Improved system for producing RNA-packaged AAV particles

Abstract

Provided herein are helicases, Rep proteins comprising helicases, and systems and methods for producing RNA-packaged AAV particles using Rep proteins.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority and filing dates of PCT / CN2022 / 137625, filed on December 8, 2022, and PCT / CN2023 / 124077, filed on October 11, 2023, the entire contents of which (including any drawings and sequence listing) are incorporated herein by reference.

[0003] References to electronic sequence listings

[0004] This disclosure contains a sequence listing XML file that has been electronically submitted in XML format, and the sequence listing is hereby incorporated by reference in its entirety. The XML copy, created on December 8, 2023 by the software "WIPO Sequence" in accordance with WIPO Standard ST.26, is named HGP030PCT.xml and is 526,281 bytes in size.

[0005] According to WIPO Standard ST.26, the symbol "t" is used to represent both T in DNA and U in RNA. Therefore, in this sequence listing prepared according to ST.26, in any case where the sequence is RNA, T in the sequence should be regarded as U. Background Art

[0006] Applicant's previous WO 2022 / 166954 (PCT / CN2022 / 075366), which is incorporated herein by reference in its entirety including any figures and sequence listing thereof, presents RNA sequences that can be packaged into DNA virus (e.g., AAV) viral particles to produce RNA-packaged DNA viral particles (e.g., RNA-packaged AAV (rAAV) particles), and systems for packaging RNA sequences into DNA virus (e.g., AAV) viral particles. It is desirable to increase desirable RNA packaging and / or reduce undesirable DNA packaging of (e.g., rAAV) packaging systems.

[0007] Citation or identification of any document in this disclosure is not an admission that such document is available as prior art to the present disclosure. Each reference mentioned or cited in this disclosure is hereby incorporated by reference in its entirety. Summary of the Invention

[0008] The present disclosure addresses the above-mentioned needs by providing a rAAV packaging system with increased RNA packaging capacity (efficiency) and / or decreased DNA packaging capacity (efficiency) using Rep proteins containing mutated helicase domains that are believed to have increased RNA unwinding properties and / or decreased DNA unwinding properties.

[0009] In one aspect, the present disclosure provides a Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0010] In another aspect, the present disclosure provides a polynucleotide encoding a Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0011] In yet another aspect, the present disclosure provides a polynucleotide encoding a Rep78 protein, a Rep68 protein, a Rep52 protein, and a Rep40 protein, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein, and the Rep40 protein share a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0012] In yet another aspect, the present disclosure provides a helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (eg, SEQ ID NO: 186).

[0013] In yet another aspect, the present disclosure provides a polynucleotide encoding a helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (eg, SEQ ID NO: 186).

[0014] In yet another aspect, the present disclosure provides a RAAV packaging system, and in particular, provides a system for packaging RNA into AAV capsids to produce recombinant RNA-packaged AAV particles (rRAAV particles).

[0015] wherein the RNA comprises:

[0016] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0017] The system comprises:

[0018] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0019] (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186);

[0020] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0021] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0022] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0023] In yet another aspect, the present disclosure provides a RAAV packaging method, and in particular, provides a method for producing recombinant RNA-packaged AAV particles (rRAAV particles), the method comprising:

[0024] a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and

[0025] b) harvesting the rRAAV particles or populations thereof;

[0026] wherein the RNA comprises:

[0027] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0028] The system comprises:

[0029] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0030] (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186);

[0031] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0032] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0033] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0034] In yet another aspect, the present disclosure provides a use of a Rep protein (e.g., Rep78, Rep68, Rep52, Rep40) or a polynucleotide encoding the Rep protein in producing recombinant RNA-packaged AAV particles (rRAAV particles), wherein the Rep protein comprises a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186), the production comprising:

[0035] a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and

[0036] b) harvesting the rRAAV particles or populations thereof;

[0037] wherein the RNA comprises:

[0038] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0039] The system comprises:

[0040] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0041] (2) one or more of the Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0042] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0043] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0044] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0045] In yet another aspect, the present disclosure provides a vector comprising the polynucleotide of the present disclosure; optionally, wherein the vector is a plasmid.

[0046] In yet another aspect, the disclosure provides a cell, an isolated cell, a host cell, or an isolated host cell comprising a Rep protein, helicase, polynucleotide, system, or vector of the disclosure.

