A melon whole genome 4k liquid breeding chip, single nucleotide polymorphism variation sites special for the chip and application thereof

By using a 4K liquid-phase breeding chip for the whole genome of melon, combined with single nucleotide polymorphism (SNP) variant site probes and liquid-phase chip technology, the problem of low efficiency in melon variety identification and phylogenetic analysis has been solved, achieving efficient and accurate variety identification and accelerating the breeding process.

CN120648849BActive Publication Date: 2026-01-02BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511092418.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-05
Publication Date
2026-01-02
Estimated Expiration
2045-08-05

AI Technical Summary

Technical Problem

Traditional breeding methods are inefficient in meeting the demands for variety and high-quality characteristics in melons, and existing molecular marker technologies have limited applications in the melon field, making it difficult to meet market demands for variety identification and varietal identity verification.

Method used

We developed a 4K liquid-phase breeding chip for the whole genome of melon, containing a probe combination of 4002 single nucleotide polymorphism variation sites. Combined with liquid-phase chip technology, we performed genotyping and constructed a variety fingerprint database to achieve high-throughput, low-cost variety identification and phylogenetic analysis.

Benefits of technology

It enables efficient and accurate identification and phylogenetic analysis of melon varieties, shortens breeding time, protects variety rights, and supports the upgrading of the melon seed industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648849B_ABST
    Figure CN120648849B_ABST
Patent Text Reader

Abstract

The application discloses a 4K liquid-phase breeding chip for melon, single nucleotide polymorphism variation sites special for the 4K liquid-phase breeding chip and application of the 4K liquid-phase breeding chip. The 4K liquid-phase breeding chip provided by the application comprises a probe combination for detecting 4002 single nucleotide polymorphism variation sites in a melon genome, and the position information of the probe corresponding to each single nucleotide polymorphism variation site in a melon reference genome is shown in Table 2 in the specification. The single nucleotide polymorphism variation sites involved in the liquid-phase breeding chip provided by the application have the advantages of high polymorphism, good repeatability, stable and reliable markers, convenience in statistics and the like. The application can also establish a DNA fingerprint database for identifying the authenticity of melon varieties based on the liquid-phase breeding chip, and the DNA fingerprint database can be used for identifying the authenticity of melon varieties, early selection and identification of melon varieties, identification of melon seed resources, and effectively protecting the rights and interests of producers and breeders, and providing technical support for the enrichment of melon germplasm resources, the selection of new varieties and the protection of new varieties.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of melon variety identification, in particular to a melon whole genome 4K liquid breeding chip, a single nucleotide polymorphism (SNP site) specially used for the same and an application thereof. BACKGROUND

[0002] Melon (Cucumis melo L.) is an important fruit crop widely planted in the world, which is favored by consumers for its sweet taste and rich nutritional value, and plays an important role in agricultural economic development. In recent years, consumers' demand for melon variety diversity and high-quality characteristics is increasing, while traditional breeding methods have inherent long cycle and low efficiency, which have been difficult to effectively meet the market demand for melon quality, yield and disease resistance, etc. In addition, the genetic diversity of melon germplasm resources is complex, which further increases the complexity and difficulty of breeding work. Moreover, more than 2000 melon varieties have been applied for registration in China, and the dozens of SSR sites currently used cannot meet the needs of the market supervision department for melon variety identification and derivative variety identification. Therefore, it is urgent to introduce modern biological technology to accelerate the process of melon breeding, strengthen the protection of melon variety intellectual property rights, and provide support for the high-quality development of melon seed industry.

[0003] Molecular markers, as DNA sequence fragments that can reflect certain specific differences in the genomes of organisms or populations, include RAPD, RFLP, SSR, SCAP, InDel and single nucleotide polymorphism. Among them, single nucleotide polymorphism has the advantages of good stability, high density, wide distribution and suitability for large-scale screening, which significantly shortens the breeding time and improves the breeding efficiency. Liquid chip, as an innovative technology in the field of single nucleotide polymorphism detection, realizes higher typing accuracy, greater throughput, lower cost and more flexible design compared with traditional solid chip through probe hybridization target capture sequencing technology, and becomes a high-efficiency preferred solution for single nucleotide polymorphism typing. At present, liquid chip technology has been widely used in wheat, rice and rapeseed breeding, but its application in the field of melon is limited. Therefore, it is particularly important to develop an economical and practical melon liquid chip, which not only helps to promote the innovation and progress of melon breeding technology, but also provides a powerful tool for the upgrading and development of melon seed industry. SUMMARY

