MiRNA for regulating body color of plectropomus leopardus and application of miRNA

Abstract

The invention discloses miRNA for regulating and controlling the body color of plectropomus leopardus and application of the miRNA, the miRNA is pl-miR-192, and the invention further discloses a kit for detecting the miRNA. The invention further discloses an inhibitor of the miRNA of the plectropomus leopardus and application of the inhibitor of the miRNA of the plectropomus leopardus to preparation of products for regulating and controlling the MITF gene of the plectropomus leopardus, regulating and controlling the formation related genes TYR, TYRP1 and TYRP2 of skin melanin of the plectropomus leopardus, regulating and controlling melanin of the plectropomus leopardus or regulating and controlling the body color of the plectropomus leopardus. The miRNA for regulating and controlling the body color of the plectropomus leopardus is disclosed for the first time and can be combined with an MITF gene of the plectropomus leopardus in a targeted manner; according to the miRNA inhibitor for the plectropomus leopardus, by inhibiting the expression quantity of pl-miR-192, the expression of an MITF gene is remarkably improved, so that the formation of melanin is promoted, and finally, the body color formation process of the plectropomus leopardus is regulated and controlled.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a miRNA for regulating the body color of leopard gill bass and an application thereof. Background Art

[0002] Body color is an important economic trait in fish. Its richness and diversity are a process of adaptation for fish to their growth environment and play an important role in a series of biological processes such as vigilance, courtship, and camouflage. The phenomenon of commercial fish being eliminated or having their prices greatly discounted due to poor body color is common in aquaculture production. Leopard gill bass (Plectropomus leopardus) is a valuable reef-dwelling fish in tropical waters. Its bright body color not only gives it good ornamental value, but also serves as an important trait in breeding to increase its economic value. As an epigenetic regulatory factor, miRNA (microRNA) participates in the expression regulation of key body color genes at the post-transcriptional level and is an important molecule for studying body color regulation, breeding, and improvement.

[0003] The coloration of melanin and pigment cells in fish is controlled by a complex series of gene activation and silencing processes. Tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2) are three members of the tyrosinase gene family, acting as rate-limiting enzymes in melanin formation. Microphtalmia-associated transcript factor (MITF) is a key regulator of melanocyte survival and development. It controls transcription by binding to the promoter regions of TYR, TYRP1, and TYRP2, contributing to melanin formation. Mutations in the MITF gene can cause coat lightening, white spots, and skin and hair discoloration. Therefore, studying the regulatory effects of miRNAs, which regulate genes involved in melanin formation, on the MITF gene is of great significance. Summary of the Invention

[0004] The purpose of the present invention is to provide a miRNA that regulates the body color of leopard gill bass.

[0005] The present invention also aims to provide a kit for detecting the miRNA and the use of the kit in preparing a miRNA product for detecting the miRNA that regulates the body color of the leopard gill bass.

[0006] The third object of the present invention is to provide an inhibitor of leopard gill bass miRNA and the use of the inhibitor in preparing products for regulating the leopard gill bass MITF gene, regulating the leopard gill bass skin melanin formation-related genes TYR, TYRP1 and TYRP2, regulating leopard gill bass melanin or regulating leopard gill bass body color.

[0007] The above-mentioned first object of the present invention can be achieved by the following technical solution: a miRNA that regulates the body color of leopard gill bass, the miRNA is pl-miR-192, and the nucleotide sequence of the pl-miR-192 is shown in SEQ ID NO: 1.

[0008] The pl-miR-192 described in the present invention is a key regulatory miRNA in the melanin synthesis pathway of the leopard gill bass.

[0009] Furthermore, the target gene of the pl-miR-192 is the MITF gene, and the pl-miR-192 acts on the 3'UTR region of the target gene MITF.

[0010] The nucleotide sequence of the MITF gene is shown in SEQ ID NO: 2, and the nucleotide sequence of the 3'UTR of the MITF gene is shown in SEQ ID NO. 3.

[0011] The above-mentioned second object of the present invention can be achieved by the following technical solution: a kit for detecting the miRNA, the kit comprising miRNA-192 qPCR quantitative detection primers miRNA-192-F, miRNA-192-R and reverse transcription primer miRNA-192-RT, the nucleotide sequence of the miRNA-192-F is shown in SEQ ID NO: 4, the nucleotide sequence of the miRNA-192-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the reverse transcription primer miRNA-192-RT is shown in SEQ ID NO: 6.

[0012] Furthermore, the kit also includes qPCR quantitative detection primers miRNA-23-F, miRNA-23-R and reverse transcription primer miRNA-23-RT of the internal reference gene miRNA-23 and conventional qPCR reagents, the nucleotide sequence of the miRNA-23-F is shown in SEQ ID NO: 7, the nucleotide sequence of the miRNA-23-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the miRNA-23-RT is shown in SEQ ID NO: 8.

