A SNP molecular marker related to brucellosis resistance in sheep and application thereof

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a SNP molecular marker related to the anti-Brucella disease trait of sheep and application thereof.The molecular marker comprises nucleic acid of the nucleotide sequence shown in SEQ ID NO.1, and polymorphism exists at the 101th position, and the polymorphism is T / C.A molecular marker is disclosed, and the molecular marker is related to the anti-Brucella disease trait of sheep.The polymorphism detection result of the molecular marker reflects the anti-Brucella disease trait of sheep.Therefore, based on the correlation between the polymorphism of the molecular marker and the anti-Brucella disease trait of sheep, the sheep germplasm resource can be improved, and the present application has important application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of animal breeding technology, and particularly relates to a SNP molecular marker related to the anti-Brucella disease trait of sheep and application thereof. BACKGROUND

[0002] Brucellosis caused by bacteria of the genus Brucella is a typical zoonosis. Its clinical features are diverse, mainly covering systemic wave-like fever and fatigue, and significant reproductive system dysfunction, such as inflammation of the testis and epididymis in male animals, and problems such as abortion or endometritis in female animals. As a facultative intracellular parasite, Brucella has a strong immune escape mechanism. This biological characteristic leads to the development of the infection in a latent or chronic manner, making early diagnosis of the disease difficult and the later control difficult. In particular, Brucella melitensis is particularly prominent in toxicity and infectivity among all strains. Since sheep and goats are the main susceptible hosts of the bacteria, they also constitute the main risk source of human infection with Brucella, posing a serious threat and economic loss to the sheep breeding industry.

[0003] Single nucleotide polymorphism (SNP) refers to a genetic marker formed by a single nucleotide variation in the genome, which is the most common form of biological genetic variation. Such variations can be divided into purine-to-purine (A / G) or pyrimidine-to-pyrimidine (C / T) transitions, and purine-to-pyrimidine transversions. In the genetic improvement practice of modern animal husbandry, SNP, as a highly efficient molecular marker, has been widely used in the field of genome analysis. Using SNP markers can accurately identify and distinguish the genotypes of different animal individuals, thereby providing a powerful tool for analyzing the genetic basis of their disease resistance, production efficiency and other key economic traits.

[0004] Therefore, screening and identifying molecular markers related to the anti-Brucella disease trait in sheep and applying them to molecular marker-assisted selection breeding are expected to break the transmission chain of the disease at the source. This is a specific embodiment of the "preventing human disease through animal prevention and controlling the source" strategic thinking in practice, and the implementation of this strategy can also effectively reduce the dependence on antibiotics, thereby alleviating the environmental pollution and drug residue problems in food safety caused by the overuse of antibiotics. In summary, the development of research on molecular markers related to the anti-Brucella disease trait of sheep has significant theoretical value and urgent practical needs. SUMMARY

[0005] In order to solve the problems existing in the prior art, the present application provides a SNP molecular marker related to the anti-Brucella disease trait of sheep and application thereof.

[0006] The present application is directed to whole genome association analysis of different breeds of sheep against brucellosis, and a SNP molecular marker related to the brucellosis resistance of sheep in the sheep genome is obtained, and through population verification, it is proved that the SNP molecular marker is significantly related to the brucellosis resistance of sheep, and can be used for detecting the resistance of sheep to brucellosis.

[0007] In a first aspect, the present application provides a molecular marker, which comprises a nucleic acid of a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism exists at position 101, and the polymorphism is T / C.

[0008] The nucleotide sequence as shown in SEQ ID NO. 1:

[0009] GGCATGCACTGATATAGGGTGAAGGCTTTGGAGTCACTTTTATTAGCTGGCTGACTCAACGTGCTTGAGAGTATCTATGATTTCATGTATGTATGATGTAYGTTCACATATTTTGCCCAATTTAAATTGGATTATCTAGCTTTTCAGTATCAATATACAGAAATTCCTTACATATTCTGAATATGAACACTATTGATTGCA.

[0010] Wherein Y represents T or C (according to the international standard IUPAC-IUBMB).

