Method for improving expression quantity of full-length III type collagen
By mutating the 15th leucine at the N-terminus of human full-length type III collagen to aspartic acid in CHO-S cells and connecting a signal peptide, combined with optimized culture conditions, the problem of low expression of human full-length collagen in CHO-S cells was solved, and efficient expression of natural human full-length collagen was achieved.
Patent Information
- Application Number
- CN202510748625.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2045-06-06
AI Technical Summary
The existing technology lacks a method to effectively increase the expression of full-length human collagen in CHO-S cells, and genetic engineering methods mainly express fragments that lack natural structure and function.
By mutating the leucine at position 15 of the N-terminus of human full-length type III collagen to aspartic acid, and connecting a 6×His fragment and a signal peptide, a recombinant plasmid was constructed. CHO-S cells were used for expression, and feed and sugar supplementation were performed during the culture process to optimize the culture conditions to increase the expression level.
The expression level of human full-length type III collagen was successfully increased in CHO-S cells. The expression level of the mutant was 1.3 times higher than that of the wild type, achieving efficient expression of natural human full-length collagen.
Smart Images

Figure CN120623316A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for increasing the expression level of full-length type III collagen. Background Art
[0002] Collagen is a biopolymer and the primary component of animal connective tissue. It is also the most abundant and widely distributed functional protein in mammals, accounting for 25% to 30% of total protein and, in some organisms, even exceeding 80%. As the most abundant animal protein, 28 types of collagen have been discovered. Type I collagen, the most common collagen in the human body, is primarily found in the skin, tendons, and bones; type II is primarily found in cartilage; and type III is primarily found in the skin and vascular system. Type III collagen is widely used to repair damaged skin, promote wound healing, and maintain skin appearance and condition. However, as people age, the proportion of type III collagen in skin tissue decreases annually.
[0003] Currently, there are two main approaches to obtaining collagen: animal extraction and genetic engineering. However, the collagen obtained through the former is more complex, loses some biological activity, is difficult to purify, and presents issues such as immunogenicity. In recent years, strategies to obtain recombinant human collagen through genetic engineering have been successful, but most of these are fragments, approximately tens of kDa in size, and do not reflect the natural structure and function of collagen. Therefore, the development of natural full-length human collagen through genetic engineering is of great significance.
[0004] Recombinant human collagen expression systems include prokaryotes (primarily E. coli) and eukaryotes (primarily yeast, plants, mammalian cells, and baculovirus). Currently, E. coli and yeast are the most commonly used expression systems. However, low-cost microbial expression systems such as E. coli and yeast require the addition of corresponding modification enzymes and lack the post-translational modifications found in animal cells. While full-length human collagen expressed in plants, baculovirus, and mammalian cells has a well-developed triple helical structure and biological activity, its yield is lower than that of microbial expression systems.
[0005] CHO-S cells are the most commonly used cells in mammalian cell expression systems. They have high genetic stability and are suitable for large-scale culture and recombinant protein production. They have advantages such as genetic stability, high expression levels, ease of culture, and wide application. Therefore, increasing the expression of full-length human collagen in CHO-S cells is of great significance. However, the existing technology lacks effective methods for increasing the expression of full-length human collagen in CHO-S cells. Summary of the Invention
[0006] The purpose of the present invention is to provide a method for increasing the expression level of human full-length type III collagen in CHO-S cells.
[0007] The technical solutions of the present invention are as follows:
[0008] The present invention provides a human full-length type III collagen mutant, which is obtained by mutating the leucine at position 15 of the N-terminus to aspartic acid based on the amino acid sequence shown in SED ID NO.1.
[0009] In one embodiment, the amino acid sequence of the mutant is shown in SED ID NO.4.
[0010] The present invention also provides a fusion protein containing the mutant.
[0011] In one embodiment, a 6×His fragment and a signal peptide shown in SEQ ID NO. 7 are sequentially connected to the N-terminus of the mutant.
