Nucleic acid composition, kit and detection method for detecting EZH2 gene mutation

Abstract

The invention belongs to the technical field of biology, and relates to a nucleic acid composition for detecting EZH2 gene mutation, a kit and a detection method.The nucleic acid composition comprises a forward primer, a reverse primer, a probe and a closing primer, the binding position of the probe and an EZH2 gene covers the target mutation site of the EZH2 gene, and the closing primer is used for closing the target mutation site of the EZH2 gene. The 5'end of the closed primer and the 3 'end of the forward primer have an overlapped part. The nucleic acid composition disclosed by the invention is used for detecting hot spot mutation of the EZH2 gene, including seven mutation sites of Y646N, Y646F, Y646C, Y646S, Y646H, A682G and A692V, the mutation sites can be subjected to typing, the mutation information of each site can be accurately analyzed only through two-tube reaction, and the sensitivity can reach 0.5%. The detection requirements of a part of more complex clinical samples can be met.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid composition, a kit and a detection method for detecting EZH2 gene mutations. Background Art

[0002] Follicular lymphoma (FL) is an indolent subtype of NHL, accounting for approximately 35% of all B-cell lymphomas. Several gene mutations in B cells, including mutations in the polycomb repressive complex 2 (PRC2) gene, can alter gene expression profiles and promote neoplastic transformation.

[0003] EZH2 and its highly related homolog EZH1 are considered epigenetic silencing factors. As core components of PRC2, they play critical roles in cell growth and differentiation. Somatic mutations in EZH2 can cause epigenetic and transcriptional modifications, making it a popular target for drug development. Several drugs, such as Constellation Pharmaceuticals' CPI-0209 and CPI-1205, have entered clinical trials.

[0004] The most common mutation in FL is the Y646 amino acid mutation in the EZH2 gene, followed by mutations at amino acids A682 and A692. A682 and A692 mutations occur in up to 25% of FL patients. Detecting EZH2 gene mutations through molecular biological methods, such as quantitative PCR (qPCR), can identify patients who may benefit from EZH2 inhibitors such as tazestat, thereby improving the drug's clinical value.

[0005] Methods for detecting EZH2 gene mutations include the Sanger assay and qPCR. While the Sanger assay is relatively inexpensive, it suffers from lengthy procedures and low sensitivity, making it unsuitable for companion diagnostics for EZH2 inhibitors. qPCR assays for EZH2 include the commercially available Roche cabas EZH2 Mutation Test, which detects amino acid mutations at Y646, A682, and A692 and can be used as a companion diagnostic for FL. However, several limitations remain, the most significant of which is the inability to genotype the mutation site, meaning it is impossible to confirm the specific mutation type.

[0006] Some related technologies are also disclosed in the prior art, such as the method and composition for detecting mutations in the human EZH2 gene disclosed in CN105593378A, and a PCR method and application for amplifying and detecting low-level gene mutations disclosed in CN109136345A. However, the probes disclosed therein are also unable to accurately type the mutation sites. Summary of the Invention

[0007] The present invention provides a nucleic acid composition, a kit, and a detection method for detecting EZH2 gene mutations. By optimizing the position and sequence of the probe, as well as the position and sequence of the blocking primer, not only can accurate typing of the mutation site be achieved, but also excellent detection sensitivity can be achieved.

[0008] The present invention adopts the following technical solutions: In a first aspect of the present invention, a nucleic acid composition for detecting EZH2 gene mutations is provided, comprising a forward primer, a reverse primer, a probe, and a blocking primer, wherein the binding position of the probe to the EZH2 gene covers the target mutation site of the EZH2 gene, and the 5' end of the blocking primer has an overlapping portion with the 3' end of the forward primer.

[0009] In the art, probes are typically designed to be positioned in the middle of the amplified sequence, away from the binding sites of the forward and reverse primers, and not overlapping the mutation site. This is because the probe's fluorescent reporter group only emits a detectable fluorescent signal after the probe is cleaved by a DNA polymerase (usually the thermostable Taq DNA polymerase). To ensure efficient cleavage, the probe should be located within the amplified fragment, allowing the polymerase to encounter and cleave the probe during extension. Therefore, it is generally believed that if the probe is too close to the 5' or 3' end of the amplified product, its cleavage efficiency may be affected. Especially when positioned close to the forward and reverse primers, the probe may be affected by incompletely annealed primers or other secondary structures, thereby reducing the likelihood of probe cleavage. This, in turn, affects the generation of the fluorescent signal.