[0047] In yet another aspect, the present disclosure provides a recombinant RNA-packaged AAV particle (rRAAV particle) or a population thereof produced by the method of the present disclosure.

[0048] The details of one or more embodiments of the present disclosure are set forth in the following description. Other features or advantages of the present disclosure should be clear from the following drawings and detailed description of several embodiments and from the appended claims. It should be understood that, unless otherwise indicated, any aspect or embodiment of the present disclosure may be combined with any other aspect or embodiments of the present disclosure (including aspects or embodiments described only in a subsection, only in the examples, or only in the claims) to constitute another embodiment disclosed herein, explicitly or implicitly. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] An understanding of certain features and advantages of the present disclosure will be gained by referring to the following detailed description, which sets forth illustrative embodiments in which the principles of the present disclosure may be utilized, and to the accompanying drawings, in which:

[0050] Figure 1A The structure and sequence of the wild-type ITR of AAV2 are shown, including the A:A' stem region sequence, B:B' and C:C' T region sequences, and the unpaired D region sequence in both the forward (SEQ ID NO: 5) and inverted (SEQ ID NO: 28) configurations of the 3' ITR. The RBE, RBE', and TRS are also shown.

[0051] Figure 1B and Figure 1C 5' from AAV1-7 (SEQ ID NOs: 40, 25, 27, 29, 31, 33, 35 and 37, respectively, in order of appearance) ( Figure 1B ) and 3' (SEQ ID NOs: 41, 26, 28, 30, 32, 34, 36 and 38, respectively, in order of appearance) ( Figure 1C )Multiple sequence alignment of ITR sequences.

[0052] Figure 2 The life cycle of an AAV vector / virion and an RAAV vector / virion of the present invention is shown.

[0053] Figure 3 Schematic diagram of the transgenic plasmids of the RAAV-ITR vector and the control vector, showing the relative positions and orientations of the promoter (e.g., CAG promoter or "C"), GOI coding sequence (e.g., coding sequence of the reporter gene tdTomato or "T"), WPRE sequence (or "W"), SV40 poly A signal sequence (or "S"), and wild-type ITR, mutant / optimized ITR (dITR or dITR-D).

[0054] Figure 4 Schematic diagram showing the generation of AAV vectors and RAAV-ITR vectors using a three-plasmid system. Recombinant AAV or RAAV viral vectors can be generated by co-transfecting three plasmids (e.g., a transgenic plasmid, a packaging plasmid, and a helper plasmid) into suitable packaging cells such as HEK293 cells. Green ITR represents wild-type ITR, and yellow ITR represents optimized ITR. pCAG-transgenic, pCAG-transgenic-ITR, and pCAG-ITR-transgenic-ITR are transgenic plasmids; pAAV-rep / cap is a packaging plasmid; and pHelper is a helper plasmid.

[0055] Figure 5A and Figure 5B A representative viral vector titration process is shown. Figure 5A Figure 4 is a flow chart of RAAV titration. Figure 5B Primers and probes for Q-PCR are shown.

[0056] Figures 6A-6C Titration of RAAV-ITR vectors is shown. Figure 6A Titration of the CITWS group is shown. Figure 6B Titration of the CTWIS group is shown. Figure 6C Titration of the CITWIS group is shown.

[0057] Figure 7A and Figure 7B Titration and infection of RAAV-dITR-D vector are shown. Figure 7A Titration of rAAV-dITR-D vector is shown. Figure 7B In vitro infection of RAAV-dITR-D vector is shown. The same volume (5 μL) of purified RAAV-dITR-D vector has been used to infect 2×10 5 HEK293T cells were infected. Fluorescence images were taken 3 and 5 days after infection.

[0058] Figure 8A is a schematic diagram (not to scale) showing different plasmid constructs used to demonstrate efficient packaging of RNA into RAAV particles.

[0059] Figure 8B Figure 3 shows the results of specific DNA and RNA packaging of AAV-tdTomato and RAAV-tdTomato constructs by detecting the WPRE sequence in the packaged DNA or RNA. Efficient RNA packaging occurs when both the heterologous RNA packaging signal (RPS) and its cognate RPS binding protein (RBP, such as MCP of MS2) are present.