[0013] The present invention also provides the use of the kit in preparing and detecting the miRNA product for regulating the body color of the leopard gill bass.

[0014] The third object of the present invention can be achieved by the following technical solution: an inhibitor of leopard gill bass miRNA, wherein the inhibitor is obtained by adding chemical modification to the nucleotide sequence of the miRNA.

[0015] Furthermore, the inhibitor of regulating the leopard gill bass miRNA of the present invention is synthesized by chemical modification of the pl-miRNA-192 sequence by adding 2'-O-methyl, phosphorothioate and / or 3'cholesteryl modifications.

[0016] The present invention also provides the use of the leopard gill bass miRNA inhibitor in preparing products for regulating the leopard gill bass MITF gene or regulating the leopard gill bass skin melanin formation-related genes TYR, TYRP1 and TYRP2.

[0017] The present invention also provides the use of the leopard gill bass miRNA inhibitor in preparing a leopard gill bass melanin regulation product.

[0018] Furthermore, the present invention also provides the use of the inhibitor of the leopard gill bass miRNA in preparing a leopard gill bass body color regulation product.

[0019] The present invention also provides a method for regulating the body color of the leopard gill perch, comprising the following steps: synthesizing the corresponding inhibitor of pl-miR-192 into the leopard gill perch, thereby regulating the body color of the leopard gill perch.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] (1) The present invention discloses for the first time a miRNA (pl-miR-192) that regulates the body color of the leopard gill bass, which can target and bind to the MITF gene of the leopard gill bass;

[0022] (2) The miRNA inhibitor of the leopard gill perch disclosed in the present invention significantly increases the expression of the MITF gene by inhibiting the expression of pl-miR-192, thereby promoting the formation of melanin and ultimately regulating the body color formation process of the leopard gill perch. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression pattern of pl-miR-192 in the skin tissue of red and black leopard gill bass in Example 1 of the present invention;

[0024] Figure 2 Figure 2 shows the detection of the targeting relationship between pl-miR-192 and MITF in Example 2 of the present invention, where Figure A shows the prediction of the targeting site and Figure B shows the verification of the targeting relationship.

[0025] Figure 3Figure 3 shows the changes in the expression levels of pl-miR-192 and its target gene MITF after injection of the antagomir in Example 3 of the present invention, wherein Figure A shows the relative expression level of pl-miR-192; Figure B shows the relative expression level of MITF;

[0026] Figure 4 Figure 4 shows the expression of genes related to skin melanin formation after the injection of the inhibitor of pl-miR-192 in Example 4 of the present invention, where Figure A shows the relative expression of the melanin-related gene TYR; Figure B shows the relative expression of the melanin-related gene TYRP1; and Figure C shows the relative expression of the melanin-related gene TYRP2. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0028] Example 1

[0029] Acquisition of miRNAs regulating the body color of leopard gill bass:

[0030] 1) Small RNA sequencing was performed on six black and six red leopard gill bass. Raw reads were filtered to obtain clean reads, which were then aligned and annotated with the Rfam database, cDNA sequences, species repeat sequence library, and miRBase database. Known microRNAs were counted and new microRNAs were predicted. Differential expression analysis of microRNAs was performed, and target genes of differentially expressed miRNAs were enriched in Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). Finally, correlation matching was performed with red and black individual samples to screen microRNAs that were indicative of both samples as candidate microRNA biomarkers.

[0031] 2) Candidate tag microRNAs were filtered according to the following five criteria: (1) there was a significant difference in expression between the red group and the black group, i.e., the P value was less than 0.05; (2) the presence of microRNAs was confirmed by comparison with a known database; (3) at least one of the two samples had a TPM value greater than 0; (4) the foldChange value was greater than 2, where the foldChange value = TPM Sample_Red . / TPM Sample_black ; (5) Eleven microRNAs, including pl-miR-192, were randomly selected from the microRNAs screened by the above four criteria.

[0032] 3) Extract two groups of validation samples: Extract total RNA from the skin of black and red fish, and use a microRNA quantitative analysis kit to quantitatively detect the differential expression of the microRNAs filtered in step 2), and screen out the miRNAs with the most tag-indicative effect as the final tag microRNAs; according to the principle of statistical analysis, a P value less than 0.05 is considered a significant difference, and finally pl-miR-192 was screened out, whose sequence is CTGACCTATGAATTGACAGCC (as shown in SEQ ID NO: 1). This tag is expressed at a higher level in red fish samples and at a lower level in black fish samples (as shown in SEQ ID NO: 2). Figure 1 Based on the results of microRNA quantitative analysis, red and black body colors were determined.

[0033] The target gene of pl-miR-192 is MITF gene, and pl-miR-192 acts on the 3ˋUTR region of the target gene MITF.

