Construction method and application of grouper oocyte in-vitro vitellogenin Vtg intake system
By constructing an in vitro vitellogenin Vtg uptake system for grouper oocytes, the problems of low labeling efficiency and difficulty in dynamic monitoring of yolk uptake in existing technologies were solved, the visualization study of Vtg uptake in oocytes in vitro was realized, and the regulatory effect of FSH on Vtg uptake in oocytes was revealed.
Patent Information
- Application Number
- CN202510633761.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-16
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies lack an efficient and visual system for studying vitellogenin (Vtg) uptake by grouper oocytes in vitro. Traditional labeling methods have low efficiency and make it difficult to dynamically monitor the yolk uptake process. Grouper is an asynchronously spawning fish, and there are oocytes at different stages in their ovaries, making it difficult to unify the yolk intake of different individuals.
An in vitro vitellogenin (Vtg) uptake system for grouper oocytes was constructed, including the preparation of fluorescently labeled vitellogenin (Vtg)-FITC, purification through ultrafiltration centrifuge tubes and chromatography columns, and the establishment of a visual in vitro culture system to study the regulatory effect of gonadotropins on Vtg uptake by oocytes.
The visualization study of Vtg uptake by grouper oocytes in vitro was achieved, the difference in yolk uptake was reduced, and the Vtg-FITC marker was used to quantify oocyte uptake. The regulatory effect of gonadotropin on oocyte Vtg uptake was preliminarily studied. The results showed that FSH significantly promoted the uptake of Vtg by oocytes.
Smart Images

Figure CN120648641A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of aquatic biology, and particularly relates to a construction method and application of an in vitro vitellogenin Vtg uptake system for grouper oocytes. Background Art
[0002] Producing a large number of high-quality gametes is fundamental to the sustainable development of aquaculture. Vitellogenesis is a crucial process in oocyte growth and development, determining egg quality. During vitellogenesis, oocytes accumulate yolk protein (Yp), providing sufficient nutrients for embryonic growth and development. Vitellogenin (Vtg), the precursor of intracellular yolk protein, enters the oocyte through the vitellogenin receptor (VtgR) on the egg membrane. Grouper, a key aquaculture fish species along my country's southeastern coast, has a limited understanding of Vtg and VtgR. Research on the expression patterns and regulatory mechanisms of Vtg and VtgR in commercial fish species such as grouper is of great significance to the aquaculture industry. Gonadotropins have been shown to enhance Vtg uptake by oocytes in a dose-dependent manner, suggesting that this regulatory mechanism may play a crucial role in vitellogenesis.
[0003] Vtg uptake by oocytes is a complex process, and research evidence suggests that it is regulated by multiple factors. In fish, studies have demonstrated, using in vitro culture systems, that follicle-stimulating hormone (FSH) promotes Vtg uptake by rainbow trout oocytes. However, the physiological state of rainbow trout differs significantly from that of grouper: rainbow trout, a cold-water freshwater fish, lay sinking eggs, while grouper, a warm-water marine fish, lays buoyant eggs. This difference in physiological state may lead to different regulation of Vtg uptake. Therefore, it is necessary to study the regulation of Vtg uptake using grouper as a model.
[0004] However, it is very difficult to conduct research on the regulation of yolk intake in grouper. Grouper is an asynchronous spawning fish, and there are oocytes of different stages in the ovaries, so it is difficult to unify the yolk intake of different individuals. Secondly, the injection of gonadotropin may cause different physiological reactions due to differences in the ovarian status of the parent fish, making it difficult to achieve stable results. Existing studies have shown that the endocytosis of vitellogenin (Vtg) is a key link in oocyte maturation, but existing technologies lack an in vitro Vtg intake research system for economic fish such as grouper. Traditional methods have problems such as low labeling efficiency and the inability to dynamically monitor the intake process. There is an urgent need to establish an efficient and visual in vitro research model. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for constructing a vitellogenin Vtg uptake system for grouper oocytes in vitro.
[0006] The present invention also aims to provide the application of the in vitro vitellogenin Vtg uptake system for grouper oocytes constructed by the above method in studying the regulatory effect of gonadotropins on the uptake of Vtg by oocytes.