[0012] The present invention also provides a gene encoding the mutant, the nucleotide sequence of the gene is shown in SEQ ID NO.5.
[0013] The present invention also provides a gene encoding the fusion protein.
[0014] The invention also provides a recombinant plasmid containing the gene.
[0015] The present invention also provides a recombinant CHO cell expressing the mutant or the fusion protein or carrying the gene or containing the recombinant plasmid.
[0016] The present invention also provides a recombinant CHO cell, which uses CHO-S cells as a host and pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin as a vector to recombinantly express the fusion protein.
[0017] In one embodiment, the method for constructing the recombinant CHO cells is: the signal peptide gene shown in SEQ ID NO.8 and the human full-length type III collagen mutant gene containing the 6×His encoding gene shown in SEQ ID NO.6 are sequentially connected behind the CMV promoter of the plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin to construct a recombinant plasmid; the recombinant plasmid is transfected into CHO-S cells to obtain recombinant CHO cells.
[0018] The present invention also provides a method for in vitro recombinant expression of human full-length type III collagen, wherein the recombinant CHO cells are cultured in a culture medium for at least 5 days.
[0019] In one embodiment, feed and sugar supplementation are performed during the culture process; the feed supplementation is to supplement fresh culture medium on the 1st / 3rd / 5th day of culture, respectively, and the supplementation amount is 5-10% of the initial culture medium volume; the sugar supplementation is to supplement glucose to a concentration of 6 g / L or above when the glucose concentration is lower than 3 g / L.
[0020] The present invention also provides the use of the mutant, the fusion protein, the gene, the recombinant plasmid or the recombinant CHO cell in expressing human full-length type III collagen or a product containing human full-length type III collagen in vitro.
[0021] Beneficial effects:
[0022] This study successfully expressed full-length human type III collagen in CHO-S cells using genetic engineering methods. By mutating the leucine at position 15 of the N-terminus of full-length human type III collagen to aspartic acid and attaching a signal peptide, the expression of the mutant was increased by 1.3 times compared to the wild-type. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Schematic diagram of the construction of human full-length type III collagen protein plasmid.
[0024] Figure 2 Schematic diagram of the construction of human full-length type III collagen plasmid containing signal peptide.
[0025] Figure 3 Schematic diagram of the construction of the human full-length type III collagen L15D mutant plasmid containing the signal peptide.
[0026] Figure 4 Human full-length type III collagen SDS-PAGE gel electrophoresis; 1-4 indicate supernatant samples taken 2, 4, 6, and 8 days after transfection, respectively.
[0027] Figure 5 SDS-PAGE gel electrophoresis of human full-length type III collagen L15D mutant; 1-4 indicate supernatant samples taken 2, 4, 6, and 8 days after transfection, respectively.
[0028] Figure 6 Enzyme-linked immunosorbent assay (ELISA); WT: native sequence human full-length type III collagen.
[0029] Figure 7 Western Blot results of different human full-length type III collagen mutants; Ctrl: cell culture supernatant without plasmid transfection; 1: K6D; 2: W9D; 3: L34D; 4: K45E; 5: S58E; 6: Q69D; 7: T95D; 8: L15D.
[0030] Figure 8Enzyme-linked immunosorbent assay (ELISA) of different mutants. DETAILED DESCRIPTION
[0031] The present invention is further described in detail below through examples.
[0032] However, the following examples are merely illustrative, and the present invention is not limited to the following embodiments.
[0033] The cell growth medium used in the following examples is: serum-free CHO Hi-Trans medium, 6 mmol / L L-glutamine and 100-200× anti-cell clumping agent (Apollo Biosciences, Cat. No. AC609916).
[0034] The culture conditions used in the following examples were 8% (v / v) CO2 shaker, 120 rpm, and 37°C culture.