[0004] In view of the defects of the prior art, the purpose of the present application is to provide a melon whole genome 4K liquid breeding chip, a single nucleotide polymorphism (SNP site) specially used for the same and an application thereof. The liquid breeding chip can accurately obtain the genotypes of 4002 single nucleotide polymorphism variation sites in the whole genome of melon.

[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0006] Scheme one:

[0007] A probe combination for detecting a combination of single nucleotide polymorphism (SNP site) sites of a whole genome of melon, each single nucleotide polymorphism site corresponding to a probe, the combination of single nucleotide polymorphism sites comprising 4002 single nucleotide polymorphism sites, the positions and base types of the 4002 single nucleotide polymorphism sites in the genome being shown in Table 1 of the specification of the present application, wherein the number on the left represents the chromosome number where the single nucleotide polymorphism site is located, the numerical value in the middle represents the physical position of the chromosome where the single nucleotide polymorphism site is located, and the letter on the right represents the two base types of the single nucleotide polymorphism site; the positions of the 4002 single nucleotide polymorphism sites in the genome are determined based on the melon reference genome "DHL92 V4.0" version.

[0008] In the probe combination of scheme one of the present application, as a preferred embodiment, the sequence of each probe in the probe combination corresponds to the position in the genome, which is shown in Table 2 of the specification of the present application, and the corresponding position is determined based on the melon reference genome "DHL92 V4.0" version, and in Table 2, the information of the corresponding position of each probe comprises three data, from left to right, the first data represents the chromosome number where the single nucleotide polymorphism site is located, the second data represents the starting position on the chromosome where the probe is located, and the third data represents the ending position on the chromosome where the probe is located.

[0009] Scheme two:

[0010] A 4K liquid breeding chip for a whole genome of melon, comprising the probe combination for detecting a combination of single nucleotide polymorphism sites of a whole genome of melon according to scheme one of the present application.

[0011] The liquid breeding chip targets the single nucleotide polymorphism sites for detecting a whole genome of melon according to scheme one to obtain the base information of the polymorphism sites.

[0012] The liquid breeding chip can also comprise other commonly used reagents or equipment required.

[0013] Scheme three:

[0014] The use of the probe combination for detecting a combination of single nucleotide polymorphism sites of a whole genome of melon according to scheme one, the use comprising any one of the following (1) to (7):

[0015] (1) for preparing a kit for identifying melon varieties;

[0016] (2) a kit for preparing a melon variety authenticity identification reagent;

[0017] (3) a kit for preparing a genetic relationship analysis reagent for melon varieties;

[0018] (4) a method for identifying melon varieties;

[0019] (5) a method for identifying the authenticity of melon varieties;

[0020] (6) a method for analyzing the genetic relationship of melon varieties;

[0021] (7) a method for constructing a fingerprint database of a melon variety to be tested.

[0022] Scheme four:

[0023] The use of the melon whole genome 4K liquid breeding chip of scheme two above, the use includes any one of the following (A) to (D);

[0024] (A) for identifying melon varieties;

[0025] (B) for identifying the authenticity of melon varieties;

[0026] (C) for analyzing the genetic relationship of melon varieties;

[0027] (D) for constructing a fingerprint database of a melon variety to be tested.

[0028] Scheme five:

[0029] A method for constructing a fingerprint database of a test melon variety, comprising the following steps:

[0030] S1-1: obtaining genomic DNA of the test melon variety;

[0031] S1-2: the genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library;

[0032] S1-3: combine the DNA library with the probe of scheme one above to form a hybridization system and perform hybridization capture, and purify to obtain a sequencing library;

[0033] S1-4: sequencing and data analysis of the sequencing library to obtain the genotyping information of the 4002 single nucleotide polymorphism variation sites shown in Table 1 of the specification, and constructing a fingerprint database of the test melon variety according to the genotyping information of the 4002 single nucleotide polymorphism variation sites.

