Molecular marker for identifying or assisting in identifying soybean oil content and application thereof

Abstract

The application discloses a molecular marker for identifying or assisting in identifying soybean oil content and application, relates to the technical field of biology, and use of SNP site. The SNP site takes a soybean Wm82.a2.v1 genome sequence as a reference genome. The SNP is the 41859817th SNP on a 5th chromosome of the soybean, corresponds to the 20th base from the 5' end of a sequence shown in SEQ ID NO:1, and when the site is TT homozygous, the corresponding genotype is A; when the site is GG homozygous, the corresponding genotype is B. The use is as follows: screening or assisting in screening soybeans with different oil contents. The different oil contents of the soybeans are as follows: the soybean with genotype A homozygous is higher than or is a candidate for being higher than the soybean with genotype B homozygous. The application has important theoretical significance and economic value for using molecular marker assisted selection to obtain soybean germplasm or breeding offspring materials with higher oil content.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a molecular marker for identifying or assisting in identifying soybean oil content and application thereof. BACKGROUND

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oil crop in China. With the development of social economy and the continuous improvement of people's living standards, the consumption of soybean in China is becoming larger and larger.

[0003] 56% of human fat comes from edible oil, which provides the required heat for the human body and also provides essential fatty acids and fat-soluble vitamins that the human body cannot synthesize. Soybean oil is an important type of edible oil for human consumption, accounting for about 31%. Research has found that since the 21st century, the consumption structure of edible oil varieties in China has shifted from rapeseed oil to soybean oil, and the consumption of soybean oil has been increasing by 10.4% per year. Therefore, it is particularly important to breed soybean varieties with high oil content. Molecular assisted breeding is an important method to speed up the breeding process of soybean, and the development of molecular markers related to soybean oil content is of great significance for breeding new soybean varieties with high oil content. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a molecular marker for identifying or assisting in identifying soybean oil content and application thereof.

[0005] To solve the above technical problems, the technical solutions adopted by the present application are as follows.

[0006] The use of the SNP site, the SNP site is based on the soybean Wm82.a2.v1 genome sequence as the reference genome, the SNP is the 41859817th SNP on the 5th chromosome of soybean, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1, when the site is TT homozygous, the corresponding genotype is A; when the site is GG homozygous, the corresponding genotype is B;

[0007] The use is: screening or assisting in screening soybeans with different oil contents, and the oil content of soybeans with different genotypes is: soybeans with genotype A homozygous are higher than or candidate higher than soybeans with genotype B homozygous.

[0008] A method for screening or assisting in screening soybeans with different oil contents, comprising the following steps: detecting the genotype of the soybean to be tested is genotype TT or genotype GG, and the oil content of the soybean with genotype TT is > the oil content of the soybean with genotype GG;

[0009] The soybean with genotype TT is a soybean with genotype TT homozygous based on T20G SNP site;

[0010] the genotype GG of the soybean is that the genotype of the soybean based on the T20G SNP site is GG homozygote;

[0011] the T20G SNP site is the 41859817th SNP on chromosome 5 of soybean based on the Wm82.a2.v1 genome sequence of soybean as the reference genome, which corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0012] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG is as follows:

[0013] (a1) using the genomic DNA of the soybean to be tested as the template, performing PCR amplification with a primer combination to obtain a PCR amplification product;

[0014] the primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4;

[0015] (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product with an instrument, obtaining the genotype of the soybean to be tested according to the color of the fluorescence signal, if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by primer 14020-05-FAM, showing orange fluorescence, then the soybean sample to be tested is genotype TT; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by primer 14020-05-VIC, showing blue fluorescence, then the soybean sample to be tested is genotype GG.

[0016] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG is as follows:

[0017] (b1) using the genomic DNA of the soybean to be tested as the template, performing PCR amplification with a primer combination to obtain a PCR amplification product;

[0018] the primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4;

[0019] (b2) sequencing the PCR amplification product obtained in step (b1);

[0020] (b3) obtaining the genotype of the soybean to be tested according to the sequencing result obtained in step (b2).

[0021] A kit for identifying or assisting in identifying soybean oil content, comprising a primer combination for detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG;

[0022] The primer combination consists of an upstream primer 14020-05-FAM as shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC as shown in SEQ ID NO: 3, and a downstream primer 14020-05-R as shown in SEQ ID NO: 4;

[0023] The genotype TT is a genotype TT homozygote based on the T20G SNP site;

[0024] The genotype GG is a genotype GG homozygote based on the T20G SNP site;

[0025] The T20G SNP site is the 41859817th SNP on chromosome 5 of soybean with the Wm82.a2.v1 genome sequence as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0026] The molecular marker shown in SEQ ID NO: 1.

[0027] The kit or the above-mentioned molecular marker is used in identifying or assisting in identifying soybean oil content.

[0028] The kit or the above-mentioned molecular marker is used in screening or assisting in screening soybeans with different oil contents.

[0029] The kit or the above-mentioned molecular marker is used in soybean breeding.