[0060] Figures 9A-9C Shown is reduced DNA packaging when an enlarged plasmid backbone is used. Figure 9A is used to generate Figure 9B and Figure 9C Schematic diagram (not to scale) of various plasmids used in the results, including a plasmid with a longer backbone sequence due to an inserted stuffer region (L-CTWM3S). Figure 9B Specific DNA packaging of AAV-tdTomato and RAAV-tdTomato was shown by detecting the presence of the CAG promoter sequence using a CAG-specific primer pair. Figure 9C Specific DNA and RNA packaging of AAV-tdTomato and RAAV-tdTomato was demonstrated by using a WPRE-specific primer pair to detect the presence of the WPRE sequence. The results show that the use of an enlarged / extended plasmid backbone sequence with a stuffer sequence unexpectedly reduced unwanted DNA packaging by approximately 2-fold.

[0061] Figure 10A and Figure 10BDemonstrated efficient packaging of the Cre transgene into rAAV using the MS2 / MCP packaging system. Figure 10A Figure 3 shows specific DNA packaging of AAV-Cre and RAAV-Cre by detecting the presence of the CAG promoter sequence using a CAG-specific primer pair. Note that the CAG sequence is not present in RAAV RNA sequences, and the detected RNA signal is a background signal. Figure 10B Specific DNA and RNA packaging of AAV-Cre and RAAV-Cre is shown by detecting the presence of the WPRE sequence using a WPRE-specific primer pair.

[0062] Figures 11A-11B RPS / RBP was shown to improve RNA packaging of conventional AAV. Figure 11A Shown are the results for AAV genome packaging when only the DNA packaging signal (ie, ITR) is present. Figure 11B Packaging of the AAV genome in the presence of both DNA packaging signals (ITR) and RNA packaging signals (MS2X3) is shown.

[0063] Figures 12A-12D Results of optimizing the RAAV system and identifying optimized RAAV properties are shown. Figure 12A The specific genome packaging of AAV-Cre and RAAV-Cre was demonstrated by detecting the WPRE sequence. Figure 12B The specific genome packaging of AAV-Cre and RAAV-Cre was demonstrated by detecting the Cre sequence. Figure 12C Silver staining analysis of the composition of AAV and RAAV particles is shown. Figure 12D Shown are morphological analyses of AAV and RAAV particles by TEM, scale bar is 100 nm.

[0064] Figure 13A and Figure 13B Results showing reduction of DNA packaging of AAV and RAAV. Figure 13A Engineered Rep was shown to reduce DNA packaging of conventional AAV. Figure 13B It was shown that DNA packaging in RAAV was reduced by using various mutant MCP fusion proteins, including the double mutant MCP fusion protein DJ-MCPX2.

[0065] Figures 14A-14D The RAAV virus particles expressed functional transgene-encoded proteins. Figures 14A-14C Specified in the same way. Figure 14A Shown is the time course of Cre mRNA levels in infected cells. Figure 14B Shown are the fold changes in Cre mRNA levels in infected cells 20 hours after infection. Figure 14CShown is the time course of Cre DNA levels in infected cells. Figure 14D Shown are the percentages of infected cells quantified by flow cytometry 5 days after infection, n=2 replicates.

[0066] Figures 15A-15D Shown are the results of DNA and mRNA analysis of Ai9-MEF cells infected with AAV or RAAV. Figure 15A The Ct values ​​of Cre mRNA are shown. Figure 15B The Ct values ​​of Cre DNA are shown. Figure 15C The Ct value of GAPDH mRNA is shown. Figure 15D The Ct value of 36B4 DNA is shown.

[0067] Figure 16 Genotype identification of Ai9-MEF cells is shown.

[0068] Figures 17A-17B Transient transfer of RAAV particles is shown. Figure 17A Western blot analysis showing the lifespan of Cre protein in infected cells after traditional AAV delivery. Figure 17B Western blot analysis showing the lifespan of Cre protein in infected cells after RAAV delivery.

[0069] Figure 18 Additional functional RPS / RBP pairs tested in the RAAV system are shown - the PP7 / PCP pair and the com / COM pair.

[0070] Figure 19 The RAAV system was shown to be applicable to various AAV serotypes, including AAV-DJ, AAV5, AAV8, and AAV9.