[0034] Scheme six:

[0035] A method for identifying a melon variety to be tested, comprising the following steps:

[0036] S2-1: obtaining the genomic DNA of the melon variety to be tested and the standard melon variety, respectively;

[0037] S2-2: obtaining the DNA library of each variety by fragmentation, end repair, adapter ligation and purification of the genomic DNA of each variety obtained in step S2-1;

[0038] S2-3: forming a hybridization system by combining the DNA library of each variety with the probe set of the above-mentioned scheme one and performing hybridization capture, and obtaining the sequencing library of each variety by purification;

[0039] S2-4: sequencing and data analysis of the sequencing library of each variety to obtain the genotyping information of the 4002 single nucleotide polymorphism variation sites shown in Table 1 in the specification of the present application in each variety;

[0040] S2-5: comparing the genotyping results of the 4002 single nucleotide polymorphism variation sites of the melon variety to be tested with the genotyping results of the 4002 single nucleotide polymorphism variation sites of the standard melon variety, respectively, and calculating the similarity LS of the single nucleotide polymorphism variation sites of the two melon varieties, the calculation formula of LS is: LS = (1-D / T) x 100%, wherein D is the number of different single nucleotide polymorphism variation sites between the two varieties compared, and T is the total number of single nucleotide polymorphism variation sites compared; and then the following judgment is made:

[0041] If the site similarity of the melon variety to be tested and a certain standard melon variety is ≥98.0%, the melon variety to be tested and the standard melon variety are the same variety or suspected to be the same variety; the fewer the number of different sites, the higher the site similarity;

[0042] If the site similarity of the melon variety to be tested and a certain standard melon variety is between 96.0% and 98.0% and does not include 98%, the melon variety to be tested and the standard melon variety are approximate varieties;

[0043] If the site similarity of the melon variety to be tested and a certain standard melon variety is <96.0%, the melon variety to be tested and the standard melon variety are different varieties.

[0044] The standard melon variety in the present application refers to a known melon variety, such as the 104 melon varieties recorded in Table 2 of the present application.

[0045] In the method for constructing the fingerprint database of the test melon variety in the above-mentioned scheme five or the method for identifying the melon variety to be tested in the above-mentioned scheme six, as an implementable mode, in step S1-2 or S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, and the system is 300 ng of DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and pure water added to the system to 20 μL.

[0046] In the method for constructing the fingerprint database of the test melon variety in the above-mentioned scheme five or the method for identifying the melon variety to be tested in the above-mentioned scheme six, as an implementable mode, in step S1-2 or S2-2, the reaction system for the linker connection is 10 ng of DNA after end repair, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina trueseq universal linker sequence, and pure water added to 20 μL.

[0047] In the method for constructing the fingerprint database of the test melon variety in the above-mentioned scheme five or the method for identifying the melon variety to be tested in the above-mentioned scheme six, as an implementable mode, in step S1-3 or S2-3, the hybridization system is 2.5 μg of the DNA library obtained in step S2-2 after concentration, 4 μL of probe working solution with a concentration of 50 ng / μL, and pure water added to the system to 16 μL.

[0048] The present application has the following beneficial effects:

[0049] (1) The combination of single nucleotide polymorphism variation sites provided by the present application has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers, and convenience for statistics, and can accurately reflect the genetic relationship of the test melon variety.

[0050] (2) The material background of the combination of single nucleotide polymorphism variation sites involved in the liquid breeding chip covers more extensive melon varieties, is representative, and is rich in diversity information.

[0051] (3) The 4K liquid breeding chip provided by the present application can be applied to the authenticity identification, genetic relationship identification, hybrid breeding and fingerprint construction of melon varieties, and is conducive to accelerating the process of melon research and breeding.

[0052] (4) The present application first provides a method for constructing a DNA fingerprint database for identifying the authenticity of melon varieties based on high-throughput sequencing, which can be used for early identification of melon varieties at the seed or seedling stage, ensures the authenticity of the variety, effectively protects the rights and interests of producers and breeders, and provides technical support for melon germplasm resources and new variety protection.

