Application of circFARSA as diagnostic marker in preparation of early pregnancy loss diagnostic kit

By detecting the expression level of circFARSA in chorionic villus tissue, a diagnostic kit for early pregnancy loss was prepared, which solved the problem of lack of understanding of the mechanism of action of circRNA in existing technologies and achieved accurate diagnosis of early pregnancy loss and development of potential treatment strategies.

CN120624635AActive Publication Date: 2025-09-12AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510854658.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-25
Publication Date
2025-09-12
Estimated Expiration
2045-06-25

AI Technical Summary

Technical Problem

The existing technology lacks in-depth research on the mechanism of action of circRNA in early pregnancy loss, resulting in a lack of effective diagnostic and treatment methods.

Method used

circFARSA was used as a diagnostic marker, and the expression level of circFARSA in chorionic villus tissue was detected by fluorescence quantitative PCR to prepare a diagnostic kit for early pregnancy loss.

Benefits of technology

Accurate diagnosis of early pregnancy loss was achieved, and circFARSA was found to play a protective role in early pregnancy loss by regulating the cell apoptosis process, laying the foundation for a deeper understanding of the pathogenesis and clinical diagnosis and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624635A_ABST
    Figure CN120624635A_ABST
Patent Text Reader

Abstract

The invention provides application of circFARSA as a diagnostic marker in preparation of a diagnostic kit for early pregnancy loss, and relates to the technical field of biological diagnosis targets, experiments prove that the expression level of circFARSA in villus tissue of a patient with early pregnancy loss is remarkably changed, and circFARSA can be used as a novel clinical diagnostic marker for early pregnancy loss. According to the application, a specific verification experiment finds that the occurrence of early pregnancy loss can be effectively judged by detecting the expression level of circFARSA in a tissue sample of a subject. The application also finds that circFARSA can play a protection role in early pregnancy loss by regulating and controlling the cell apoptosis process. The discovery not only provides important clues for deeply understanding the pathogenesis of early pregnancy loss, but also lays a theoretical foundation for the development of clinical diagnosis and treatment strategies, and has important scientific research value and clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological diagnostic targets, and in particular to the use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss. Background Art

[0002] Early pregnancy loss, defined as the spontaneous loss of an embryo or fetus before 12 weeks of gestation, is a common complication of early pregnancy. The pathogenesis of early pregnancy loss is complex, involving multiple factors, including chromosomal abnormalities, genetic factors, reproductive tract malformations, infection, immune dysfunction, endocrine abnormalities, environmental factors, and psychological factors. However, the specific pathogenic mechanisms remain incompletely elucidated. Current studies have shown that many genes are significantly differentially expressed in chorionic villus tissue from early pregnancy loss. These genes may affect cell function and survival through signaling pathways such as apoptosis and oxidative stress, thereby affecting the maintenance of pregnancy.

[0003] Circular RNA (circRNA) is a special type of RNA molecule with a closed circular structure and high stability. Recent studies have found that circRNA plays an important role in various physiological and pathological processes, such as regulating gene expression and affecting cell apoptosis. In early pregnancy, circRNA may participate in the development and function of the placenta through multiple pathways, such as by interacting with other proteins or RNA molecules to form a complex regulatory network to affect the development and function of the placenta. In-depth research on the mechanism of action of circRNA in early pregnancy loss will help to reveal its pathogenesis and provide new biomarkers and therapeutic targets for the diagnosis and treatment of early pregnancy loss, thereby improving pregnancy outcomes and enhancing the reproductive health of women of childbearing age. Summary of the Invention

[0004] The purpose of the present invention is to solve the problem in the prior art of the lack of corresponding research on the mechanism of action of circRNA in early pregnancy loss.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: Application of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss.

[0006] Preferably, by detecting changes in the expression level of circFARSA, an objective basis can be provided for the diagnosis of early pregnancy loss.