[0011] Specifically, the polymorphism site of the aforementioned molecular marker is located at position 106808175 of chromosome 4 of the reference genome version number Oar_v4.0, and the polymorphism is T / C.

[0012] In a second aspect, the present application provides a primer pair for amplifying the aforementioned molecular marker. The design method of the primer pair of the present application can be the conventional method of the present application, and the skilled person can design different lengths of primer pairs (including primer pairs, or KASP primer combinations) for amplifying the aforementioned molecular marker according to the existing primer design rules and primer design software (such as primer).

[0013] Further, the present application provides a probe for amplifying the aforementioned molecular marker. The existing technology has mature technical guidance and means for designing probes for molecular markers, and the probes designed according to the existing technical guidance are within the protection scope of the present application.

[0014] Further, the present application provides a gene chip comprising the probe. The prior art also has mature gene chip design means, which can comprise the aforementioned probe alone or combine the aforementioned probe with other probes to prepare a gene chip for molecular marker assisted breeding.

[0015] In a third aspect, the present application provides a primer pair comprising the nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0016] SEQ ID NO. 2: 5'-GCAGAGAACGTGAATGCTGTG-3';

[0017] SEQ ID NO. 3: 5'-ACTCCTGTCTACCTAGAGGCA-3'.

[0018] The primer combination described above can achieve efficient amplification and genotyping for the aforementioned molecular marker.

[0019] In a fourth aspect, the present application provides a kit comprising the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip.

[0020] In a fifth aspect, the present application provides the SNP site as a target for use in any of the following:

[0021] (1) predicting or detecting the Brucella resistance trait of sheep, or preparing a reagent for predicting or detecting the Brucella resistance trait of sheep;

[0022] (2) identifying or breeding sheep breeds with high Brucella resistance traits, or preparing a reagent for identifying or breeding sheep breeds with high Brucella resistance traits;

[0023] (3) molecular marker assisted breeding of sheep Brucella resistance traits;

[0024] (4) improvement of sheep breeds related to Brucella resistance traits;

[0025] (5) improvement of sheep germplasm resources;

[0026] The SNP site is located at position 106808175 of chromosome 4 of the reference genome version number Oar_v4.0, and the polymorphism is T / C.

[0027] The target of the present application includes existing conventional nucleotide detection methods and reagents, such as gene sequencing, primer amplification design, probe targeting detection, etc.

[0028] In a sixth aspect, the present application provides the use of the aforementioned molecular marker detection reagent, or the aforementioned primer pair, or the aforementioned gene chip, or the aforementioned kit in any one of the following:

[0029] (1) predicting or detecting the Brucella resistance trait of sheep, or preparing a reagent for predicting or detecting the Brucella resistance trait of sheep;

[0030] (2) identifying or breeding a sheep breed with high Brucella resistance trait, or preparing a reagent for identifying or breeding a sheep breed with high Brucella resistance trait;

[0031] (3) molecular marker assisted breeding of the Brucella resistance trait of sheep;

[0032] (4) improvement of a sheep breed related to the Brucella resistance trait;

[0033] (5) improvement of the germplasm of sheep.

[0034] In a seventh aspect, the present application provides a method for identifying the Brucella resistance trait of sheep, comprising:

[0035] detecting the polymorphism of the aforementioned molecular marker in a sample of a sheep to be tested, and determining the Brucella resistance trait of the sheep to be tested according to the genotype detection result.

[0036] Further, the detection method comprises one or more of PCR amplification, gene sequencing, molecular probe, liquid phase capture or mass spectrometry.

[0037] Further, the determination of the Brucella resistance trait of the sheep to be tested according to the genotype detection result comprises: genotype TT corresponds to low Brucella resistance trait, and genotypes CC and TC correspond to high Brucella resistance trait.

[0038] Taking the aforementioned primer pair as an example, the amplification result at the 175th position corresponds to the polymorphic site, thereby realizing the identification of the Brucella resistance trait of the sheep to be tested. In fact, in addition to this, the detection of the polymorphism of the molecular marker can also be directly realized by any method of gene sequencing, molecular probe, liquid phase capture or mass spectrometry (all of which are conventional methods in the art).