[0053] (5) The method for identifying melon varieties provided by the application can identify unknown melon varieties and identify the authenticity of known varieties.

[0054] (6) The method provided by the application has the advantages of high throughput, accuracy, low cost, simple operation, saving of manpower and material resources, and has a very broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0055] Figure 1 A distribution map of single nucleotide polymorphism variation sites of the 4K liquid breeding chip in the genome of melon.

[0056] Figure 2 Genotype deletion rate of the 4K liquid breeding chip in 104 representative melon varieties.

[0057] Figure 3 Genotype MAF value of the 4K liquid breeding chip in 104 representative melon varieties.

[0058] Figure 4 A melon fruit skin flower spot trait gene mapping map of single nucleotide polymorphism variation sites of the 4K liquid breeding chip.

[0059] Figure 5 A background recovery rate distribution map of the 4K liquid chip for 125 single plants in a BC2F1 population. DETAILED DESCRIPTION

[0060] The following examples and drawings are provided to facilitate a better understanding of the application, and are intended to explain and illustrate certain aspects or features of the application, but do not limit the application.

[0061] Unless otherwise specified, the technical and scientific terms described in the application are the usual meanings in the art.

[0062] Improvements or technical applications of the embodiments of the application without departing from the spirit or scope of the application are within the protection scope of the application.

[0063] In the following examples, the experimental methods are conventional methods unless otherwise specified. For the liquid chip application method not described in detail in the specification, refer to (Targeted Sequencing Genotype Detection (GBTS) Technology and Its Application, 2020).

[0064] The test materials used in the following examples are commercially available from conventional biochemical reagent stores unless otherwise specified. In the quantitative test in the following examples, three repeated experiments were set up, and the average value was taken as the result.

[0065] Example 1, acquisition of 4K liquid breeding chip single nucleotide polymorphism variation sites of whole genome of melon

[0066] The present application is based on 149 melon resequencing data disclosed in the vegetable whole genome single nucleotide polymorphism variation big data platform VegSNP DB (www.vegsnp db.cn) and "DHL92 V4.0" reference genome information, and screens high-quality single nucleotide polymorphism variation sites that can represent whole genome genetic information and are suitable for targeted sequencing. Specifically, the single nucleotide polymorphism screening criteria are as follows: minimum allele frequency MAF>0.05, genotype heterozygosity<0.1, genotype deletion rate<0.1, and no other single nucleotide polymorphism, SSR and Indel variations in the 50bp flanking region of the single nucleotide polymorphism. Finally, the inventors of the present application screened 4002 single nucleotide polymorphism variation sites evenly distributed on the whole genome of melon, which were used for 4K liquid breeding chip of melon, and had a high polymorphism information content (PIC value). The positions of the 4002 single nucleotide polymorphism variation sites on the chromosomes of melon and the variation bases are shown in Table 1, and the distribution of the 4002 single nucleotide polymorphism variation sites on the 12 chromosomes of melon is shown in Figure 1. Figure 1 The base types and physical positions of the single nucleotide polymorphism variation sites on the chromosomes are determined based on the melon reference genome "DHL92 V4.0" version (http: / / http: / / cucurbitgenomics.org / v2 / ftp / genome / melon / DHL92 / v4.0 / DHL92_genome_v4.fa.gz).

[0067] The single nucleotide polymorphism variation sites involved in the 4K breeding liquid chip of melon are evenly distributed on the chromosomes, with an average interval physical distance of 89.46kb per site, and 58.35% of the variation sites are located in the gene exon region.

[0068] Table 1. Positions of 4002 single nucleotide polymorphism variations on chromosomes and base information

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Note: In the information of single nucleotide polymorphism variation site, the data on the left side of the underscore is the chromosome where the single nucleotide polymorphism variation site is located, the middle numerical value is the physical position of the single nucleotide polymorphism site on the chromosome, and the numerical value on the right side of the underscore is the two genotypes of the single nucleotide polymorphism variation site, wherein the "-" in the two genotypes indicates base deletion.