[0035] Example 1 Construction of recombinant human full-length type III collagen and its mutant plasmids
[0036] A 6×His fragment was connected to the N-terminus of the amino acid sequence of human full-length type III collagen COL3A1 as fragment 1; a nucleotide sequence encoding fragment 1 was artificially synthesized (eg, SED ID NO.3), using the nucleotide fragment as a template, PCR was performed with ATTCCGGTATGCACCATCACCATCACCAC and CGAGGAATTCTCACAGGAAGCACACGGGGC as primers to obtain fragment 2; using the plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin (purchased from Hanheng Biotechnology Co., Ltd., No. LV012) as a template, PCR was performed with GTGTGCTTCCTGTGAGAATTCCTCGAGACTAG and GTGATGGTGCATACCGGAAATAGATCCTCT as primers to obtain fragment 3, and fragments 2 and 3 were connected by homologous recombination to obtain a recombinant plasmid. After transformation, colony PCR and sequencing, the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puro was finally obtained. The constructed plasmid map is shown in FIG. Figure 1 shown.
[0037] Two pairs of primers were designed by PCR amplification to add a signal peptide sequence after the CMV promoter of the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puro. First, the recombinant plasmid pHBLV-CMV-COL3A1-EF1-Zsgreen-T2A-puro was used as a template and CCGGCGTGCGCGCGGGCAGCGGCATGCACCATCACCATCACCACATGAGCTTCGTGCAG and
[0038] TCAGCAGCACCAGGCAGCACAGCAGCGCGCTGCTATGCATACCGGAAATAGATCCTCTA was used as primer for PCR amplification; then the amplified product was used as a template, and GTGCTGCCTGGTGCTGCTGACCGGCGTGCGCGCG and TCAGCAGCACCAGGCAGCACAGCAGCGCGCTGCTATGCATACCGGAAATAGATCCTCTA were used as templates for amplification to obtain a recombinant plasmid carrying a signal peptide nucleotide sequence (shown in SED ID NO.8). After transformation, colony PCR verification and sequencing, the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro was obtained. The constructed plasmid map is as follows: Figure 2 .
[0039] Based on the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro, mutation site primers were designed with the primer sequences of GCTGCTCCTGGCCCTGGATCACCCTACCATTATCC and GGATAATGGTAGGGTGATCCAGGGCCAGGAGCAGC. PCR was followed by DpN I digestion, followed by transformation, colony PCR, and sequencing. Finally, the recombinant mutant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro was obtained. The constructed plasmid map is as follows: Figure 3 .
[0040] Example 2 Construction and culture of recombinant cells
[0041] CHO-S cell culture:
[0042] Preheat CHO Hi-Trans medium at 37°C for 20-30 minutes and add L-glutamine to a final concentration of 6 mM. 6Cells in the mid-logarithmic growth phase with a viability greater than 95% are passaged. Aseptically transfer the required amount of seed solution to a shake flask of appropriate volume and supplement with CHO Hi-Trans medium containing 6 mM L-glutamine and 100-200× anti-agglomerant. Culture the shake flask in a cell culture shaker at 37°C, 80% humidity, 120 rpm (50 mm amplitude), and 8% CO2.
[0043] CHO-S cell transfection:
[0044] Take a 125mL shake flask as an example:
[0045] 1. Preparation of transfected cells: Inoculate cells and culture to (5-6) × 10 6 cells / ml, cell viability ≥95%.
[0046] 2. Preparation of transfection complexes
[0047] (1) Preparation of plasmid dilution: Add 25 μg of plasmid to CHO Hi-Trans medium and mix gently. The volume of plasmid dilution is 1.25 mL.
[0048] (2) Preparation of transfection reagent diluent: Add 175 μL of CarpTrans transfection reagent to CHO Hi-Trans culture medium and mix gently. The volume of transfection reagent diluent is 1.25 mL.