[0030] The primer combination is used in directed breeding or assisting in directed breeding of soybean lines with high oil content, and the primer combination consists of an upstream primer 14020-05-FAM as shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC as shown in SEQ ID NO: 3, and a downstream primer 14020-05-R as shown in SEQ ID NO: 4.

[0031] The beneficial effects of the above technical solutions are that the present application provides KASP markers for identifying genotype TT and GG allelic variation and their correlation with soybean oil content. The KASP markers in the present application are applied to molecular marker assisted selection of soybean oil content, which can quickly and efficiently screen soybean varieties (germplasm) with high oil content, thereby accelerating the breeding process of high-quality soybean new varieties. The present application has important theoretical significance and economic value for utilizing molecular marker assisted selection of soybean germplasm or breeding progeny materials with high oil content. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 Figure for QTL mapping analysis of oil content trait of population numbered 14020 in Example 1 of the present application;

[0033] Figure 2 Figure for selection efficiency of normal distribution marker of oil content of population numbered 14020 in Example 1 of the present application;

[0034] Figure 3 Figure for genotyping of KASP marker and oil content of population numbered 14020 in Example 2 of the present application. DETAILED DESCRIPTION

[0035] The following examples illustrate the present application. The various raw materials and equipment used in the present application are all conventional commercially available products, which can be directly obtained by market purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0036] It should be understood that the term "comprising" as used in the specification and the appended claims indicates the presence of the recited features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0037] It should also be understood that the term "and / or" as used in the specification and the appended claims indicates any combination of one or more of the associated listed items and all possible combinations thereof, and includes these combinations.

[0038] The reference in the specification to "one embodiment" or "some embodiments" or "an embodiment" or "some embodiments" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. The appearances of the phrases "in one embodiment" or "in some embodiments" or "in an embodiments" or "in some embodiments" in various places in the specification are not necessarily all referring to the same embodiment, however, but can refer to one or more but not all embodiments.

[0039] Unless otherwise indicated, the terms "including", "includes", "having", "has", "containing", "contains" or variants thereof are meant to be equivalent to the term "comprising" or "comprises", and are meant to be open-ended terms that do not exclude additional, unrecited elements or method steps.

[0040] In addition, in the description of the specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description, and cannot be understood as indicating or implying relative importance.

[0041] The technical solutions of the present application will be described clearly and completely below in combination with specific embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the present application.

[0042] Example 1: Discovery of SNP site specific to soybean oil content

[0043] The soybean materials in the present embodiment are derived from the following: in 2006, the cultivated soybean Jidou 12 in the laboratory was used as the female parent, and the wild soybean ZYD02738 was used as the male parent to perform hybridization and establish a RIL population. In 2012, Jidou 12 was used as the female parent, and the RIL population was used as the male parent to perform backcrossing, and the BC1F1 population was obtained in 2013. In 2014, Jidou 12 was used as the female parent, and the BC1F2 combined with Jidou 12 and ZYD02738 was used as the male parent to perform backcrossing; the BC2F1 population was obtained in 2015. After selfing for 4 times, the BC2F4:5 population was obtained, and 55 strains of the 14020 population were numbered. In December 2018, the leaves of the BC2F4:5 strains were taken in Sanya, and the DNA was extracted by Baimaik company, and the genotype of each strain was identified, and the genetic map was constructed.

[0044] In combination with the phenotype data, QTL positioning was performed on the soybean oil content, and the QTL site qOil-14020-05 related to the soybean oil content was positioned on chromosome 5 of soybean, the LOD value was 7.29, and the explained phenotypic variation was 45.70%. The marker associated with the QTL was CHr05_41859817_T_G. The SNP was taken as the reference genome of the soybean Williams82 (Wm82.a2.v1) genome sequence, the 41859817th SNP on the soybean chromosome 5, and the nucleotide type was T or G, which was the 20th nucleotide of SEQ ID NO: 1.

[0045] Table 114020 population QTL positioning analysis results of oil content traits

[0046]

[0047] The genotype of each family in the population corresponding to the soybean SNP marker CHr05_41859817_T_G is divided into three types, namely TT, GG and T / G, wherein the genotype TT is the homozygous type of T, the genotype AA is the homozygous type of A, and the genotype TA is the heterozygous type of T and G. The oil content phenotype value and the genotype identification results of CHr05_41859817_T_G of the 55 strain soybean materials in the present embodiment are as follows: Figure 2As shown in Table 2, the average oil content of the TT genotype and GG genotype families was 19.70% and 18.53%, respectively, and the average oil content of the TT genotype family was significantly higher than that of the GG genotype family by 6.30% (P<0.001).

[0048] Table 2 Detection results of soybean molecular markers and oil content of 14020 population

[0049]

[0050]

[0051] In practical application, the genotype of soybean can be detected according to the following method. The KASP marker is designed for the specific CHr05_41859817_T_G site on chromosome 5, and the primers are designed as follows:

[0052] 14020-05-FAM: gaaggtgaccaagttcatgctAAAAAAGTTTCTTTTGTGCT (SEQ ID NO: 2);

[0053] 14020-05-VIC: gaaggtcggagtcaacggattAAAAAAGTTTCTTTTGTGCG (SEQ ID NO: 3);

[0054] 14020-05-R: CTAAGGAGACTCATGGTGGC (SEQ ID NO: 4);

[0055] The KASPAssay Mix enzyme 5 μL is selected for amplification: 1.2 μL of 14020-05-FAM, 1.2 μL of 14020-05-VIC, 3 μL of 14020-05-R, and 4.6 μL of ddH2O. The reaction system is shown in Table 3. The reaction program is as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, 10 cycles, each cycle decreasing by 0.6°C; 94°C for 20 s, 55°C for 1 min, 26 cycles, and finally 30°C for 1 min.

