to the control group (P = 0.0001). This result indicates that in acute inflammatory anemia, although the body initiates compensatory increases in EPO secretion, it cannot overcome the erythroid suppression and erythrocyte destruction mediated by inflammatory factors, resulting in an anemia phenotype with significantly decreased hemoglobin levels.
[0085] Figure 5 The levels of serum inflammatory factors (TNF-α and IL-6) in a mouse model of acute inflammatory anemia were displayed. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, n=4. Serum TNF-α levels were significantly higher in the Poly(I:C) injection group at 36 h compared to the PBS control group (P = 0.0006); serum IL-6 levels were also significantly higher (P = 0.0008), indicating that TNF-α and IL-6 synergistically participate in the acute inflammatory response and mediate the development of inflammatory anemia.
[0086] Figure 6 This study showed changes in the mRNA levels of innate immune genes (Rsad2, Isg15, Ifit1, Oas1a) in bone marrow-derived erythroid cells from mice with acute inflammatory anemia. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, n=4. The expression of these genes significantly increased 36 h after Poly(I:C) injection, indicating that Poly(I:C) rapidly induces widespread activation of the type I interferon pathway by mimicking viral double-stranded RNA signaling.
[0087] Figure 7This study showed changes in the mRNA levels of erythroid regulatory genes (Eklf, Gata1, Nfe2, Ldb1) in bone marrow-derived erythroid cells from mice with acute inflammatory anemia. P-values were calculated using Students' t test. Data are expressed as mean ± standard error, n=4. The expression of these genes was significantly inhibited 36 h after Poly(I:C) injection, indicating a direct inhibition of terminal differentiation of erythroid progenitor cells and hemoglobin synthesis.
[0088] This invention is the first to discover that a single Poly (I:C) stimulation for 36 hours can induce acute inflammatory anemia in mice, and confirms through 12-hour negative control data that 36 hours is the key time point. The mouse model provided by this invention can accurately simulate the time window of acute anemia, laying a good foundation for the study of the mechanism of acute inflammatory anemia.
[0089] Example 3: Screening method for drugs to treat acute inflammatory anemia
[0090] First, the acute inflammatory anemia mice obtained by the method described in Example 1 were randomly divided into a model group and a drug administration group. The drug to be screened was administered to the drug administration group, while PBS was administered to the control group.
[0091] Secondly, at least one of the following indicators related to acute inflammatory anemia was detected in each group of mice: peripheral blood mononuclear cell ratio, erythrocyte concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression level, innate immune gene expression level, and erythroid regulatory gene expression level.
[0092] Finally, the test results of the mice in the drug administration group and the model group were compared, and the drugs to be screened were evaluated based on the test results to determine whether they were therapeutic agents for acute inflammatory anemia.
[0093] The specific evaluation criteria for screening drugs for the treatment of acute inflammatory anemia are as follows: If, compared with the model group mice, the test results of the treated mice show changes in at least one of the following indicators: decreased peripheral blood mononuclear cell ratio, increased erythrocyte concentration, increased hemoglobin concentration, decreased spleen weight, increased hemoglobin gene expression, decreased serum EPO level, decreased serum TNF-α and IL-6 levels, decreased expression of innate immune genes, and increased expression of erythroid regulatory genes, then the drug to be screened has a therapeutic effect on acute inflammatory anemia and is a candidate drug for the treatment of acute inflammatory anemia; if the test results remain unchanged or are contrary to the above results, then the drug to be screened is not a candidate drug for the treatment of acute inflammatory anemia.
[0094] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. A method for constructing a mouse model of induced acute inflammatory anemia, characterized in that, The construction method involves a single intraperitoneal injection of Poly(I:C) into C57BL / 6J mice at a dose of 12 mg / kg. The model is completed 36 hours later.
2. The application of the mouse model obtained by the construction method described in claim 1 in the study of the pathogenesis of acute inflammatory anemia.
3. The application of the mouse model obtained by the construction method of claim 1 in screening drugs for the treatment of acute inflammatory anemia.
4. A method for screening drugs for the treatment of acute inflammatory anemia, characterized in that, The steps of the method include: The drug to be screened was administered to the mouse model obtained by the construction method of claim 1; The study measured at least one of the following indicators in mouse peripheral blood: percentage of mononuclear cells, red blood cell concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression level, serum erythropoietin (EPO) level, serum inflammatory factor level, expression level of innate immune genes and erythroid regulatory genes. By comparing the test results of mice treated with the drug to be screened and those not treated with the drug to assess whether the drug to be screened is a treatment for acute inflammatory anemia.
5. The method according to claim 4, characterized in that, The serum inflammatory factors are TNF-α and / or IL-6.
6. The method according to claim 4, characterized in that, The drugs to be screened include protein analogs, antibodies, DNA, RNA, and small molecule compounds.
7. The method according to claim 4, characterized in that, The drugs to be screened include drugs used alone or drug combinations.