[0010] In the above scheme of the present invention, first, the position of the probe is changed, and the probe is designed to cover the target mutation site of the EZH2 gene, so that the specific mutant base can be detected, thereby accurately typing the mutation site.

[0011] On this basis, the 5' end of the blocking primer is further designed to have an overlapping portion with the 3' end of the forward primer, so that higher sensitivity can be achieved in coordination with the probe position.

[0012] Preferably, the target mutation site is selected from any one mutation site of Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V, or a combination of at least two mutation sites, wherein the probe sequence corresponding to Y646N is shown in SEQ ID NO: 1; the probe sequence corresponding to Y646F is shown in SEQ ID NO: 2; the probe sequence corresponding to Y646C is shown in SEQ ID NO: 3; the probe sequence corresponding to Y646S is shown in SEQ ID NO: 4; the probe sequence corresponding to Y646H is shown in SEQ ID NO: 5; the probe sequence corresponding to A682G is shown in SEQ ID NO: 6; and the probe sequence corresponding to A692V is shown in SEQ ID NO: 7.

[0013] Preferably, the Tm value of the probe corresponding to each mutation site is 3°C to 5°C higher than the Tm value of the forward primer and the Tm value of the reverse primer corresponding to the mutation site. For example, the Tm value of the probe corresponding to mutation site Y646N is 3°C to 5°C higher than the Tm value of the forward primer and the Tm value of the reverse primer corresponding to Y646N.

[0014] Preferably, the Tm value of each blocking primer is 5° C. to 10° C. higher than the Tm value of the corresponding forward primer. For example, the Tm value of the blocking primer corresponding to Y646N is 5° C. to 10° C. higher than the Tm value of the forward primer corresponding to Y646N.

[0015] Preferably, the blocking primers corresponding to Y646N, Y646F, Y646C, Y646S and Y646H are shown in SEQ ID NO:8.

[0016] Preferably, the blocking primer corresponding to A682G is shown in SEQ ID NO:9.

[0017] Preferably, the blocking primer corresponding to A692V is shown in SEQ ID NO: 10.

[0018] Preferably, the 5' end of the blocking primer overlaps with the 3' end of the forward primer by 4 to 12 bases.

[0019] Preferably, the forward primers corresponding to Y646N, Y646F, Y646C, Y646S and Y646H are shown in SEQ ID NO: 11, and the reverse primers are shown in SEQ ID NO: 12.

[0020] Preferably, the forward primer corresponding to A682G is shown as SEQ ID NO: 13, and the reverse primer is shown as SEQ ID NO: 14.

[0021] Preferably, the forward primer corresponding to A692V is shown as SEQ ID NO: 15, and the reverse primer is shown as SEQ ID NO: 16.

[0022] In the preferred embodiment described above, targeting seven hotspot mutation sites in the EZH2 gene, including Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V, the probe sequence, the blocking primer sequence, and the relationship between the Tm values ​​of the probe and other primers ensure that three mutation sites can be detected in one tube and four sites in another, effectively detecting seven sites in two tubes without interference, resulting in high specificity. The existing Roche cabas EZH2 Mutation Test requires three tubes to complete the assay. Further optimization of the forward and reverse primer sequences has resulted in a sensitivity of 0.5%, while the Roche cabas EZH2 Mutation Test only achieves 5%.

[0023] In a second aspect, the present invention provides a kit for detecting EZH2 gene mutations, comprising the above-mentioned nucleic acid composition.

[0024] Preferably, the kit includes reagent A and / or reagent B, wherein reagent A includes forward primers, reverse primers, probes and blocking primers for simultaneously detecting target mutation sites Y646N, Y646F and A682G; and reagent B includes forward primers, reverse primers, probes and blocking primers for simultaneously detecting target mutation sites Y646C, Y646S, Y646H and A692V.