[0049] (3) Preparation of plasmid-transfection reagent complex: Add the transfection reagent diluent to the plasmid diluent, mix gently, and incubate at room temperature for 10-15 minutes to fully react and form a plasmid-transfection reagent complex.
[0050] 3. Transfection and Culture
[0051] (1) Slowly add the incubated plasmid-transfection reagent complex to the cells to be transfected while gently shaking the shaker.
[0052] (2) Culture in a cell culture shaker at 37°C, 80% humidity, 120 rpm (50 mm amplitude), and 8% CO2. To increase expression, reduce the culture temperature to 32°C 16-20 hours after transfection.
[0053] (3) Add anti-cell clumping agents
[0054] At 12-18 h after transfection, add 125-250 μL of anti-cell clumping agent.
[0055] (4) Add feed and glucose
[0056] If the cell culture time is longer than 5 days before protein harvest, additional feed and glucose should be added.
[0057] Feed: CHO Hi-Trans feed was added on D1, D3, and D5 after transfection, with the amount added each time being 7.5% of the initial culture volume, i.e. 1.875 mL.
[0058] Sugar supplementation: Take samples every day to test the glucose concentration in the supernatant. If it is lower than 3g / L, supplement it to 6g / L.
[0059] 4. Cell Harvest
[0060] When expressing secreted proteins, cells were harvested when cell viability was ≤ 60%.
[0061] Following the above method, the recombinant plasmid pHBLV-CMV-SP-COL3A1-EF1-Zsgreen-T2A-puro obtained in Example 1 was transfected into CHO-S cells to generate wild-type recombinant cells. The recombinant mutant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro was transfected into CHO-S cells to generate mutant recombinant cells. After transfection, the resulting recombinant cells were cultured according to the above method, and samples were collected on days 2, 4, 6, and 8 after transfection to assay for expression of human full-length type III collagen.
[0062] Example 3 Expression of human full-length type III collagen
[0063] SDS-PAGE gel electrophoresis detection of human full-length type III collagen expression:
[0064] Prepare 10% separation gel and 5% stacking gel, and perform SDS-PAGE gel electrophoresis on the supernatants of CHO-S cells transfected with human full-length type III collagen and its mutant plasmids on days 2, 4, 6, and 8. Figure 4 and Figure 5 As shown, the 130 kDA band is the human full-length collagen, and the expression level of the mutant is higher than that of the natural full-length on day 8.
[0065] The culture supernatant was collected on the 8th day of culture and subjected to ELISA for human full-length type III collagen:
[0066] 1. Sample Addition: Set 10 wells at 5 concentration points for the standard. Set parallel wells for each concentration and add 50 μL of standard at different concentrations. Set one blank well to add 50 μL of distilled water. For the sample wells, add 40 μL of sample diluent to the sample wells on the ELISA plate, followed by 10 μL of the sample. Add the sample to the bottom of the plate well, avoiding contact with the well walls. Gently shake to mix.
[0067] 2. Incubation: Seal the plate with sealing film and incubate at 37°C for 30 min.
[0068] 3. Liquid preparation: dilute the 30 times concentrated washing solution with 30 times distilled water and set aside.
[0069] 4. Washing: Carefully peel off the sealing film, discard the liquid, spin dry, fill each well with washing solution, let it stand for 30 seconds and then discard it. Repeat this 5 times and pat dry.
[0070] 5. Add enzyme: Add 50 μL of enzyme-labeled reagent to each well, except for the blank well.
[0071] 6. Incubation: Same operation as 2.
[0072] 7. Washing: Same operation as 4.
[0073] 8. Color development: First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and incubate at 37°C in the dark for 15 minutes.
[0074] 9. Stop: Add 50 μL of stop solution to each well to terminate the reaction (the blue color immediately turns yellow).
[0075] 10. Measurement: Use the blank well as the zero setting and measure the absorbance (OD value) of each well in sequence at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.