[0071] Figure 20A and Figure 20B Additional AAP and MCP fusion proteins were shown to increase RAAV production. Figure 20A This indicates the specific genome packaging of RAAV-Cre by detecting the Cre sequence. Figure 20B Shown is a comparison of RNA packaging efficiency of RAAVs with AAP N- or C-terminal fusions (AM or MA fusion constructs).

[0072] Figures 21A-21D Shown are the results of transient transfer of RAAV-Cre into the hippocampus of Ai9- mice. Figure 21A Shown is the transfer of high-dose AAV-Cre into the hippocampus of Ai9- mice. Figure 21B Shown is the transfer of low-dose AAV-Cre into the hippocampus of Ai9- mice. Figure 21C Shown is the transfer of high-dose RAAV-Cre into the hippocampus of Ai9- mice. Figure 21D Results in control mice are shown. Red signal: tdTomato; Green signal: Cre; Blue signal: DAPI (nuclear staining).

[0073] Figure 22 The establishment of the RAAV system for producing AAV carrying mRNA is shown. Figure 22 A. Principles of conventional AAV production. ITR, inverted terminal repeat; CAG, CAG promoter; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; pA, poly(A). Figure 22 B. Schematic diagram of the rAAV system. RPS, RNA packaging signal; RBP, RPS-binding protein. RBP is fused to the N-terminus of Rep78 / 68. Figure 22 C and Figure 22 D. Use targeted WPRE ( Figure 22 C) and CAG promoter ( Figure 22 Primers (D) were used to quantify tdTomato-encoding RNA and DNA encapsidated in RAAV and AAV by RT-qPCR and qPCR. RAAV-v1, first-generation RAAV system; MCP, MS2 coat protein; 1× or 3× MS2, one or three copies of the MS2 stem-loop; vg / dish, vector genomes / 15-cm dish. Data are shown as individual data points and mean ± SD of n = 3 biological replicates. Figure 22 E. Cre-encoding RNA and DNA encapsidated in RAAV and AAV were quantified by RT-qPCR and qPCR using primers targeting WPRE. Data are shown as individual data points and mean ± range of n=2 biological replicates. Figure 22 F. Principle of the RAAV-v2 system. The Y156F mutation was introduced into the MCP fusion Rep78 / 68 in RAAV-v1 to abolish its endonuclease activity, thereby hindering undesirable DNA release and packaging. Figure 22 G. Cre RNA and DNA encapsidated in RAAV produced by the RAAV-v2 system were quantified by RT-qPCR and qPCR using primers targeting WPRE. Data are shown as mean ± SD of individual data points and n = 3 biological replicates; unpaired two-tailed t-test; **P < 0.01; ns, not significant. Figure 22 H. Two other RPS / RBP pairs were tested in the rAAV-v2 system. PP7, PP7 binding site; PCP, PP7 bacteriophage coat protein; COM, COM binding site; COM, bacteriophage COM protein. Figure 22 I. Different AAV serotypes were tested in the rAAV-v2 system.

[0074] Figure 23 Helicase engineering is shown to improve RAAV productivity. Figure 23 A. Schematic diagram of the helicase domain in the AAV2 Rep78 protein. All AAV2 Rep proteins (including Rep78, Rep68, Rep50, and Rep42) contain a helicase domain. Figure 23 B. Workflow of the helicase mutagenesis experiment. rAAV was generated using the artificial capsid DJ. ssDNA, single-stranded DNA; ssRNA, single-stranded RNA. Figure 23 C. Measurement of single helicase mutations in rAAV production. Dashed line set at Y = 3. Top candidates are marked as red dots. Figure 23 D. Measuring combinatorial helicase mutations in rAAV production. Single mutations derived from the same or different motifs were combined and assessed for RNA packaging capacity. The dashed line was set at Y = 4. The top candidate is marked as a red dot. Figure 23 E. Comparison of RNA and DNA packaging capacity of mutant helicases with wild-type helicases in the rAAV-v2 system. Data are shown as mean ± range of individual data points and n = 2 biological replicates. Figure 23 F. Quantification of Cre RNA and Cre DNA encapsidated in rAAV produced using the rAAV-v3 system by RT-qPCR and qPCR using primers targeting WPRE. optCre, optimized Cre coding sequence. vg / dish, vector genomes / 15-cm dish. Data are shown as mean ± SD for individual data points and n = 3 biological replicates; unpaired two-tailed t-test, *P < 0.05, **P < 0.01; ns, not significant.