[0025] Preferably, in reagent A of the kit, the probe corresponding to Y646N is shown in SEQ ID NO: 1, the probe corresponding to Y646F is shown in SEQ ID NO: 2, and the probe corresponding to A682G is shown in SEQ ID NO: 6; the blocking primers corresponding to Y646N and Y646F are shown in SEQ ID NO: 8; the blocking primer corresponding to A682G is shown in SEQ ID NO: 9; the forward primers corresponding to Y646N and Y646F are shown in SEQ ID NO: 11, and the reverse primer is shown in SEQ ID NO: 12; the forward primer corresponding to A682G is shown in SEQ ID NO: 13, and the reverse primer is shown in SEQ ID NO: 14.

[0026] Preferably, in reagent B of the kit, the probe corresponding to Y646C is shown in SEQ ID NO: 3, the probe corresponding to Y646S is shown in SEQ ID NO: 4, the probe corresponding to Y646H is shown in SEQ ID NO: 5, and the probe corresponding to A692V is shown in SEQ ID NO: 7; the blocking primers corresponding to Y646C, Y646S, and Y646H are shown in SEQ ID NO: 8; the blocking primer corresponding to A692V is shown in SEQ ID NO: 10; the forward primers corresponding to Y646C, Y646S, and Y646H are shown in SEQ ID NO: 11, and the reverse primer is shown in SEQ ID NO: 12; the forward primer corresponding to A692V is shown in SEQ ID NO: 15, and the reverse primer is shown in SEQ ID NO: 16.

[0027] The third aspect of the present invention provides a method for detecting EZH2 gene mutation using the above-mentioned kit.

[0028] By implementing the above technical solution, the present invention has the following advantages compared to the prior art: 1. The present invention can type the mutation site and accurately determine the mutated base.

[0029] 2. The primers and probes of the present invention can realize multiple fluorescence reactions in one tube and have excellent sensitivity.

[0030] 3. This method is used to detect seven hotspot mutations in the EZH2 gene, including Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V. Only two reaction tubes are required to accurately analyze the mutation information at each site, with a sensitivity of up to 0.5%. This method can meet the testing needs of some more complex clinical samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a schematic diagram of the principle of detecting EZH2 gene mutation sites using the nucleic acid composition of the present invention.

[0032] Figure 2 This is the PCR amplification curve of 1% standard in the reaction system of tube 1 in the embodiment of the present invention.

[0033] Figure 3 This is the PCR amplification curve of 1% standard in the reaction system of tube 2 in the embodiment of the present invention. DETAILED DESCRIPTION

[0034] In order to more clearly illustrate the technical content of the present invention, it is described in detail in conjunction with specific embodiments. Obviously, the enumerated embodiments are only preferred implementation plans of the present technical solution. Other technical solutions that can be obviously derived by those skilled in the art based on the disclosed technical content still fall within the scope of protection of the present invention.

[0035] Those skilled in the art should understand that, unless otherwise stated, the primers or probes used in the following examples are synthesized by biotechnology companies according to conventional nucleotide synthesis technology, and the PCR reaction system reagents used can be purchased from reagent companies.

[0036] Example 1 This example provides a kit for detecting EZH2 gene mutations, specifically Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V mutations. The kit includes an enzyme mix (DNA polymerase, buffer, magnesium chloride, and dNTPs), a primer-probe mix in tube 1, a primer-probe mix in tube 2, a negative control, a positive control, and water.

[0037] The forward and reverse primers, probes and blocking primers involved in the kit of this embodiment are shown in Table 1 below and were synthesized by a biological company.