[0088] Preparation of probes of the melon 4K liquid breeding chip

[0089] The melon 4K liquid breeding chip includes 4002 probe combinations, each of which is hybridized with a single nucleotide polymorphism variation site region to form a double strand. According to the principle of base complementary pairing, an oligonucleotide probe complementary to the target sequence is designed, wherein the probe combination design principle is as follows:

[0090] (1) The average length of the probe is 160 bp, the single nucleotide polymorphism variation site is in the middle position of the probe, and the probe sequence length varies in the range of 109-214 bp;

[0091] (2) The region where the probe is located is relatively conservative (50 bp on both wings without other variations), avoiding regions such as repetitive sequences and structural variations;

[0092] (3) The GC content of the probe is 40%-60%, among which the region with a capture capacity of 50% is stronger, and high GC and high AT regions are avoided.

[0093] The unknown information of 4002 probes in the melon 4K liquid breeding chip is shown in Table 2.

[0094] The probe sequences in Table 2 are synthesized by single-stranded nucleotides, with a length of 109bp to 214bp, an average of 159.4bp, a 5' end modified with a biotin group, and a polystyrene microsphere covalently coupled with biotin.

[0095] Table 2 Position information of probes in melon 4K liquid breeding chip

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114] Note: In the single nucleotide polymorphism variation site information, the leftmost data is the chromosome where the single nucleotide polymorphism variation site is located, the middle value is the starting position of the probe on the chromosome, and the rightmost data is the end position of the probe on the chromosome.

[0115] Example 3, genotype detection efficiency evaluation of melon 4K liquid breeding chip

[0116] A melon whole genome 4K liquid breeding chip involves single nucleotide polymorphism variation sites listed in Table 1 in the above-mentioned Example 1, and the liquid breeding chip includes the probe combination in Example 2. Among them, 4002 single nucleotide polymorphism variation sites correspond to 4002 probes, and each probe is hybridized with a single nucleotide polymorphism variation site to form a double strand.

[0117] In order to evaluate the genotype capture efficiency of 4002 single nucleotide polymorphism variation sites, 104 melon hybrid varieties collected from China were subjected to single nucleotide polymorphism genotyping using the melon 4K liquid breeding chip of the application.

[0118] The basic information of the 104 test melon varieties in this example is shown in Table 3. The 104 test melon varieties are all excellent varieties commonly used in production or some foreign introduced varieties.

[0119] Table 3. Information of 104 melon varieties

[0120]

[0121]

[0122] The detection experiment method of the melon 4K liquid breeding chip includes the following specific steps: obtaining genomic DNA, library construction, hybrid capture, sequencing and data analysis, etc.

[0123] 1. Obtaining genomic DNA of test melon varieties

[0124] The CTAB method was used to extract the genomic DNA of the leaves of the 104 test melon varieties, and the genomic DNA of the test melon varieties was obtained.

[0125] The quality and concentration of the genomic DNA of the test melon varieties must meet the PCR requirements, and the standard is that 1% agarose electrophoresis shows that the DNA band is single and has no obvious dispersion; the ultraviolet spectrophotometer Nanodrop2000 (Thermo) detects that A260 / A280 is between 1.8-2.1 (indicating that the genomic DNA of the test melon varieties has no protein contamination); A260 / A230 is between 1.8-2.1 (indicating that the salt ion concentration of the genomic DNA of the test melon varieties is low); the concentration of the genomic DNA of the test melon varieties is >50 ng / μL.

[0126] 2. Library construction

[0127] Take 300 ng of qualified DNA, add 2.6 μL of fragmentation and end repair enzyme, 4 μL of end repair reaction buffer, and make up the system to 20 μL with ultrapure water. Then treat at 37°C for 30 min and at 72°C for 30 min. After the DNA is fragmented and repaired by the end repair enzyme, A is added to the 3' end;

[0128] Use 10 ng of the repaired DNA obtained in the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illuminatrueseq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and make up to 20 μL with ultrapure water, and treat at 22°C for 60 min. The A-added DNA fragments are connected with the adapter, and the Index and adapter sequences for the sequencer are connected to the ends of the DNA fragments containing the adapter to form a complete library structure. Purify and fragment select the library by adding purified magnetic beads and mixing uniformly by vortexing. Mix the purified and selected fragments equally to form a mixed library.