[0039] In an eighth aspect, the present application provides a method for improving the Brucella resistance trait of sheep, comprising:

[0040] In the breeding process of sheep, the offspring of a sheep with the aforementioned molecular marker genotype of CC or TC is selected for breeding.

[0041] The Brucella disease in the present application refers to the Brucella disease caused by Brucella infection in sheep.

[0042] The present application has the following beneficial effects:

[0043] The application discloses a molecular marker related to a sheep anti-Brucella disease trait, which can more accurately detect the resistance of sheep to Brucella disease, realizes early prediction of the sheep anti-Brucella disease trait, and is not limited by the age and gender of the sheep. The molecular marker provided by the application can be used for detection of the sheep anti-Brucella disease trait and molecular marker assisted breeding, has important significance for prevention and screening of Brucella disease susceptible sheep, effectively improves breeding efficiency, and has important significance for development and utilization of excellent economic characteristics of sheep excellent breeds and protection and reasonable utilization of breed resources. BRIEF DESCRIPTION OF DRAWINGS

[0044] In order to more clearly illustrate the technical solutions in the application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0045] Figure 1 is the expansion verification result of the SNP molecular marker disclosed in embodiment 2 of the application in a sheep population, wherein, represents p<0.05, represents p<0.01. DETAILED DESCRIPTION

[0046] In order to make the objects, technical solutions and advantages of the application more clear, the technical solutions in the application will be clearly and completely described below in combination with the drawings in the application. Obviously, the described embodiments are some embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.

[0047] The experimental methods involved in the following embodiments are all conventional methods in the art, for example, refer to the experimental manual in the art, or follow the suggested conditions in the manufacturer's instruction, if not specially mentioned.

[0048] The experimental materials and reagents involved in the following embodiments can be obtained from commercial channels, if not specially mentioned.

[0049] Example 1: Screening of SNP molecular marker related to sheep anti-Brucella disease trait

[0050] In the embodiment, a method is used to develop SNP molecular markers related to the resistance of sheep to brucellosis by using whole genome association analysis (GWAS) on a sample of a sheep population infected with brucellosis, and the specific steps are as follows:

[0051] (1) Blood collection and serological detection.

[0052] Blood samples of 50 Texel sheep raised under the same conditions are collected, and the concentration of brucella antibodies in the sheep serum is detected by using competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively, and the detection results are used as the resistance index of sheep brucellosis and as the phenotype data for GWAS analysis.

[0053] (2) Total DNA extraction, genome resequencing and quality control.

[0054] The blood DNA samples of the above 50 sheep are subjected to whole genome resequencing, the sequencing depth is 20x, and the sequencing data is subjected to sequence alignment and quality control, and the number of effective SNPs after quality control is 22833320.

[0055] (3) Screening of SNP sites related to the resistance of sheep to brucellosis by using whole genome association analysis technology.

[0056] The cELISA value is selected as the phenotype, GEMMA (Version 0.95) software is used, MLM (y=γCov+Xβ+Zα+Wμ+e) is used as the model basis for whole genome association analysis; the iELISA value is selected as the phenotype, GEMMA (Version 0.95) software is used, MLM (y=γCov+Xβ+Zα+Wμ+e) is used as the model basis for whole genome association analysis; and the FPA value is selected as the phenotype, GEMMA (Version 0.95) software is used, MLM (y=γCov+Xβ+Zα+Wμ+e) is used as the model basis for whole genome association analysis.

[0057] (4) Screening of SNP sites significantly associated with the resistance of sheep to brucellosis.

[0058] The top 500 SNPs in the three GWAS results are compared, and finally, the SNP molecular markers significantly related to the resistance of sheep to brucellosis are obtained, and the physical position is based on the 4th chromosome of the sheep reference genome Oar_v4.0 at 106808175.

[0059] The above SNP molecular marker corresponds to the sequence shown as SEQ ID NO. 1, wherein the polymorphic site is at 101bp, and the polymorphism is T or C.