[0056] Table 3 PCR reaction system of the test population

[0057]

[0058] The 40 breeding varieties were subjected to gene identification by using the marker CHr05_41859817_T_G, and the KASP marker detection showed that among the 40 breeding varieties, 27 germplasms were of TT genotype, and 8 germplasms were of GG genotype, and the genotype results are shown in Table 4 andFigure 3 As shown,

[0059] Table 4 Detection results of molecular markers and oil content of 440 soybean varieties

[0060]

[0061]

[0062] Note: NA indicates missing data of oil content or genotype

[0063] Table 5 Statistical analysis of the relationship between CHr05_41859817_T_G allelic variation types and oil content

[0064]

[0065] The average oil content of TT genotype and GG genotype families was 21.44% and 19.67%, respectively, and the average oil content of TT genotype family was significantly higher than that of GG genotype family by 9.00% (P<0.01). It is proved that the identification of soybean oil content by marker CHr05_41859817_T_G is reliable and effective.

[0066] In summary, soybean with genotype TT of CHr05_41859817_T_G is high oil content soybean, and soybean with genotype GG of CHr05_41859817_T_G is low oil content soybean. The oil content of soybean with genotype TT of CHr05_41859817_T_G is higher than that of soybean with genotype GG of CHr05_41859817_T_G. When selecting superior varieties of soybean oil content, soybean with genotype TT of CHr05_41859817_T_G should be selected for breeding and improvement.

[0067] Although the embodiments of the present application have been shown and described, it is to be understood that various changes, modifications, substitutions and alterations can be made to the examples without departing from the principles and spirit of the present application, the scope of which is defined by the appended claims and their equivalents.

[0068] In the above embodiments, the description of each embodiment has its own focus, and the parts not described or recorded in detail in a certain embodiment can be referred to the relevant description of other embodiments.

[0069] The above-described embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.

Claims

1. Use of a SNP site, characterized in that, the SNP site is the 41859817th nucleotide on chromosome 5 of soybean, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO: 1, and the genotype corresponding to the SNP site is A when the SNP site is TT homozygous, and the genotype corresponding to the SNP site is B when the SNP site is GG homozygous; the use is to assist in screening soybeans with different oil contents, and the oil content of soybeans of genotype A is higher than or higher than that of soybeans of genotype B.

2. A method of assisting in the selection of soybeans of different oil content, characterized by, The method comprises the following steps: detecting the genotype of the soybean to be tested as genotype TT or genotype GG, and the oil content of the soybean of genotype TT is higher than that of the soybean of genotype GG; the soybean of genotype TT is a soybean with genotype TT homozygous based on the T20G SNP site; the soybean of genotype GG is a soybean with genotype GG homozygous based on the T20G SNP site; the T20G SNP site is the 41859817th nucleotide on chromosome 5 of soybean, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO:

1.

3. The method of claim 2, wherein, The step of detecting the genotype of the soybean to be tested as genotype TT or genotype GG is as follows: (a1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification with a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4; (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product with an instrument, and obtaining the genotype of the soybean to be tested according to the color of the fluorescence signal, if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-FAM, showing orange fluorescence, then the soybean sample to be tested is of genotype TT; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-VIC, showing blue fluorescence, then the soybean sample to be tested is of genotype GG.

4. The method of claim 2, wherein, The step of detecting the genotype of the soybean to be tested as genotype TT or genotype GG is as follows: (b1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification with a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4; (b2) sequencing the PCR amplification product obtained in step (b1). (b3) obtaining the genotype of the soybean to be tested according to the sequencing result obtained in step (b2).

5. A kit for aiding in the identification of soybean oil content, characterized by, The primer combination comprises primers for detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG; The primer combination consists of an upstream primer 14020-05-FAM as shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC as shown in SEQ ID NO: 3, and a downstream primer 14020-05-R as shown in SEQ ID NO: 4; The genotype TT is a genotype TT homozygous based on the T20G SNP site; The genotype GG is a genotype GG homozygous based on the T20G SNP site; The T20G SNP site is the 41859817th nucleotide on chromosome 5 of soybean with the Wm82.a2.v1 genome as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. Use of the kit of claim 5 in assisting screening of soybeans with different oil contents.

7. Use of the kit of claim 5 in soybean breeding.

8. Use of a primer combination in assisting directional breeding of soybean lines with high oil content, wherein the primer combination consists of an upstream primer 14020-05-FAM as shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC as shown in SEQ ID NO: 3, and a downstream primer 14020-05-R as shown in SEQ ID NO: 4.

Images