[0076] The results are as follows Figure 6 As shown, the expression level of the natural sequence full-length human type III collagen is about 38 mg / L, and the expression level of the mutant L15D is about 50 mg / L. The expression level of the mutant full-length human type III collagen is 1.3 times that of the natural sequence.
[0077] Comparative Example 1 Expression of other mutants of human full-length type III collagen
[0078] Referring to the method of Example 1, the 6th lysine, 9th tryptophan, 34th leucine, 45th lysine, 58th serine, 69th glutamine and 95th threonine at the N-terminus of human full-length type III collagen were mutated to aspartic acid, aspartic acid, aspartic acid, glutamic acid, glutamic acid, aspartic acid and aspartic acid, respectively, and finally 7 recombinant mutant plasmids were obtained, namely pHBLV-CMV-SP-COL3A1-N-K6D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-W9D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-CO L3A1-N-L34D-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-K45E-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-S58E-EF1-Zsgreen-T2A-puro, pHBLV-CMV-SP-COL3A1-N-Q69D-EF1-Zsgreen-T2A-puro and pHBLV-CMV-SP-COL3A1-N-T95D-EF1-Zsgreen-T2A-puro, and the corresponding primers were TTCG, respectively. TGCAGGATGGCAGCTGGCTGCTCCTG and GCTGCCATCCTGCACGAAGCTCATGTGGTGAT, GTGCAGAAGGGCAGCGATCTGCTCCTGGCCCTG and CAGGGCCAGGAGCAGATCGCTGCCC TTCTGCAC, GCGGCTGCAGCCACGATGGGCAGAGCTACGC and GCGTAGCTCTGCCATCGTGGGCTGCAGCCGC, ACGTGTGGGAGCCCGAGCCCTGTCAGATCTGCGTG and CACGCAGATC TGACAGGGCTCGGGCTCCCACACGT, GACAGCGGCGAGGTGCTGTGCGACGACATCATCTG and CAGATGATGTCGTCGCACAGCACCTCGCCGCTGTC, GACGACATCATCTGCGACGAC GATGAGCTGGACTG and CAGTCCAGCTCATCGTCGTCGCAGATGATGTCGTC, GCCCCCCACAGCCCCTGATAGACCTCCCAACGG and CCGTTGGGAGGTCTATCAGGGGCTGTGGGGGGC.
[0079] Referring to Example 2, the above seven recombinant mutant plasmids and the recombinant plasmid pHBLV-CMV-SP-COL3A1-N-L15D-EF1-Zsgreen-T2A-puro constructed in Example 1 were transfected into CHO-S cells to obtain mutant recombinant cells. Samples were taken on the 8th day after transfection, and the expression of human full-length type III collagen was detected by Western Blot.
[0080] The specific experimental steps of Western Blot are as follows:
[0081] 1. SDS-PAGE gel electrophoresis: load samples and run on the gel in order;
[0082] 2. PVDF membrane treatment: Cut a PVDF membrane to the same size as the SDS-PAGE gel and place it in an appropriate amount of methanol. Shake and soak for 30 seconds. Then place the PVDF membrane in pre-cooled transfer buffer to equilibrate before transfer. Remove the SDS-PAGE gel after electrophoresis and place it in transfer buffer to equilibrate.
[0083] 3. Transfer: Prepare a sandwich in the order of blackboard-sponge-3 layers of filter paper-SDS gel-PVDF membrane-3 layers of filter paper-sponge-whiteboard, place it in the electrophoresis tank, set the constant current mode to 300mA, and transfer for 150min.
[0084] 4. Blocking: After transfer is completed, wash the membrane with TBST three times, 5 minutes each time; place the membrane in blocking solution and block at room temperature for 1-2 hours;
[0085] 5. Incubate with primary antibody: dilute COL3A1 primary antibody in blocking buffer at the optimal ratio and incubate overnight at 4°C.