[0007] The first object of the present invention can be achieved by the following technical solution: a method for constructing an in vitro vitellogenin Vtg uptake system for grouper oocytes, comprising the following steps:
[0008] (1) Preparation of fluorescently labeled vitellogenin Vtg-FITC:
[0009] (1.1) Multiple intramuscular injections of the estrogen estradiol E2 were performed on grouper fish. After the last injection, blood was drawn under anesthesia, allowed to stand overnight, and then centrifuged. The supernatant was collected and stored at low temperature until use.
[0010] (1.2) taking the supernatant from step (1.1), adjusting the volume with Na2CO3 / NaHCO3 buffer and centrifuging, and performing preliminary purification through an ultrafiltration centrifuge tube to obtain preliminary purified vitellogenin Vtg;
[0011] (1.3) Mix the preliminarily purified vitellogenin Vtg with Na2CO3 / NaHCO3 buffer solution containing 6-fluorescein isothiocyanate (FITC) powder and incubate in the dark to prepare Vtg-FITC marker;
[0012] (1.4) Remove free FITC from the Vtg-FITC marker using an ultrafiltration centrifuge tube, then purify the Vtg-FITC marker using a Sephacryl S-300 column, chromatograph using Tris chromatography buffer, and collect the eluate corresponding to the 280 nm UV absorption peak;
[0013] (1.5) Finally, the purified Vtg-FITC marker was obtained by enrichment and constant volume through ultrafiltration centrifuge tube;
[0014] (2) Construction of an in vitro oocyte culture system:
[0015] (2.1) LV-stage follicles from female Epinephelus coioides broodstock were cultured in phenol red-free L15 medium in the dark.
[0016] (2.2) Adding the Vtg-FITC marker purified in step (1.5) to the cultured follicles, and continuing to culture, thereby obtaining an in vitro vitellogenin Vtg uptake system for grouper oocytes.
[0017] In the above-mentioned method for constructing the in vitro vitellogenin Vtg uptake system for grouper oocytes:
[0018] Preferably, in step (1.1), the estrogen estradiol E2 is injected into 1.5-year-old grouper, the number of injections is 2-5, the dose of each injection is 3-10 mg / kg, and the interval between each injection is 12-48 hours. 12-36 hours after the last injection, blood is drawn under anesthesia, and after standing at 4°C overnight, the blood is centrifuged at 6000-12000g for 10-20 minutes. After taking the supernatant, it is immediately stored at -80°C for use.
[0019] More preferably, in step (1.1), the estrogen estradiol E2 is injected into 1.5-year-old grouper, and the injection frequency is 3 times, each injection dose is 10 mg / kg, and each injection is separated by 48 hours. 24 hours after the last injection, blood is drawn under anesthesia, and after standing at 4°C overnight, the blood is centrifuged at 8000g for 15 minutes. After taking the supernatant, it is immediately stored at -80°C for use.
[0020] Preferably, in step (1.2), 50 to 150 μL of serum from grouper coioides is taken, and the serum is supplemented to 4 to 6 mL using a Na2CO3 / NaHCO3 buffer solution with a pH of 8.5 to 9.5. The serum is centrifuged at 5000 g for 15 min in a 4°C centrifuge using a 4 to 6 mL 100K ultrafiltration tube, and the ultrafiltration is repeated 5 to 10 times for preliminary purification to obtain preliminary purified vitellogenin Vtg.
[0021] More preferably, in step (1.2), 100 μL of serum from grouper coi is taken, supplemented to 4 mL with a Na2CO3 / NaHCO3 buffer solution having a pH of 9.5, and centrifuged at 5000 g for 15 min in a 4°C centrifuge using a 4 mL 100K ultrafiltration tube. The ultrafiltration is repeated 5-10 times for preliminary purification to obtain preliminary purified vitellogenin Vtg.