[0129] 3. Hybridization capture

[0130] Concentrate the mixed library to a dry powder state, and then add a hybridization system to perform hybridization capture. Concentrate 2.5 μg of the library, add 4 μL of a 50 ng / μL probe working solution, make up the system to 16 μL with ultrapure water, treat at 95°C for 10 min, and treat at 65°C for 2-4 h. After hybridization, transfer 16 μL of the hybridization capture solution to a prepared magnetic bead. Purify the enriched product to complete the preparation of the sequencing library.

[0131] 4. Sequencing and data analysis

[0132] Mix the purified product equally to obtain a sequencing library, and perform high-throughput sequencing using a Huada T7 sequencer. According to the barcode of different samples, split the raw sequencing bases, filter low-quality sequencing data, align with the melon reference genome ("DHL92 V4.0"), mine single nucleotide polymorphism variation information, and obtain the corresponding single nucleotide polymorphism genotype according to the obtained single nucleotide polymorphism variation information, thereby constructing a fingerprint of the test variety.

[0133] 5. Efficiency evaluation

[0134] After testing 104 test melon samples, the genotype data detection rate of the melon 4K liquid chromatography breeding chip was 98.75% on average ( Figure 2 ). By statistically analyzing the minimum allele frequency (MAF) of 4002 single nucleotide polymorphism variations, the MAF value of 97.7% of the single nucleotide polymorphism variation sites was greater than 0.05, and the average MAF value was 0.35 ( Figure 3), which indicates that the melon 4K liquid breeding chip developed by the application has high polymorphism in 104 melon test varieties.

[0135] Example 4, application of melon 4K liquid chip in the positioning of fruit skin flower spot trait gene

[0136] Through investigating the fruit skin phenotype data of 104 melon varieties, and combining the whole genome association analysis of the 4K liquid chip genotype data, the gene controlling the melon fruit skin flower spot trait is positioned between 25,621,981 and 25,806,448 of chromosome 2 Figure 4 ), and there is a key gene ARR5 (MELO3C017128, two-component response regulator) regulating chlorophyll synthesis in the interval. In the research of melon fruit skin flower spot, the research results of Lv Jianchun show that the fruit skin flower spot and non-fruit skin flower spot traits are controlled by a single gene CmSP-1, which is located at the end of chromosome 2, 22,160,000-26,180,000 bp, with a total length of 3.94 Mb (Lv Jianchun, Genetic analysis and gene positioning of fruit skin flower spot of thin-skinned melon, China Agricultural University dissertation, 2018). This is consistent with the results of the article published by Lv Jianchun, indicating the accuracy of the liquid chip in genetic map construction and QTL positioning of important agronomic traits of fruit skin flower spot.

[0137] Example 5, method for detecting whether a to-be-tested melon variety belongs to one of the 104 test melon varieties

[0138] 1. Obtaining the genomic DNA of the to-be-tested melon variety

[0139] The leaves of the to-be-tested melon variety “Jingyuhuapicui” were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agriculture and Forestry Sciences.

[0140] According to the method of step 1 in Example 3, replace “leaves of the test melon variety” with “leaves of the to-be-tested melon variety”, and the other steps remain unchanged, to obtain the genomic DNA of the to-be-tested melon variety.

[0141] 2. Preparation of sequencing library

[0142] According to the method of step 2 in Example 3, replace “genomic DNA of the test melon variety” with “genomic DNA of the to-be-tested melon variety”, and the other steps remain unchanged, to obtain the sequencing library of the to-be-tested melon variety.

[0143] 3. Hybrid capture

[0144] According to the method of step 3 in Example 3.

[0145] 4. Sequencing

[0146] Taking the sequencing library of the melon variety to be tested, sequencing.