[0007] Preferably, the kit uses fluorescent quantitative PCR analysis to detect the expression level of circFARSA in the sample tissue of the subject.

[0008] Preferably, the sample tissue is villus tissue.

[0009] Preferably, the sequence information of circFARSA is: The sequence of circFARSA is shown in SEQ ID: NO 01; Preferably, the primer information of circFARSA is: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

[0010] This application also provides a diagnostic kit for diagnosing early pregnancy loss, wherein the diagnostic kit uses circFARSA as a diagnostic target. Preferably, the diagnostic kit is a diagnostic kit that uses fluorescent quantitative PCR detection.

[0011] Compared with the prior art, this application has the following beneficial effects: The present invention experimentally confirms that the expression level of circFARSA in the villus tissue of patients with early pregnancy loss undergoes significant changes, and circFARSA can be used as a new clinical diagnostic marker for early pregnancy loss. Through specific verification experiments, the present application discovered that by detecting the expression level of circFARSA in the tissue samples of the subjects, the occurrence of early pregnancy loss can be effectively judged. More importantly, the present application found that circFARSA can play a protective role in early pregnancy loss by regulating the cell apoptosis process. These findings not only provide important clues for a deeper understanding of the pathogenesis of early pregnancy loss, but also lay a theoretical foundation for the development of clinical diagnosis and treatment strategies, and have important scientific research value and clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Figure 3. Expression pattern of circFARSA in early pregnancy loss. Figure A shows the expression level of circFARSA in chorionic villus tissue from patients with early pregnancy loss and normal villi (Student's t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, N = 46, with 23 samples in the control and experimental groups). Figure B shows the expression pattern of circFARSA in HTR-8 / SVneo cells.

[0013] Figure 2Figure 3. Effects of circFARSA knockdown on cell proliferation and apoptosis in HTR-8 / SVneo cells. (A) Verification of circRNA interference efficiency (Student's t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001); (B) CCK8 cell proliferation assay; (C) Tunel staining of HTR-8 / SVneo cells; (D) Percentage of Tunel-positive cells; (E) Cleaved Caspase-3 staining of HTR-8 / SVneo cells; (F) Percentage of Cleaved Caspase-3-positive cells.

[0014] Figure 3 Effects of circFARSA overexpression on cell proliferation and apoptosis in HTR-8 / SVneo cells. (A) Verification of circRNA overexpression efficiency (Student's t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001); (B) CCK8 cell proliferation assay; (C) Tunel staining of HTR-8 / SVneo cells; (D) Percentage of Tunel-positive cells; (E) Cleaved Caspase-3 staining of HTR-8 / SVneo cells; (F) Percentage of Cleaved Caspase-3-positive cells. DETAILED DESCRIPTION

[0015] The present invention is further described in detail below with reference to specific embodiments.

[0016] This application provides the use of circFARSA as a diagnostic marker in the preparation of an early pregnancy loss diagnostic kit. By detecting changes in the expression level of circFARSA, an objective basis can be provided for the diagnosis of early pregnancy loss.

[0017] In one embodiment, the kit uses fluorescent quantitative PCR analysis to detect the expression level of circFARSA in a sample tissue of a subject, wherein the sample tissue is villus tissue.

[0018] The primer information of circFARSA is as follows: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

[0019] The above contents are described below in conjunction with specific implementation methods: Experimental materials and sources: serial number Experimental Materials source 1 <![CDATA[Purelink TM RNA Mini Kit]]> Invitrogen 2 PrimeScript™ 1st Strand cDNA Synthesis Kit TAKARA 3 TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) TAKARA 4 FISH probes Jima Gene 5 FISH kits Jima Gene 6 siRNA Jima Gene 7 plasmids Jin Weizhi 8 Cell Counting Kit-8 New Saimei 9 One-step TUNEL cell apoptosis detection kit Blue Sky 10 Cleaved Caspase3 CST 11 Alexa Fluor® 647 AffiniPure™ Goat Anti-rabbit IgG (H+L) Jackson ImmunoResearch Laboratories

[0020] Example 1 Expression pattern of circFARSA in early pregnancy loss The expression pattern of circFARSA in chorionic villus tissue was observed in the control group (induced abortion group) and the experimental group (early pregnancy loss group). Fluorescence quantitative PCR and RNA in situ hybridization were used to investigate the expression pattern of circFARSA in chorionic villus tissue / cells.