[0022] Preferably, in step (1.3), the volume ratio of the vitellogenin Vtg to the Na2CO3 / NaHCO3 buffer solution to which 6-fluorescein isothiocyanate FITC powder is added is 1:50-300, wherein the dosage relationship of the 6-fluorescein isothiocyanate FITC powder to the Na2CO3 / NaHCO3 buffer solution is 1 mg:5-25 mL, the pH value of the Na2CO3 / NaHCO3 buffer solution is 8.5-9.5, and the incubation time in the dark is 12-16 hours.
[0023] More preferably, in step (1.3), the volume ratio of the vitellogenin Vtg to the Na2CO3 / NaHCO3 buffer solution to which 6-fluorescein isothiocyanate FITC powder is added is 1:100, wherein the amount of 6-fluorescein isothiocyanate FITC powder to the Na2CO3 / NaHCO3 buffer solution is 1 mg:10 mL, the pH value of the Na2CO3 / NaHCO3 buffer solution is 9, and the incubation time in the dark is 12-16 hours.
[0024] Preferably, in step (1.4), a 4-6 mL 50-300K ultrafiltration tube is used to remove free small molecule FITC in the Vtg-FITC marker, the filter is operated in the dark, and the filter is centrifuged at 4000-6000 g for 10-20 min in a 4°C centrifuge, and the filtration is repeated 5-10 times until the filtrate becomes white.
[0025] More preferably, in step (1.4), a 4 mL 100K ultrafiltration tube is used to remove free small molecule FITC in the Vtg-FITC marker, the filter is operated in the dark, and centrifuged at 5000 g for 15 min in a 4°C centrifuge. The filtration is repeated 5-10 times until the filtrate becomes white.
[0026] Preferably, in step (1.4), 1 mL of Vtg-FITC marker is taken and a chromatography column with a size of 1.6 cm × 70 cm assembled using Sephacryl S-300 is used for chromatography on an AKTA-pure instrument using Tris chromatography fluid at a flow rate of 0.5 mL / min. The chromatography temperature is 4°C, and the whole process is protected from light. The eluate corresponding to the ultraviolet absorption peak at 280 nm is collected.
[0027] Preferably, in step (1.5), the eluate is enriched by centrifugation at 4000-6000g for 15-20 min in a 100K ultrafiltration tube in a 4°C centrifuge, and supplemented with PBS to the target concentration. The whole process is performed in the dark to obtain a purified Vtg-FITC marker.
[0028] More preferably, in step (1.5), the eluate is enriched by centrifuging at 5000 g for 15 min in a 1.5 mL 100K ultrafiltration tube at 4°C centrifuge, and then supplemented to 1.5 mL with PBS. The whole process is performed in the dark to obtain a purified Vtg-FITC marker.
[0029] Preferably, the follicles in step (2.1) are isolated from ovarian tissue of female Epinephelus coioides broodstock, and LV stage follicles are screened under sterile conditions using a dissecting microscope. The phenol red-free L15 culture medium contains 1% (volume percentage) of the triple antibody and is cultured at 23-28° C. in the dark for 2-6 hours.
[0030] More preferably, the follicles described in step (2.1) are isolated from ovarian tissue of female Epinephelus coioides broodstock, and LV stage follicles are screened under sterile conditions using a dissecting microscope. The phenol red-free L15 culture medium contains 1% (volume percentage) of the triple antibody and is cultured at 26° C. in the dark for 2 hours.
[0031] Preferably, in step (2.2), 1% by volume of the Vtg-FITC marker purified in step (1.5) is added to the cultured follicles, mixed and placed in a dark place at 26° C. for 12 to 48 hours, then taken out and placed under an Eclipse Ti2-E fluorescence microscope for observation and photography of Vtg uptake.
[0032] The second object of the present invention can be achieved by the following technical solution: application of the in vitro vitellogenin Vtg uptake system for grouper oocytes constructed by the above method in studying the regulatory effect of gonadotropin on the uptake of Vtg by oocytes.