[0038] Table 1 Forward and reverse primers, probes and blocking primers used in this example Primer name Primer sequence (5' to 3') 5' modification 3' modification Sequence number 646 site forward primer 646-F CTGAATACAGGTTATCAGTGCC / / SEQ ID NO:11 646 site reverse primer 646-R CAGGCTGGGGGATTTTTATCA / / SEQ ID NO:12 Y646N probe 646N-p CCTCTCCACAGTTTTCTGAGATG 5'6-FAM 3'BHQ1 SEQ ID NO: 1 Y646F probe 646F-p CCTCTCCACAGAATTCTGAGATG 5'VIC 3'BHQ1 SEQ ID NO:2 Y646H probe 646H-p CCTCTCCACAGTGTTCTGAGA 5'CY5 3'BHQ2 SEQ ID NO:5 Y646S probe 646S-p CCTCTCCACAGGATTCTGAGATG 5'VIC 3'BHQ1 SEQ ID NO:4 Y646C probe 646C-p CCTCTCCACAGCATTCTGAGATG 5'6-FAM 3'BHQ1 SEQ ID NO:3 646-site blocking primer 646-blokcer GTGCCTTACCTCTCCACAGTATTCTGAGAAATTA / / SEQ ID NO:8 682 site forward primer 682-F TTTGCAAAACGAATTTTGTTACC / / SEQ ID NO:13 682 site reverse primer 682-R ATTATTCACTGGGCTGTGCTT / / SEQ ID NO:14 A682G probe 682-p TGCGGGTTCCATCCACCA 5'CY5 3'BHQ2 SEQ ID NO:6 682 site blocking primer 682-blocker ACCCTTGCGGGTTGCATCCACCAATTTT / / SEQ ID NO:9 692 site forward primer 692-F GCAACCCGCAAGGGTAAC / / SEQ ID NO:15 692 site reverse primer 692-R GGACTGAAAAGGGAGTTCCAA / / SEQ ID NO:16 A692V probe 692-p ATTCGTTTTGTAAATCATTCGGT 5'ROX 3'MGB SEQ ID NO:7 692 site blocking primer 692-blocker GGTAACAAAATTCGTTTTGCAAATCATTCGCCCTT / / SEQ ID NO: 10 Internal reference forward primer EZH2C-F TTGAACCTCCTGAGAATGTGG / / SEQ ID NO: 18 Internal reference probe EZH2C-p TGGAGTGGTGCTGAAGCCT 5'TAMRA 3'BHQ2 SEQ ID NO: 17 Internal control reverse primer EZH2C-R GTAAGTGCCAATGAGGACTCT / / SEQ ID NO: 19 The composition of tube 1 is as follows: 2× Goldstar SNP Mastermix 10 μL, upstream primer (646-F) (10 μM) 0.4 μL, downstream primer (646-R) (10 μM) 0.4 μL, probe (646N-p) (10 μM) 0.16 μL, probe (646F-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, upstream primer (682) (10 μM) 0.4 μL, downstream primer (682) (10 μM) 0.4 μL, probe (682-p) (10 μM) 0.16 μL, blocking primer (682-blocker) (100 μM) 0.4 μL, upstream primer (EZH2C-F) (10 μM) 0.2 μL, downstream primer (EZH2C-R) (10 μM) 0.2 μL, probe (EZH2C-p) (10 μM) 0.08 μL, and water was added to a total volume of 16 μL.

[0039] The composition of tube 2 is as follows: 2× Goldstar SNP Mastermix 10 μL, upstream primer (646-F) (10 μM) 0.4 μL, downstream primer (646-R) (10 μM) 0.4 μL, probe (646H-p) (10 μM) 0.16 μL, probe (646S-p) (10 μM) 0.16 μL, probe (646C-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, upstream primer (692-F) (10 μM) 0.4 μL, downstream primer (692-R) (10 μM) 0.4 μL, probe (692) (10 μM) 0.16 μL, blocking primer (692-blocker) (100 μM) 0.4 μL, upstream primer (EZH2C-F) (10 μM) 0.2 μL, downstream primer (EZH2C-R) (10 μM) 0.2 μL, probe (EZH2C-p) (10 μM) 0.08 μL, and water was added to a total volume of 16 μL.

[0040] Example 2 This example provides a method for detecting EZH2 gene mutations in clinical samples, using the kit described in Example 1. The detection method specifically includes: (1) Take 3-5 paraffin-embedded (FFPE) sections of lymphoma and extract DNA using the Qiagen Tissue FFPE DNA Kit (Cat. No. 56404).

[0041] (2) DNA purity was determined using a Thermo NanoDrop instrument; the A260 / A280 ratio should be in the range of 1.7-2.2. DNA concentration was determined using a Thermo Qubit instrument, and the sample was diluted to 12.5 ng / μL based on the determined concentration.

[0042] (3) Prepare the reaction solution according to the number of samples. Each sample is configured with two wells (tube 1 and tube 2). At the same time, both the negative and positive quality control products are configured with the reaction system of tube 1 and tube 2. (4) Add 4 μL of extracted sample DNA to each reaction system and mix well; (5) Turn on the Thermo Quantstudio 5 fluorescence PCR instrument and start PCR according to the following reaction program: 95℃ for 5 minutes, 45 cycles (95℃ for 10 seconds, 60℃ for 30 seconds read).