[0075] Figure 24 Characterization of RAAV characteristics is shown. Figure 24 A. Morphological analysis of rAAV and AAV by transmission electron microscopy. rAAV and AAV were generated using the artificial capsid DJ. Bottom image is a magnified version of the image. Scale bar, 50 nm. Figure 24 B. Analysis of AAV and RAAV composition by silver staining. Figure 24 C and Figure 24 D. Characterization of the purity of AAV-DJ-Cre (C) and RAAV-DJ-v3-optCre (D) by analytical ultracentrifugation assay. Figure 24 E. Schematic diagram of viral vector genome analysis on denaturing agarose gel. The theoretical genome sizes of rAAV-DJ-v3-optCre and AAV-DJ-Cre are shown in the image. Figure 24 F. Using SYBR TMThe genomes of RAAV and AAV were analyzed on denaturing agarose gels stained with Green II. DNAse I (DNase I) and RNAse I (RNase I) treatment groups were set up to identify the RAAV genome. Figure 24 G. Workflow for sequencing-based analysis of rAAV genomes. rAAV and AAV were generated using the artificial capsid DJ. Figure 24 H. Differential mRNA abundance and significance of VLP fractions in the presence or absence of MCP. Figure 24 I. Alignment of sequencing reads shows the Figure 24 G and Figure 24 Sequencing coverage of optCre mRNA of H. Figure 24 J. Schematic diagram of transgene expression cassettes of varying lengths used to assess rAAV packaging capacity. Four qPCR primers targeting different regions of the mRNA transcribed from the transgene cassette are shown. rAAV and AAV were generated using the artificial capsid DJ. SA, splice acceptor site. Figure 24 K. Assessment of RAAV packaging capacity. RNA and DNA encapsidated in RAAV were quantified by RT-qPCR and qPCR using primers targeting different regions of the mRNA. vg / dish, vector genomes / 15-cm dish. Data are shown as individual data points and mean ± range of n = 2 biological replicates.

[0076] Figure 25 RAAV was shown to be able to efficiently transfer mRNA to target cells for transient expression of functional proteins. Figure 25 A. Schematic diagram of RAAV / AAV in vitro infection assay. Artificial capsid DJ was used to generate negative controls (no MS2, no MCP and no Cap) for RAAV, AAV and AAV / RAAV. MOI was calculated using vector genome titer. The amount of DNA in RAAV, RAAV without MS2 and RAAV without MCP was normalized. The volume of RAAV and RAAV without Cap was normalized during infection. For all Ai9-MEF infection experiments, cells were seeded on 48-well plates at a density of 5E4 cells / well 24 hours before infection. Figure 25 B. Analysis of tdTomato by cytometry 5 days after infection + The infectivity of RAAV and AAV was investigated by measuring the percentage of Ai9-MEFs. Data are shown as mean ± SD of individual data points and n = 3 biological replicates, multiple unpaired t-test; ns, not significant. Figure 25 C and Figure 25D. Time course of Cre DNA (C) and mRNA (D) levels in RAAV / AAV-infected Ai9-MEFs. Mock: uninfected control. Data are shown as mean ± SD of n = 3 biological replicates. Figure 25 E. Western blot analysis of Cre protein levels and lifespan in RAAV / AAV-infected Ai9-MEFs. RAAV-DJ-v3-optCre was used to infect Ai9-MEFs at an MOI of 3,000 vg, while AAV-DJ-Cre was used to infect Ai9-MEFs at an MOI of 300 vg. Tubulin was used as a loading control. Figure 25 F. Spatial distribution of viral RNA and DNA over time in RAAV / AAV-infected cells. HeLa cells were infected with RAAV / AAV. At different time points after infection, cells were fixed and processed for RNAscope analysis. Cell nuclei were visualized using DAPI staining. Viral RNA and DNA were detected using DNA probes that bind to Cre mRNA and DNA. Red arrows, RNA signals accumulated in the cytoplasm; Scale bar, 50 μm. Figure 25 G. Indels at the hTTR locus in hTTR-gRNA-HEK293T cells infected with rAAV-DJ-v3 or AAV-DJ-Cas12Max. Indels were quantified by NGS 120 hours after viral vector addition. Figure 25 H. NGS analysis of off-target effects in hTTR-gRNA-HEK293T cells infected with RAAV-DJ-v3 or AAV-DJ-Cas12Max. Off-target sites of hTTR-gRNA were predicted by Cas-OFFinder (33). Indels at predicted off-target sites were quantified by NGS 120 hours after RAAV / AAV infection. Figure 25 I. Quantification of Cas12Max DNA copy number in hTTR-gRNA-HEK293T cells infected with rAAV / AAV. (G to I) Mock: uninfected control. MOI calculation was performed using vector genome titer. Data are mean ± SD of n = 3 biological replicates, unpaired two-tailed t-test; *P < 0.05, ****P < 0.0001; ns, not significant.