[0033] Furthermore, the application includes the following steps:
[0034] (S1) Different concentrations of follicle-stimulating hormone (FSH) or human chorionic gonadotropin (HCG) were added to the constructed in vitro vitellogenin uptake system of grouper oocytes;
[0035] (S2) After static culture in the dark, the follicles were cultured and the relative content of Vtg-FITC marker (FITC conjugate) was detected by Western Blot;
[0036] (S3) At the same time, RNA was extracted from follicles, and the expression levels of lrp13, lr8, and β-actin genes were analyzed by qPCR after reverse transcription to study the mechanism by which gonadotropins regulate Vtg uptake in oocytes.
[0037] Compared with the prior art, the present invention has the following advantages:
[0038] (1) The present invention establishes for the first time an in vitro vitellogenin Vtg uptake system for grouper oocytes and its construction method;
[0039] (2) In the method of the present invention, the difference in yolk uptake caused by the difference in egg surface area between follicles of different sizes is reduced by using oocytes of the same stage (LV stage);
[0040] (3) The present invention uses Vtg-FITC marker as a means to quantify the amount of Vtg taken up by oocytes;
[0041] (4) The present invention established an in vitro vitellogenin Vtg uptake system for grouper oocytes to conduct a preliminary study on the role of gonadotropin (GTH) in regulating the uptake of Vtg by oocytes. The results showed that FSH can significantly promote the uptake of Vtg by oocytes, and GTH plays an important role in fish vitellogenesis. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1 Figure 1 is the verification results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting (WB) after E2 intramuscular injection induced Vtg synthesis in grouper in Example 1. Figure A is SDS-PAGE analysis of serum from the control group and experimental group, and Figure B is WB analysis of serum from the control group and experimental group;
[0043] Figure 2 Figure 1 is the SDS-PAGE verification result after the serum was initially purified by ultrafiltration centrifuge tube in Example 1. Figure A is the diluted serum; Figure B is the serum purified by ultrafiltration centrifuge tube;
[0044] Figure 3 The results of WB analysis of Vtg-FITC markers in Example 1 are shown in Figure A, which shows Vtg-FITC markers before chromatography; and Figure B shows Vtg-FITC markers after chromatography.
[0045] Figure 4 The uptake of Vtg-FITC marker by oocytes was observed by fluorescence microscopy in Example 1;
[0046] Figure 5 Figure 1 shows the effect of gonadotropins on Vtg uptake by oocytes. Figures A and B show the effect of FSH on Vtg uptake. Figures C and D show the effect of HCG on Vtg uptake. Data are expressed as mean ± SEM (n = 3). Different letters above the error bars indicate statistical differences (p < 0.05).
[0047] Figure 6 The expression levels of lr8- and lrp13 in the FSH-regulated Vtg uptake experiment in Example 1 were detected by real-time fluorescence quantitative detection. The data are expressed as mean ± SEM (n = 3). DETAILED DESCRIPTION
[0048] The application method of the present invention is further described below with reference to specific examples. The following examples and figures are for illustrative purposes only and are not to be construed as limiting the present invention. Unless otherwise specified, the reagent raw materials used in the following examples are conventional commercially available or commercially available biochemical reagent raw materials, and the experimental instruments used are conventional laboratory instruments. Unless otherwise specified, the methods and equipment used in the following examples are conventional methods and equipment used in the art.
[0049] Example 1
[0050] The method for constructing an in vitro vitellogenin Vtg uptake system for grouper oocytes provided in this embodiment comprises the following steps:
[0051] (1.1) Three 1.5-year-old groupers (Epinephelus coioides) were injected intramuscularly with 10 mg / kg of the estrogen estradiol (estradiol-17β, E2, diluted in 0.9% saline) once every 48 hours for a total of three injections. The control group was injected with an equal dose of saline. Twenty-four hours after the third injection, blood was drawn under anesthesia, incubated at 4°C overnight, and then centrifuged at 8000 g for 15 minutes. The supernatant was immediately stored at -80°C until use.
[0052] (1.2) Take 100 μL of the supernatant and add Na2CO3 / NaHCO3 buffer (pH = 9.5) to 4 mL. Centrifuge at 5000 g for 15 min in a 4°C centrifuge using a 4 mL 100K ultrafiltration tube (Merck, USA). Repeat ultrafiltration 5-10 times to obtain preliminarily purified vitellogenin Vtg.