[0043] (5) Results analysis a) Open the data analysis software and set Baseline and Threshold to Auto; (2) Determine whether the internal reference gene in the two wells of the sample meets the Ct ≤ 28. If the internal reference gene meets the standard, the quality control is normal. Otherwise, the experiment fails and the qPCR needs to be repeated. If the internal reference gene quality control fails the second time, resampling and analysis are required.

[0044] b) Determine whether the ΔCt value of each target (site) meets the cut-off value standard and determine the EZH2 gene mutation status according to the rules shown in Table 2 below: Table 2 Rules for determining EZH2 gene mutation status ΔCt = Ct target - Ct internal reference. For example, for Y646N, first calculate the difference between the Ct value of the Y646N site and the internal reference Ct value, ΔCt. If ΔCt ≤ 10, the Y646N site is positive and the Y646N mutation has occurred. If ΔCt > 10, the Y646N site is negative and the Y646N mutation has not occurred.

[0045] Example 3 Sensitivity Verification Example of the Detection Method of Example 2 Cell lines containing Y646N, Y646F, Y646H, Y646S, Y646C, A682G, and A692V mutations were purchased, DNA was extracted and diluted to the same concentration, then mixed in equal proportions and spiked into healthy human genomic DNA (Human Genome DNA, HGD) at ratios of 0.5%, 1%, 2%, and 5%, and a series of sensitivity gradient standards were prepared.

[0046] According to the operating steps of Example 2, sensitive samples and negative samples were detected (Table 3 below, the gradient was set according to the performance of each tube).

[0047] Table 3 Sensitivity test samples and negative samples Software analysis of the off-machine data revealed that the Ct values, internal reference Ct values, and ΔCt values ​​for the EZH2 target (site) for each sample in tube 1 are shown in Table 4 below. Combined with the cut-off values ​​(ΔCt ≤ 10 for Y646N, ΔCt ≤ 9 for Y646F, and ΔCt ≤ 7 for A682G) for positive / negative determination, the minimum detection limits for tube 1 were 0.5% for the FAM target (Y646N site), 0.5% for the VIC target (Y646F site), and 0.5% for the CY5 target (A682G site). This means that the detection limits for tube 1 were all 0.5%.

[0048] Table 4 EZH2 target (site) Ct value, internal reference Ct value, ΔCt value of each sample corresponding to tube 1 Note 1: The internal reference Ct is 26.33.

[0049] Note 2: Undetermined means no amplification curve.

[0050] The Ct values, internal reference Ct values, and ΔCt values ​​for each EZH2 target (site) in tube 2 are shown in Table 5 below. Combined with the cut-off values ​​(ΔCt ≤ 15 for FAM-Y646C, ΔCt ≤ 9 for CY5-Y646H, ΔCt ≤ 8 for VIC-Y646S, and ΔCt ≤ 11 for ROX-A692V) for positive / negative determination, the minimum detection limits for tube 2 (FAM target (Y646C site)) are 2%, 1% for VIC target (Y646S site), 2% for CY5 target (Y646H site), and 2% for ROX target (A692V site). This indicates that the detection limit for tube 2 is between 1% and 2%.

[0051] Table 5 EZH2 target (site) Ct values, internal reference Ct values, and ΔCt values ​​for each sample corresponding to tube 2 Note: The internal reference Ct is 25.53.

[0052] Example 4 This example takes the detection of the A682 site as an example and conducts experiments using different blocking primers.

[0053] The sequences of primers, probes, and blocking primers used in this example to detect the A682 site are shown in Table 6 below.

[0054] Table 6 Primer, probe and blocking primer sequences for detecting A682 locus Primer name Primer sequence (5' to 3') 5' modification 3' modification 682-F TTTGCAAAACGAATTTTGTTACC / / 682-R ATTATTCACTGGGCTGTGCTT / / 682-p TGCGGGTTCCATCCACCA 5'CY5 3'BHQ2 682-blocker-1 ACCCTTGCGGGTTGCATCCACATTTT / / 682-blocker ACCCTTGCGGGTTGCATCCACCAATTTT / / Prepare a 2-tube qPCR reaction system according to the following recipe.