[0086] 6. Rinse: After the primary antibody incubation is completed, wash the membrane with TBST three times, 10 min each time;
[0087] 7. Incubate with secondary antibody: dilute the secondary antibody with TBST and incubate at room temperature for 1 hour;
[0088] 8. Rinse: After the secondary antibody incubation is completed, wash the membrane with TBST three times, 10 min each time;
[0089] 9. Exposure: Mix equal amounts of Solution A and Solution B of the Western Blot super-sensitive luminescent solution, drop them evenly on the PVDF membrane, and expose the membrane using the instrument.
[0090] The results are as follows Figure 7 As shown in the figure, among the eight recombinant mutant plasmids, the expression levels are L15D, K45E, S58E, Q69D and T95D from high to low, among which the expression level after L15D mutation is the highest.
[0091] Referring to the method of Example 3, all mutants were subjected to human full-length type III collagen ELISA. The results were as follows: Figure 8 As shown in the figure, the protein concentration after the leucine at position 15 was mutated to aspartic acid was much higher than that of other mutation sites.
[0092] The above examples are merely examples disclosed for the purpose of illustrating the present invention, but should not be construed as limitations of the present invention. Many different combinations are possible without departing from the scope and spirit of the present invention, and the present invention is not limited to the disclosed embodiments. Anyone skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention, and the scope of protection of the present invention shall be determined by the claims.
Claims
1. A human full-length type III collagen mutant, characterized in that: Based on the amino acid sequence shown in SEQ ID NO. 1, the leucine at position 15 was mutated to aspartic acid.
2. A fusion protein containing the mutant according to claim 1, characterized in that The N-terminus of the mutant according to claim 1 is sequentially connected to a 6×His fragment and a signal peptide shown in SEQ ID NO.
7.
3. A gene encoding the mutant according to claim 1 or the fusion protein according to claim 2.
4. A recombinant plasmid carrying the gene according to claim 3.
5. A recombinant CHO cell expressing the mutant according to claim 1 or the fusion protein according to claim 2, or carrying the gene according to claim 3, or containing the recombinant plasmid according to claim 4.
6. A recombinant CHO cell, characterized in that CHO-S cells are used as hosts and pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin is used as a vector to recombinantly express the mutant according to claim 1 or the fusion protein according to claim 2.
7. The recombinant CHO cell according to claim 6, wherein The method for constructing the recombinant CHO cells comprises: sequentially connecting the signal peptide gene shown in SEQ ID NO.8 and the human full-length type III collagen mutant gene containing the 6×His encoding gene shown in SEQ ID NO.6 behind the CMV promoter of the plasmid pHBLV-CMV-MCS-EF1-Zsgreen-T2A-puromycin to construct a recombinant plasmid; and transfecting the recombinant plasmid into CHO-S cells to obtain recombinant CHO cells.
8. A method for in vitro recombinant expression of full-length human type III collagen, characterized in that: The recombinant CHO cells according to claim 6 or 7 are cultured in a culture medium for at least 5 days.
9. The method according to claim 8, wherein: Feeding and sugar supplementation are performed during the culture process; the feeding is to supplement fresh culture medium on the 1st / 3rd / 5th day of culture, and the supplementation amount is 5-10% of the initial culture medium volume; the sugar supplementation is to supplement glucose to a concentration of 6g / L or above when the glucose concentration is lower than 3g / L.
10. Use of the mutant according to claim 1, the fusion protein according to claim 2, the gene according to claim 3, the recombinant plasmid according to claim 4, or the recombinant CHO cells according to any one of claims 5 to 7 in expressing human full-length type III collagen or a product containing human full-length type III collagen in vitro.
Citation Information
Patent Citations
Recombinant human III-type collagen as well as preparation method and application thereof
CN117700528A
Preparation method and application of recombinant full-length III type humanized collagen
CN118773255A
Attenuated rabies virus with nucleoprotein mutation at the phosphorylation site for vaccination against rabies and gene therapy in the CNS
CN1635905A