[0053] (1.3) Mix the preliminarily purified Vtg with FITC (Fluorescein Isothiocyanate, FITC) solution at a volume ratio of 1:100, store in the dark at 4°C overnight to prepare Vtg-FITC marker.
[0054] The FITC solution was prepared by the following method: 1 mg of FITC powder (Solar Bio, China) was dissolved in 10 mL of 0.05 M Na2CO3 / NaHCO3 buffer (Zeye Bio, China) with a pH of 9.5.
[0055] (1.4) Use a 4 mL 100K ultrafiltration tube to remove free small FITC molecules from the Vtg-FITC marker. Protect from light. Centrifuge at 5000 g for 15 min at 4°C. Repeat the filtration 5-10 times until the filtrate turns white.
[0056] 1 mL of Vtg-FITC marker was taken and chromatographed on a chromatography column (1.6 cm × 70 cm) assembled with Sephacryl S-300 (Rui Da Heng Hui, China) on an AKTA-pure (GE, USA) instrument using Tris chromatography fluid at a flow rate of 0.5 mL / min. The chromatography temperature was 4°C and the whole process was protected from light. The detection wavelength was 280 nm, and the liquid of the elution peak was collected.
[0057] The Tris chromatography buffer was prepared by adding 4.091 g of NaCl to 1000 mL of 25 mM Tris-HCl buffer (pH = 7.5), and finally adding 1 mM phenylmethylsulfonyl fluoride (PMSF, Fude Biotechnology, China).
[0058] (1.5) Use a 1.5 mL 100K ultrafiltration tube and centrifuge at 5000 g for 15 min in a 4°C centrifuge to enrich the effluent to obtain purified Vtg-FITC labeled product. Add PBS to 1.5 mL and protect from light throughout the operation.
[0059] (2) Construction of an in vitro oocyte culture system
[0060] (2.1) According to the method of Tang Lin (Tang Lin, 2020), female Epinephelus coioides broodstock were completely anesthetized, and the intact ovaries were removed by dissection. The ovaries were immediately cut into fragments in L15 medium (without phenol red), and LV stage (late-vitellogenesis stage) follicles (370-410 μm) were isolated under a dissecting microscope.
[0061] The separated follicles were placed in a 24-well culture plate, with about 60 follicles per well. 1 mL of phenol red-free L15 (containing 1% tertiary antibody) was added to each well and cultured at 26° C. in the dark for 2 hours.
[0062] (2.1) Add 1% volume of purified Vtg-FITC marker to each well, mix gently, and then incubate at 26°C in the dark for 12 hours.
[0063] The cells were taken out after 12 hours and observed and photographed under an Eclipse Ti2-E fluorescence microscope (Nikon, Japan).
[0064] Example 2
[0065] First, an in vitro vitellogenin Vtg uptake system for grouper oocytes was constructed according to the method in Example 1, and the uptake effect was observed using a fluorescence microscope. The specific steps are as follows:
[0066] The successful induction of Vtg was verified by SDS-PAGE and WB on the serum of adolescent female grouper that had been injected intramuscularly with E2 multiple times.
[0067] The results of SDS-PAGE and WB verification after E2 intramuscular injection induced Vtg synthesis in grouper were as follows Figure 1 As shown, Figure A is SDS-PAGE analysis of serum in the control group and experimental group, and Figure B is WB analysis of serum in the control group and experimental group, and the arrow indicates the Vtg band; Figure 1 Figures A and B show that intramuscular injection of E2 can induce large-scale synthesis of Vtg in adolescent female grouper.
[0068] The diluted serum was preliminarily purified using an ultrafiltration centrifuge tube, and the purified blood was detected by SDS-PAGE. The serum was then FITC-coupled, and a Vtg-FITC marker with a relatively single band was obtained using chromatography technology.
[0069] The results of SDS-PAGE verification after preliminary purification of serum by ultrafiltration centrifuge tube are as follows Figure 2 As shown, Figure A shows the diluted serum; Figure B shows the serum purified by ultrafiltration centrifuge tube; Figure 2 Figures A and B show that the serum impurities are significantly reduced after purification by ultrafiltration centrifuge tube, and the purity of Vtg is significantly improved.