[0055] Tube 1-Reaction system 1 2×Goldstar SNP Mastermix 10 μL, upstream primer (646-F) (10 μM) 0.4 μL, downstream primer (646-R) (10 μM) 0.4 μL, probe (646N-p) (10 μM) 0.16 μL, probe (646F-p) (10 μM) 0.16 μL, blocking primer (646-blocker) (100 μM) 0.4 μL, upstream primer (682-F) (10 μM) 0.4 μL, downstream primer (682-R) (10 μM) 0.4 μL, probe (682-p) (10 μM) 0.16 μL, blocking primer (682-blocker-1) (100 μM) 0.4 μL, add water to a total volume of 16 μL.

[0056] Tube 1-Reaction system 2 In reaction system 2, blocker (682-blocker-1) (100 μM) in reaction system 1 was replaced with blocker (682-blocker) (100 μM), and the rest remained unchanged.

[0057] 4 μL of the 1% standard extract containing 1% of the A682G mutation was added to the reaction system.

[0058] The reaction was carried out according to the reaction procedure in Example 2.

[0059] Off-line data showed that after replacing the blocking primer (reaction system 2), the amplification Ct value of the A682 site (CY5 channel) remained essentially unchanged, but the amplification noise of the FAM channel decreased. (See Table 7.) This optimization significantly improved the detection sensitivity of the FAM channel (Y646) in tube 1, indicating that optimizing the primer, probe, and blocking primer sequences can improve the specificity of the reaction system, reduce background noise, and indirectly increase reaction sensitivity.

[0060] Table 7 Results of detecting A682 site using different blocking primers

Claims

1. A nucleic acid composition for detecting EZH2 gene mutation, comprising a forward primer, a reverse primer, a probe and a blocking primer, characterized in that: The binding position of the probe to the EZH2 gene covers the target mutation site of the EZH2 gene, the blocking primer covers the target mutation site, and the 3' end of the blocking primer has an overlapping portion with the probe, the 5' end has an overlapping portion with the 3' end of the forward primer, and the 5' end of the blocking primer has an overlapping portion with the 3' end of the forward primer; the Tm value of the probe corresponding to the mutation site is 3° C. to 5° C. higher than the Tm value of the forward primer and the Tm value of the reverse primer corresponding to the mutation site.

2. The nucleic acid composition according to claim 1, characterized in that The target mutation site is selected from any one mutation site of Y646N, Y646F, Y646C, Y646S, Y646H, A682G, and A692V, or a combination of at least two mutation sites, wherein the probe corresponding to Y646N is shown in SEQ ID NO: 1; the probe corresponding to Y646F is shown in SEQ ID NO: 2; the probe corresponding to Y646C is shown in SEQ ID NO: 3; the probe corresponding to Y646S is shown in SEQ ID NO: 4; the probe corresponding to Y646H is shown in SEQ ID NO: 5; the probe corresponding to A682G is shown in SEQ ID NO: 6, and the probe corresponding to A692V is shown in SEQ ID NO:

7.

3. The nucleic acid composition according to claim 2, characterized in that The Tm value of each blocking primer is 5°C to 10°C higher than the Tm value of the corresponding forward primer.

4. The nucleic acid composition according to claim 3, characterized in that The 5' end of the blocking primer overlaps with the 3' end of the forward primer by 4 to 12 bases.

5. The nucleic acid composition according to claim 4, characterized in that The forward primers corresponding to Y646N, Y646F, Y646C, Y646S, and Y646H are shown in SEQ ID NO: 11, and the reverse primers are shown in SEQ ID NO:

12.

6. The nucleic acid composition according to claim 5, characterized in that The forward primer corresponding to A682G is shown in SEQ ID NO: 13, and the reverse primer is shown in SEQ ID NO:

14.

7. The nucleic acid composition according to claim 5, characterized in that The forward primer corresponding to A692V is shown as SEQ ID NO: 15, and the reverse primer is shown as SEQ ID NO:

16.

8. A kit for detecting EZH2 gene mutation, characterized in that: The invention comprises the nucleic acid composition according to any one of claims 1 to 8.

Images