[0021] (1) Specimen collection: Patients with missed abortion were selected as the experimental group (early pregnancy loss group), and patients with normal pregnancy who were admitted during the same period and intended to terminate their pregnancy were selected as the control group (artificial abortion group). The selected pregnant women had no evidence of recent infection, no chromosomal abnormalities, no immune diseases, and no treatment for pregnancy preservation. Chorionic villi were collected from the two groups of patients after uterine curettage and the blood was rinsed with normal saline. The chorionic villi were placed in a cryovial and placed in a -80℃ freezer within half an hour for future experiments such as fluorescent quantitative PCR. (2) Fluorescence quantitative PCR Total RNA was extracted from chorionic villus tissue and reverse transcribed into cDNA using a reverse transcription kit, followed by amplification using a fluorescent quantitative PCR kit. The relative expression level of circFARSA was calculated using the CT value. Fluorescent quantitative PCR results showed that the expression level of circFARSA was downregulated in chorionic villus tissue of early pregnancy loss ( Figure 1 A).

[0022] (3) Cell culture Human trophoblast HTR-8 / SVneo cells were cultured in DMEM / F12 + 10% FBS + 1% P / S medium as complete culture medium in a 37°C, 5% CO2 cell culture incubator.

[0023] (4) RNA in situ hybridization staining Cells were seeded in 12-well plates and cultured overnight in a 37°C 5% CO2 incubator. After washing twice with PBS, 1 mL of 4% paraformaldehyde was added to each well and fixed at room temperature for 15 minutes. The 4% paraformaldehyde was discarded, and RNA in situ hybridization staining was performed. The staining method mainly includes blocking, probe incubation and washing, nuclear staining, and sealing. Finally, the slides were observed and photographed under a fluorescence microscope. The results showed that circFARSA was expressed in both the nucleus and cytoplasm ( Figure 1 B).

[0024] Example 2 Functional Analysis of circFARSA in an Early Pregnancy Loss Model

[0025] (1) Cell culture Human trophoblast HTR-8 / SVneo cells were cultured in DMEM / F12 + 10% FBS + 1% P / S medium as complete culture medium in a 37°C, 5% CO2 cell culture incubator.

[0026] (2) CCK-8 detection of cell proliferation Cells in the logarithmic growth phase were seeded into 6-well plates at a density of 1×10^5 cells per well. 2 mL of complete culture medium was added to each well and the cells were cultured at 37°C in a 5% CO2 incubator. After 24 hours of transfection, the cells were cultured for an additional 6-8 hours. The cells were then digested with 0.25% EDTA-free trypsin, harvested, and seeded into 96-well plates at a density of 2000 cells per well. After the cells adhered, 10 μL of CCK-8 solution was added to each well, and the plate was gently shaken to ensure uniform mixing. After incubation for 2 hours, the absorbance (OD) of each well was measured at 450 nm using a microplate reader. Cell growth curves were constructed based on the OD values ​​at different time points.

[0027] (3) TUNEL detection of cell apoptosis Cells in logarithmically growing phase were seeded into 24-well plates and cultured in a 37°C, 5% CO2 incubator. After 24 hours of cell growth, pre-treat the cells and continue incubation for 48 hours. Fix with 4% PFA for half an hour, wash with PBS, and treat with 0.3% Triton X-100 for 5-10 minutes. Wash twice with PBS, add Tunel detection solution, and incubate at 37°C in the dark for 60 minutes. Minimize evaporation of Tunel detection solution. Wash three times with PBS, proceed with DNA staining, mounting, and observation under a fluorescence microscope.