[0070] The results of WB analysis of Vtg-FITC labeling were as follows Figure 3 As shown, Figure 3 Figure A shows the Vtg-FITC marker before chromatography; Figure B shows the Vtg-FITC marker after chromatography. Figure 3 As shown in Figures A and B, a single band of Vtg-FITC marker was obtained after chromatography. The chromatographically purified Vtg-FITC marker can be used to observe the uptake of vitellogenin by oocytes in vitro.
[0071] The LV stage follicles of female broodstock of Epinephelus coioides were collected and cultured in phenol red-free L15 medium in dark conditions.
[0072] Purified Vtg-FITC marker was added to the cultured follicles, and after continued culture, the in vitro vitellogenin Vtg uptake system of grouper oocytes was obtained.
[0073] Fluorescence microscopy was used to observe the uptake of Vtg-FITC markers into oocytes. Figure 4 As shown, Figure 4 Significant green fluorescence was observed in the experimental group compared with the control group, indicating that the Vtg-FITC marker was successfully taken up by the oocytes.
[0074] The following study explores the regulatory effect of gonadotropins on oocyte uptake of Vtg, including the following steps:
[0075] (S1) 0, 20, 50, or 100 IU / mL FSH or 0, 20, 50, or 100 IU / mL human chorionic gonadotropin (HCG, Sansheng Biotechnology, China) was added to each well of the oocyte Vtg in vitro uptake system. The cells were incubated at 26°C in the dark for 12 hours, and then the follicles were harvested for subsequent protein extraction.
[0076] (S2) After the follicles were transferred to a 1.5 mL sterile centrifuge tube, the excess culture medium was carefully removed and 100 μL of RIPA protein lysis buffer (Fude Biotechnology, China) was immediately added. Then, PMSF was added to a final concentration of 1 mM and the reagents required for Western blotting were prepared, including 5× Tris-Glycine buffer, 10× Transfer Buffer, 1× TBST solution, and skim milk powder solution.
[0077] Prepare SDS-PAGE gel, for example, 8% separating gel and 5% stacking gel, and electrophorese the above protein sample in freshly prepared 1× Tris-Glycine. Load 10 μL of the sample and run electrophoresis at 70 V constant voltage for about 15 minutes, then change to 100 V constant voltage for 60 minutes.
[0078] The gel was removed and placed in a culture dish. An appropriate amount of Coomassie Brilliant Blue staining solution (Biyuntian, China) was added and stained on a shaker at room temperature for 10 min. After the staining solution was discarded, Coomassie Brilliant Blue destaining solution (Biyuntian, China) was added and placed on a shaker at room temperature for 12 h. The destaining solution was changed every 4 h.
[0079] Western blotting analysis: This experiment used a Vtg antibody (Biosense, USA) at a dilution of 1:5000, a FITC antibody (Proteintech, USA) at a dilution of 1:2000, or a Mouse Monoclonal Beta Actin Antibody (Proteintech, USA) at a dilution of 1:10000. Gel preparation, sample loading, electrophoresis, membrane transfer, color development, and photography were performed.
[0080] Grayscale analysis: Grayscale values were calculated using Image J to determine the relative protein expression. The calculation method was: grayscale of FITC conjugate / grayscale of β-actin = relative content of FITC conjugate. The relative expression of the target protein in the experimental group relative to the control group was then calculated by dividing the experimental group value by the control group value.
[0081] Effects of gonadotropins on oocyte uptake of Vtg Figure 5Figures A and B show the effects of FSH on Vtg uptake; Figures C and D show the effects of HCG on Vtg uptake. Data are presented as mean ± SEM (n = 3). Different letters above the error bars indicate statistical differences (p < 0.05). Figure 5 Figures A and B show that FSH can promote the uptake of Vtg by oocytes in a dose-dependent manner. Figures C and D show that HCG can also promote the uptake of Vtg by oocytes in a dose-dependent manner, but its effect is significantly smaller than that of FSH.