[0147] The sequencing results of the 4002 single nucleotide polymorphism amplification products of the melon variety to be tested in the melon 4K liquid breeding chip are compared with the 4002 single nucleotide polymorphism variation sites of 104 test melon varieties (shown in Table 3), and the site similarity LS of the two melon varieties is counted, wherein:

[0148] The LS calculation formula is: LS = (1-D / T) x 100%, wherein D is the number of difference sites between the two samples compared, and T is the total number of sites compared. Then the following judgment is made:

[0149] If the site similarity of the melon variety to be tested and a standard melon variety (test melon variety) is ≥98.0%, the melon variety to be tested and the standard melon variety are suspected to be the same variety; the fewer the number of difference sites, the higher the site similarity;

[0150] If the site similarity of the melon variety to be tested and a standard melon variety (test melon variety) is between 96.0% and 98.0% and does not include 98%, the melon variety to be tested and the standard melon variety are approximate varieties.

[0151] If the site similarity of the melon variety to be tested and a standard melon variety is <96.0%, the melon variety to be tested and the standard melon variety are different varieties.

[0152] The results show that the genetic similarity of the melon variety to be tested and the 104 test melon varieties at the 4002 single nucleotide polymorphism variation sites is 91%, and therefore, the melon variety to be tested does not belong to any of the 104 test melon varieties, i.e., the melon variety to be tested “Jingyuhuapicui” is not the same as any of the 104 test melon varieties.

[0153] Example 6, constructing a DNA fingerprint database of 104 melon varieties

[0154] The melon 4K liquid breeding chip developed in the present application can be used to construct a DNA fingerprint database of 104 melon varieties, and establish a unique DNA fingerprint molecular identity card for each variety resource.

[0155] According to the 4002 nucleotide variation information in Example 1 and the 104 test melon varieties in Example 3, the method of Example 3 can be used to quickly construct a DNA fingerprint database of 104 melon varieties, and provide data support for whether the newly collected variety resources are introduced into the DNA fingerprint database in the future.

[0156] Example 7, screening single plants for rapid recovery of background in backcross breeding

[0157] The 4K liquid breeding chip of melon developed by the application can be used for identifying and quickly determining the genome percentage of each single plant of the backcross breeding offspring, and providing data support for screening the backcross offspring with high background recovery rate.

[0158] According to the 4002 nucleotide variation information in embodiment 1, the genotypes of 125 single plants of a BC2F1 population constructed by the donor parent TZ1126 and the recurrent parent TZ83 are identified at the seedling stage, 2565 SNP variations existing between the donor parent and the recurrent parent are screened, the proportion of the recurrent parent genotype in the 125 single plants is calculated, the proportion of the recurrent parent genotype of 96% is taken as the selection standard of recovering the recurrent parent background, and finally 4 single plants are selected (see Table 1). Figure 5 ), and the field phenotype has no significant difference with the recurrent parent, which significantly improves the identification efficiency and saves the field planting cost.

Claims

1. A probe combination for detecting a combination of single nucleotide polymorphism variant sites of a whole genome of Cucumis melo, each single nucleotide polymorphism variant site corresponding to a probe, the combination of single nucleotide polymorphism variant sites consisting of four thousand and two single nucleotide polymorphism variant sites, the positions and base types of the four thousand and two single nucleotide polymorphism variant sites in the genome being as shown in Table 1 of the specification, wherein, The left number represents the chromosome number where the single nucleotide polymorphism variation site is located, the middle value represents the physical position of the chromosome where the single nucleotide polymorphism variation site is located, and the right letter represents the two base types of the single nucleotide polymorphism variation site; The corresponding positions of the nucleotide sequences of each probe in the probe combination in the genome are shown in Table 2 of the specification, and each probe corresponding position contains three data from left to right, the first data represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data represents the starting position on the chromosome where the probe is located, and the third data represents the ending position on the chromosome where the probe is located; The positions of the four thousand and two single nucleotide polymorphism variation sites in the genome and the corresponding positions of the nucleotide sequences of each probe in the probe combination in the genome are determined based on the melon reference genome "DHL92 V4.0" version.

2. A melon whole genome 4K liquid breeding chip, characterized in that, The probe combination for detecting the combination of whole genome single nucleotide polymorphism variation sites of melon according to claim 1.

3. Use of a probe combination, characterized in that The probe combination for detecting the combination of whole genome single nucleotide polymorphism variation sites of melon according to claim 1, the use includes any one of the following (1) to (7): (1) for preparing a kit for identifying melon varieties; (2) for preparing a kit for identifying the authenticity of melon varieties; (3) for preparing a kit for analyzing the genetic relationship of melon varieties; (4) for identifying melon varieties; (5) for identifying the authenticity of melon varieties; (6) for analyzing the genetic relationship of melon varieties; (7) for constructing a fingerprint database of the melon variety to be tested.