[0034] The nucleotide sequence of the MITF gene is shown in SEQ ID NO: 2, and the nucleotide sequence of the 3'UTR of the MITF gene is shown in SEQ ID NO. 3.

[0035] The microRNA quantitative analysis kit includes:

[0036] The qPCR quantitative detection primers for miRNA-192 include miRNA-192-F, miRNA-192-R, and reverse transcription primer miRNA-192-RT. The nucleotide sequence of miRNA-192-F is shown in SEQ ID NO: 4, the nucleotide sequence of miRNA-192-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the reverse transcription primer miRNA-192-RT is shown in SEQ ID NO: 6.

[0037] As well as qPCR quantitative detection primers miRNA-23-F, miRNA-23-R and reverse transcription primer miRNA-23-RT of the internal reference gene miRNA-23 and conventional qPCR reagents, the nucleotide sequence of the miRNA-23-F is shown in SEQ ID NO: 7, the nucleotide sequence of the miRNA-23-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the miRNA-23-RT is shown in SEQ ID NO: 8.

[0038] Example 2

[0039] By combining the prediction results of miRanda, RNAhybrid and TargetScan, we preliminarily determined the target gene MITF of pl-miR-192 and the target binding site between them ( Figure 2 (Figure A in the middle).

[0040] This example also provides a dual-luciferase reporter gene recombinant expression vector of the MITF gene of the leopard gill bass, comprising a dual-luciferase reporter gene vector and a nucleotide sequence (as shown in SEQ ID NO.3) of the 3'UTR region of the MITF gene (as shown in SEQ ID NO.2).

[0041] In this example, the pmir-GLO vector was used to construct a dual-luciferase reporter vector.

[0042] In this example, the 3'UTR region of the MITF gene was successfully cloned and inserted into the pmir-GLO dual-luciferase reporter gene vector by homologous recombination to construct a MITF gene dual-luciferase reporter gene recombinant expression vector.

[0043] Dual luciferase reporter experiments were performed: HEK293T cells were used for transfection and cultured in a cell culture incubator at 37°C and 5% CO2 using DMEM medium containing 10% FBS and 1% dual antibody. After culture in 24-well plates until the cell adherence reached 70% to 80%, transfection was performed according to the instructions of the lip2000 transfection reagent.

[0044] In this example, four transfection groups were set up:

[0045] (1) Co-transfection of MITF gene dual luciferase reporter gene recombinant expression vector (synthesized MITF gene WT sequence, as shown in SEQ ID NO. 9, constructed into the pmirGLO vector) and synthetic pl-miR-192 mimics (pl-miR-192-mimics+MITF-WT, synthesized by the company);

[0046] (2) Co-transfection of MITF gene mutant (synthetic MITF gene MT sequence, as shown in SEQ ID NO. 10), constructing this sequence into the pmirGLO vector (synthesized by the company) dual luciferase reporter gene recombinant expression vector and pl-miR-192 mimics (pl-miR-192-mimics+MITF-MT);

[0047] (3) Co-transfection of MITF gene dual-luciferase reporter gene recombinant expression vector and miR-NC (NC-mimics+MITF-WT);

[0048] (4) Co-transfection of MITF gene mutant dual luciferase reporter gene recombinant expression vector and miR-NC (NC-mimics+MITF-MT).

[0049] After transfection into HEK-293T cells, continue to culture in a cell culture incubator, replace the cell culture medium 6 to 8 hours after transfection, and measure the luciferase activity 48 hours later.

[0050] Using the Dual-Luciferase Reporter Gene Assay Kit, aspirate the remaining culture medium from the culture wells, lyse the cells and centrifuge according to the manufacturer's instructions, and use the supernatant to measure luciferase activity. Record the measured values ​​and perform statistical analysis using SPSS (v25.0) software.

[0051] The results of the dual luciferase assay after 293T cells were co-transfected with the target gene MITF recombinant vector for 48 hours are shown in Figure 2. Figure 2 As shown in Figure B, the pl-miR-192 mimic can significantly reduce the activity of luciferase in the MITF gene dual-luciferase reporter gene recombinant expression vector, indicating that pl-miR-192 can target and bind to the MITF gene of leopard gill bass.

[0052] Example 3

[0053] This example provides an inhibitor that can inhibit the expression of pl-miR-192.

[0054] The synthesis of pl-miR-192 inhibitors was achieved by chemically modifying the pl-miR-192 sequence by adding 2ˋ-O-methyl, phosphorothioate, and 3'cholesteryl modifications.

[0055] 1. Injection experiment of leopard gill bass

[0056] Select about 60 healthy leopard gill bass with uniform body color.