[0060] Application of SNP molecular marker associated with sheep anti-brucellosis trait in Example 2

[0061] In this example, a method is used to verify the SNP molecular marker associated with sheep anti-brucellosis trait developed in Example 1 in a larger population, as follows:

[0062] (1) Primer design

[0063] According to the information of sheep genomic DNA sequence, a pair of primers is designed as follows:

[0064] Forward primer F 5'-GCAGAGAACGTGAATGCTGTG-3'.

[0065] Reverse primer R 5'-ACTCCTGTCTACCTAGAGGCA-3'.

[0066] for amplifying the nucleotide fragment where the SNP to be tested is located.

[0067] (2) Collecting blood samples of sheep to be tested and identifying serum antibody concentration

[0068] 135 sheep without vaccination from a farm naturally infected with Brucella were collected, including jugular vein blood of four breeds of Texel sheep, East Friesian sheep, Suffolk sheep and white Suffolk sheep. The serum Brucella antibody concentration was detected by competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively.

[0069] (3) Extracting genomic DNA in blood samples of sheep to be tested

[0070] Solution method was used to extract genomic DNA in blood samples of sheep to be tested.

[0071] (4) Extracting SNP marker of the tested genome by genotyping technology

[0072] Based on the primer design in this example (1), the SNP molecular marker associated with sheep anti-brucellosis trait developed in Example 1 was detected by genotyping.

[0073] (5) Comparing whether there is a significant difference in disease resistance of different genotypes

[0074] The genotypes of the polymorphic sites of the SNP molecular markers of the above-mentioned 135 sheep are detected, and three genotypes (i.e., two homozygous and one heterozygous genotypes) are distinguished in the detected sheep population. The significance test of mean difference of the different genotypes of the sites on the anti-Brucella resistance traits (cELISA value, iELISA value, FPA value) is respectively performed by using the single factor variance analysis of SPSS.

[0075] The results are shown in Table 1. Figure 1 As shown in Table 1, three genotypes of "TT", "TC" and "CC" are distinguished in the detected sheep population, and the iELISA mean of the "TC" and "CC" genotype sheep individuals is significantly lower than that of the "TT" genotype, which indicates that the "TC" and "CC" genotype sheep individuals are stronger than the "TT" genotype in the anti-Brucella resistance, which also indicates that "TC" and "CC" are the dominant genotypes of the anti-disease sheep, and the SNP molecular marker provided by the present application has high accuracy for the identification of the anti-Brucella resistance traits.

[0076] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. Application of SNP site as a target in any one of the following: (1) preparation of reagent for predicting or detecting Brucella resistance trait of sheep; (2) identification or breeding of sheep breed with high Brucella resistance trait, or preparation of reagent for identifying or breeding sheep breed with high Brucella resistance trait; (3) molecular marker assisted breeding of Brucella resistance trait of sheep; (4) improvement of sheep breed related to Brucella resistance trait; (5) improvement of germplasm resource of sheep; The SNP site is located at 106808175 of chromosome 4 of reference genome version number Oar_v4.0, and the polymorphism is T / C.

2. Application of detection reagent of molecular marker, or primer pair, or kit in any one of the following: (1) preparation of reagent for predicting or detecting Brucella resistance trait of sheep; (2) identification or breeding of sheep breed with high Brucella resistance trait, or preparation of reagent for identifying or breeding sheep breed with high Brucella resistance trait; (3) molecular marker assisted breeding of Brucella resistance trait of sheep; (4) improvement of sheep breed related to Brucella resistance trait; (5) improvement of germplasm resource of sheep; The nucleic acid of the molecular marker is the nucleotide sequence as shown in SEQ ID NO. 1, and the polymorphism is T / C at the 101st position; The nucleotide sequences of the primer pair are as shown in SEQ ID NO. 2 and SEQ ID NO. 3; The kit comprises the primer pair.

3. A method of improving the Brucellosis resistance trait in sheep, characterized in that, Comprise: In the breeding process of sheep, the offspring is selected as the sheep offspring with the genotype of CC or TC of the molecular marker mentioned in the application of claim 2; and the method is used for non-therapeutic or diagnostic purposes.

Images