[0082] (S3) Real-time fluorescence quantitative analysis: 30 follicles were collected from each well, placed in liquid nitrogen, and then transferred to −80°C for storage. RNA was extracted, reverse transcribed, and subjected to real-time fluorescence quantitative PCR using pre-designed qPCR primers for the three genes lrp13, lr8, and β-actin (see Table 1).
[0083] Table 1 Real-time fluorescence quantitative primers
[0084] Primer name Sequence (from 5' to 3') lrp13-qF TACAGCCTTCGTGACCACAC (as shown in SEQ ID NO: 1) lrp13-qR TGGTGTTGCCCAGGAGTTTT (as shown in SEQ ID NO: 2) lr8--qF GCAGACCTGAAGCCAACGTG (as shown in SEQ ID NO: 3) lr8--qR CGAAATCGCAGGGTAGGTG (as shown in SEQ ID NO: 4) β-actin-F ACCATCGGCAATGAGAGGTT (as shown in SEQ ID NO: 5) β-actin-R ACATCTGCTGGAAGGTGGAC (as shown in SEQ ID NO: 6)
[0085] Real-time fluorescence quantitative detection of lr8- and lrp13 expression in FSH-regulated Vtg uptake experiments Figure 6 The data are shown as mean ± SEM (n = 3). Figure 6 The results showed that FSH did not change the expression of lr8- and lrp13.
[0086] The data analysis of the above experimental results showed that intramuscular injection of E2 can induce the synthesis of large amounts of Vtg in adolescent female grouper; fluorescence microscopy observation of oocytes incubated with Vtg-FITC marker at 26°C in the dark for 12 hours showed that Vtg-FITC marker was successfully taken up by oocytes; FSH promoted the uptake of Vtg by oocytes through a certain mechanism; and fluorescence quantitative detection results showed that FSH increased the uptake of Vtg not by upregulating the expression of lr8- and lrp13.
[0087] The present invention is not limited to the specific embodiments described above. The embodiments described above are merely intended to illustrate the use of the present invention in detail. Functionally equivalent production methods and technical details are also part of the present invention. In fact, based on the above description, those skilled in the art will be able to find various adjustments according to their respective needs, and such adjustments are intended to be within the scope of the appended claims.
Claims
1. A method for constructing a vitellogenin Vtg uptake system for grouper oocytes in vitro, characterized in that: The following steps are involved: (1) Preparation of fluorescently labeled vitellogenin Vtg-FITC: (1.1) Multiple intramuscular injections of the estrogen estradiol E2 were performed on grouper fish. After the last injection, blood was drawn under anesthesia, allowed to stand overnight, and then centrifuged. The supernatant was collected and stored at low temperature until use. (1.2) taking the supernatant from step (1.1), adjusting the volume with Na2CO3 / NaHCO3 buffer and centrifuging, and performing preliminary purification through an ultrafiltration centrifuge tube to obtain preliminary purified vitellogenin Vtg; (1.3) Mix the preliminarily purified vitellogenin Vtg with Na2CO3 / NaHCO3 buffer solution containing 6-fluorescein isothiocyanate (FITC) powder and incubate in the dark to prepare Vtg-FITC marker; (1.4) Remove free FITC from the Vtg-FITC marker using an ultrafiltration centrifuge tube, then purify the Vtg-FITC marker using a Sephacryl S-300 column, chromatograph using Tris chromatography buffer, and collect the eluate corresponding to the 280 nm UV absorption peak; (1.5) Finally, the purified Vtg-FITC marker was obtained by enrichment and constant volume through ultrafiltration centrifuge tube; (2) Construction of an in vitro oocyte culture system: (2.1) LV-stage follicles from female Epinephelus coioides broodstock were cultured in phenol red-free L15 medium in the dark. (2.2) Adding the Vtg-FITC marker purified in step (1.5) to the cultured follicles, and continuing to culture, thereby obtaining an in vitro vitellogenin Vtg uptake system for grouper oocytes.