4. Use of a melon whole genome 4K liquid breeding chip, characterized in that, The use of the whole genome 4K liquid breeding chip of melon according to claim 2 includes any one of the following (A) to (D): (A) for identifying melon varieties; (B) for identifying the authenticity of melon varieties; (C) for analyzing the genetic relationship of melon varieties; (D) for constructing a fingerprint database of the melon variety to be tested.

5. A method for constructing a database of fingerprints of test melon varieties, characterized in that, The steps include: S1-1: obtaining the genomic DNA of the test melon variety; S1-2: obtaining the DNA library by crushing, end repair, adapter ligation and purification of the genomic DNA obtained in step S1-1; S1-3: forming a hybridization system by hybridizing the DNA library and the probe combination for detecting the combination of whole genome single nucleotide polymorphism variation sites of melon according to claim 1, and performing hybridization capture, and obtaining a sequencing library by purification; S1-4: sequencing and data analysis of the sequencing library to obtain the genotyping information of the four thousand and two single nucleotide polymorphism variation sites according to claim 1, and constructing a fingerprint database of the test melon variety according to the genotyping information of the four thousand and two single nucleotide polymorphism variation sites.

6. A method of identifying a melon variety to be tested, characterized in that, The steps include: S2-1: respectively obtaining the genomic DNA of the melon variety to be tested and the standard melon variety; S2-2: The genomic DNA of each variety obtained in step S2-1 is subjected to fragmentation, end repair, adapter ligation and purification to obtain a DNA library of the corresponding variety; S2-3: The DNA library of each variety is combined with the probe combination for detecting the single nucleotide polymorphism variation sites in the whole genome of C. melo according to claim 1 to form a hybridization system and perform hybridization capture, and the sequencing library of each variety is obtained after purification; S2-4: The sequencing library of each variety is sequenced and data analyzed to obtain the genotyping information of the 4,002 single nucleotide polymorphism variation sites in each variety according to claim 1; S2-5: The genotyping results of the 4,002 single nucleotide polymorphism variation sites of the C. melo variety to be tested are compared with the genotyping results of the 4,002 single nucleotide polymorphism variation sites of the standard C. melo variety, and the similarity LS of the single nucleotide polymorphism variation sites of the two C. melo varieties is calculated, the calculation formula of LS is: LS = (1-D / T) x 100%, wherein D is the number of different single nucleotide polymorphism variation sites between the two varieties compared, and T is the total number of single nucleotide polymorphism variation sites compared; then the following judgment is made: If the similarity of the sites of the C. melo variety to be tested and a standard C. melo variety is greater than or equal to 98.0%, the C. melo variety to be tested and the standard C. melo variety are the same variety; If the similarity of the sites of the C. melo variety to be tested and a standard C. melo variety is between 96.0% and 98.0% and does not include 98%, the C. melo variety to be tested and the standard C. melo variety are approximate varieties; If the similarity of the sites of the C. melo variety to be tested and a standard C. melo variety is less than 96.0%, the C. melo variety to be tested and the standard C. melo variety are different varieties.

7. The method for identifying the C. melo variety to be tested according to claim 6, characterized in that: In step S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, and the system is: 300 ng of DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and the system is supplemented with ultrapure water to 20 μL.

8. The method for identifying the C. melo variety to be tested according to claim 6, characterized in that: In step S2-2, the reaction system of the adapter ligation is 10 ng of DNA after end repair, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina trueseq universal adapter sequence, and the system is supplemented with ultrapure water to 20 μL.

9. The method for identifying the C. melo variety to be tested according to claim 6, characterized in that: In step S2-3, the hybridization system is 2.5 μg of the DNA library obtained after concentration in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and the system is supplemented with ultrapure water to 16 μL.

Citation Information

Patent Citations

  • Method for identifying authenticity of melon varieties and special SSR primer combinations of method

    CN110331226A

  • Melon liquid phase chip and application thereof

    CN118421817A