[0028] (4) Immunofluorescence staining After 24 hours of cell growth, cells were pretreated and cultured for an additional 48 hours. The cells were then fixed with 4% PFA for half an hour, washed with PBS, and treated with 0.3% Triton X-100 for 5-10 minutes. After blocking, the cells were incubated with primary antibodies overnight at 4°C and washed three times with PBS. Following incubation with secondary antibodies and PBS washes, DNA staining, and mounting, the cells were stored in a dark box. Fluorescence signals of the target proteins were observed and recorded using a fluorescence microscope.

[0029] To further investigate the role of circFARSA in HTR-8 / SVneo, siRNA transfection was used to silence circFARSA expression, and qRT-PCR was used to verify the interference efficiency ( Figure 2 A). CCK8 results showed that downregulation of circFARSA could significantly inhibit cell proliferation ( Figure 2 B). Tunel staining showed that downregulating the expression level of circFARSA could increase the ratio of Tunel-positive cells ( Figure 2CD). Immunofluorescence results showed that downregulating the expression level of circFARSA could increase the ratio of Cleaved Caspase-3 positive cells ( Figure 2 EF). These results suggest that circFARSA regulates cell proliferation and apoptosis.

[0030] At the same time, circFARSA was overexpressed by plasmid transfection, and the overexpression efficiency was verified by qRT-PCR technology ( Figure 3 A). CCK8 results showed that upregulating circFARSA could significantly promote cell proliferation ( Figure 3 B). Tunel staining results also showed that upregulating the expression level of circFARSA could reduce the ratio of Tunel-positive cells ( Figure 3 CD). Immunofluorescence results showed that upregulating the expression level of circFARSA could reduce the ratio of Cleaved Caspase-3 positive cells ( Figure 3 EF). These results further suggest that circFARSA regulates cell proliferation and apoptosis.

[0031] In summary, this application experimentally verified that the expression level of circFARSA in the chorionic tissue of patients with early pregnancy loss was significantly changed, and circFARSA can be used as a new clinical diagnostic marker for early pregnancy loss. The study also found that by detecting the expression level of circFARSA in the tissue samples of the subjects, the occurrence of early pregnancy loss can be effectively judged. More importantly, this application found that circFARSA can play a protective role in early pregnancy loss by regulating the cell apoptosis process. These findings not only provide important clues for a deeper understanding of the pathogenesis of early pregnancy loss, but also lay a theoretical foundation for the development of clinical diagnosis and treatment strategies, and have important scientific research value and clinical application prospects.

Claims

1. Application of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss.

2. Use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss according to claim 1, characterized in that: By detecting changes in circFARSA expression levels, it can provide an objective basis for the diagnosis of early pregnancy loss.

3. Use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss according to claim 2, characterized in that: The kit uses fluorescent quantitative PCR analysis to detect the expression level of circFARSA in the sample tissue of the subject.

4. Use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss according to claim 3, characterized in that: The sample tissue is villus tissue.

5. Use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss according to claim 4, characterized in that: The sequence of circFARSA is shown in SEQ ID: NO 01; The primer information of circFARSA is as follows: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

6. A diagnostic kit, characterized in that: The diagnostic kit is used for diagnosing early pregnancy loss, and the diagnostic kit uses circFARSA as a diagnostic target.

7. A diagnostic kit according to claim 6, characterized in that: The diagnostic kit is a diagnostic kit that uses fluorescent quantitative PCR detection.

Citation Information

Patent Citations

  • Method for detecting circular plasma RNA marker related to non-small cell lung cancer

    CN107815495A

  • Marker and intervention medicine for repeated pregnancy loss early prediction and diagnosis kit

    CN118326034A

  • Genetic signature of lung cancer

    WO2025078639A1