2. The method according to claim 1, wherein: In step (1.1), the estrogen estradiol E2 is injected into 1.5-year-old grouper fish, with 2-5 injections at a dose of 3-10 mg / kg each time, and an interval of 12-48 hours between each injection. 12-36 hours after the last injection, blood is drawn under anesthesia, and after standing at 4°C overnight, the blood is centrifuged at 6000-12000g for 10-20 minutes. The supernatant is immediately stored at -80°C for use.
3. The method according to claim 1, wherein: In step (1.2), 50 to 150 μL of serum from grouper was taken, and the serum was supplemented to 4 to 6 mL using a Na2CO3 / NaHCO3 buffer solution with a pH of 8.5 to 9.
5. The serum was centrifuged at 5000 g for 15 min in a 4°C centrifuge using a 4 to 6 mL 100K ultrafiltration tube. The ultrafiltration was repeated 5 to 10 times for preliminary purification to obtain preliminary purified vitellogenin Vtg.
4. The method according to claim 1, wherein: The volume ratio of the vitellogenin Vtg to the Na2CO3 / NaHCO3 buffer solution to which 6-fluorescein isothiocyanate FITC powder is added in step (1.3) is 1:50-300, wherein the amount of 6-fluorescein isothiocyanate FITC powder to the Na2CO3 / NaHCO3 buffer solution is 1 mg:5-25 mL, the pH value of the Na2CO3 / NaHCO3 buffer solution is 8.5-9.5, and the incubation time in the dark is 12-16 hours.
5. The method according to claim 1, wherein: In step (1.4), a 4-6 mL 50-300K ultrafiltration centrifuge tube was used to remove free small molecule FITC from the Vtg-FITC marker. The operation was protected from light and centrifuged at 4000-6000 g in a 4°C centrifuge for 10-20 min. The filtration was repeated 5-10 times until the filtrate was white. In step (1.4), 1 mL of Vtg-FITC marker was taken and a chromatography column with a size of 1.6 cm × 70 cm assembled using Sephacryl S-300 was used on an AKTA-pure instrument. Tris chromatography solution was used at a flow rate of 0.5 mL / min for chromatography. The chromatography temperature was 4°C. The whole process was protected from light, and the eluate corresponding to the 280 nm ultraviolet absorption peak was collected.
6. The method according to claim 1, wherein: In step (1.5), the eluate was enriched by centrifugation at 4000-6000 g for 15-20 min using a 100K ultrafiltration tube in a 4°C centrifuge, and supplemented with PBS to the target concentration. The whole process was performed in the dark to obtain the purified Vtg-FITC marker.
7. The method according to claim 1, wherein: The follicles described in step (2.1) are isolated from the ovarian tissue of female Epinephelus coioides broodstock, and the LV stage follicles are screened under sterile conditions using a dissecting microscope. The phenol red-free L15 culture medium contains 1% of the triple antibody by volume and is cultured at 23-28° C. in the dark for 2-6 hours.
8. The method according to claim 1, wherein: In step (2.2), 1% by volume of the purified Vtg-FITC marker from step (1.5) was added to the cultured follicles. After mixing, the follicles were placed in the dark at 26°C for 12 to 48 hours. The follicles were then taken out and placed under an Eclipse Ti2-E fluorescence microscope to observe and photograph the Vtg uptake.
9. Use of the in vitro vitellogenin Vtg uptake system for grouper oocytes constructed by the method according to any one of claims 1 to 8 in studying the regulatory effect of gonadotropins on Vtg uptake by oocytes.
10. The use according to claim 9, characterized in that The following steps are involved: (S1) Different concentrations of follicle-stimulating hormone (FSH) or human chorionic gonadotropin (HCG) were added to the constructed in vitro vitellogenin uptake system of grouper oocytes; (S2) After static culture in the dark, follicle proteins were extracted and the relative content of Vtg-FITC marker was detected by Western Blot; (S3) At the same time, RNA was extracted from follicles, and the expression levels of lrp13, lr8, and β-actin genes were analyzed by qPCR after reverse transcription to study the mechanism by which gonadotropins regulate Vtg uptake in oocytes.