[0057] This embodiment sets three groups:

[0058] (1) Control group injected with DEPC water;

[0059] (2) control group injected with NC-antagomir at a concentration of 200 ng / μL;

[0060] (3) Experimental group injected with pl-miR-192 antagomir at a concentration of 200 ng / μL.

[0061] The injection volume was 100 μL. Samples were collected 7 days after the injection experiment, and the expression level of pl-miR-192 was detected (using the microRNA quantitative analysis kit in Example 1).

[0062] The results are as follows Figure 3 As shown in Figure 2, the inhibitor of pl-miR-192 can significantly inhibit the expression of pl-miR-192 ( Figure 3 Figure A), and significantly increased the expression of the target gene MITF ( Figure 3 Middle panel B), the negative correlation between the expression patterns of pl-miR-192 and the target gene MITF after injection of the pl-miR-192 inhibitor, indicating that pl-miR-192 in Leopard sea bass can regulate the expression of the target gene MITF.

[0063] Injection of a pl-miR-192 inhibitor upregulated the expression of the transcription factor MITF, further boosting the expression of genes involved in skin melanin formation. This resulted in leopard gill bass with a predominantly black color. Therefore, by promoting or inhibiting pl-miR-192 expression, this could provide a reference for screening individuals with red and black leopard gill bass.

[0064] Example 4

[0065] Based on Example 3, the expression changes of skin melanin formation-related genes TYR, TYRP1 and TYRP2 were detected after pl-miR-192 was inhibited.

[0066] The specific implementation plan is as follows:

[0067] For the three groups of leopard gill bass in Example 3, the expression levels of skin tissues of the DEPC group, NC-antagomir group and pl-miR-192antagomir group were detected, that is, the key gene for melanin formation, TYR ( Figure 4 Figure A), TYRP1 ( Figure 4 Middle B) and TYRP2 ( Figure 4 Expression of C).

[0068] After injecting the pl-miR-192 inhibitor, the expression levels of skin melanin formation-related genes TYR, TYRP1 and TYRP2 increased. Therefore, by injecting the pl-miR-192 inhibitor, the melanin content in leopard gill bass can be regulated, and then the body color change of leopard gill bass can be regulated. By injecting the pl-miR-192 inhibitor, the expression levels of melanin formation-related genes TYR, TYRP1 and TYRP2 in leopard gill bass are increased, and leopard gill bass with black as the dominant color can be obtained.

[0069] The above embodiments are merely examples to illustrate the technical solutions of the present invention and are not intended to be limitative descriptions of the invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A miRNA that regulates the body color of leopard gill bass, characterized in that: The miRNA is pl-miR-192, and the nucleotide sequence of the pl-miR-192 is shown in SEQ ID NO:

1.

2. The miRNA according to claim 1, wherein The target gene of the pl-miR-192 is the MITF gene, and the pl-miR-192 acts on the 3'UTR region of the target gene MITF.

3. A kit for detecting the miRNA according to claim 1, characterized in that: The kit includes miRNA-192 qPCR quantitative detection primers miRNA-192-F, miRNA-192-R and reverse transcription primer miRNA-192-RT, the nucleotide sequence of miRNA-192-F is shown in SEQ ID NO: 4, the nucleotide sequence of miRNA-192-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the reverse transcription primer miRNA-192-RT is shown in SEQ ID NO:

6.

4. The kit according to claim 3, wherein The kit also includes qPCR quantitative detection primers miRNA-23-F, miRNA-23-R and reverse transcription primer miRNA-23-RT of the internal reference gene miRNA-23, as well as conventional qPCR reagents. The nucleotide sequence of the miRNA-23-F is shown in SEQ ID NO: 7, the nucleotide sequence of the miRNA-23-R is shown in SEQ ID NO: 5, and the nucleotide sequence of the miRNA-23-RT is shown in SEQ ID NO:

8.

5. Use of the kit according to claim 3 or 4 in preparing and detecting the miRNA product for regulating the body color of the leopard gill bass according to claim 1.

6. An inhibitor of leopard gill bass miRNA, characterized in that The inhibitor is obtained by adding chemical modification to the nucleotide sequence of the miRNA according to claim 1.

7. Use of the inhibitor of leopard gill perch miRNA according to claim 6 in preparing products for regulating the leopard gill perch MITF gene or the leopard gill perch skin melanin formation-related genes TYR, TYRP1 and TYRP2.

8. Use of the inhibitor of leopard gill perch miRNA according to claim 6 in preparing a product for regulating leopard gill perch melanin.

9. Use of the inhibitor of the leopard gill perch miRNA according to claim 6 in preparing a product for regulating the body color of the leopard gill perch.

10. A method for regulating the body color of leopard gill bass, characterized in that: The method comprises the following steps: introducing the miRNA synthesis corresponding inhibitor according to claim 1 into the body of the leopard gill bass to regulate the body color of the leopard gill bass.

Images