[0077] Figure 26 It was shown that RAAV is capable of tropism-dependent delivery of mRNA to target tissues / organs for transient expression of functional proteins. Figure 26 A. Experimental workflow for RAAV / AAV-DJ in vivo hippocampal transduction. RAAV DNA was normalized to that of RAAV without MCP (negative control). Figure 26B. Fluorescence microscopy analysis of tdTomato and Cre expression in the hippocampus of Ai9 mice 4 weeks after stereotactic injection of AAV / RAAV. The right image is a magnified version of the area indicated by the white box in the left image. The scale bar in the left image is 200 μm, while the scale bar in the right image is 50 μm. Figure 26 C. Statistical analysis of tdTomato-positive and Cre-positive cells in (B). Data are shown as individual data points and mean ± SD of n = 3 mice; unpaired two-tailed t-test; **P < 0.01; ns, not significant. Figure 26 D. Schematic diagram of the AAV / RAAV in vivo systemic infection assay. RAAV (carrying optCre mRNA) was produced using the RAAV-v3 system. MOI was calculated using vector genome titer. Figure 26 E. RAAV / AAV transduction in Ai9 mouse liver 4 weeks after intravenous injection. N = 2 mice. Scale bar, 1000 μm. Figure 26 F. Fluorescence microscopy analysis of tdTomato and Cre expression in the liver of Ai9 mice 4 weeks after intravenous injection of RAAV9 / AAV9. N = 2 mice. Scale bar, 100 μm. Figure 26 G. Statistical analysis of tdTomato-positive and Cre-positive cells in (F). Data are shown as individual data points and mean ± range of n=2 mice. Figure 26 H. RAAV / AAV transduction in the brain of Ai9 mice 4 weeks after intravenous injection. N = 2 mice. Scale bar, 1000 μm. Figure 26 I. Fluorescence microscopy analysis of tdTomato and Cre expression in the brains of Ai9 mice 4 weeks after intravenous injection of RAAV / AAV-PHP.eB. N = 2 mice. Scale bar, 50 μm. Figure 26 J and Figure 26 K. Statistical analysis of tdTomato-(J) and Cre-(K) positive cells in (I). Data are shown as individual data points and mean ± range of n=2 mice.

[0078] Figure 27A Shown is a phylogenetic analysis of the helicase domains of 98 SF3 viral helicases using the AlignX program of Vector NTI software.

[0079] Figure 27B Shown is an alignment of the helicase domains of 98 SF3 viral helicases using the AlignX program of Vector NTI software. The tested mutations are marked with black boxes.

[0080] Figure 27CThe helicase domains of 98 SF3 viral helicases were aligned using the MUSCLE program of Jalview software. The tested mutations are marked with black boxes.

[0081] Figure 27D Shown is the alignment of 23 complete viral protein sequences using the AlignX program of Vector NTI software. The complete sequences of 23 randomly selected viral proteins containing helicases were aligned via AlignX, and partial alignment results are shown. The mutations tested are marked with black boxes.

[0082] Figure 28 Cargo sequence optimization for improving RAAV infectivity is shown. Figure 28 A. Encapsidation of different Cre coding sequences in RAAV was quantified by qPCR and RT-qPCR using primers targeting WPRE. Cre opt sequences were obtained by codon optimization using several online tools (Table S4). RAAV was generated from the RAAV-v2 system (carrying L454F+D455F mutations in the helicase). Data are shown as individual data points and mean ± range of n = 2 biological replicates. Figure 28 B. The infectivity of rAAVs carrying different Cre coding sequences was investigated by analyzing the percentage of tdTomato+Ai9-MEFs 5 days after infection using cytometry. AAV / rAAV vectors were generated using the artificial capsid DJ. MOI was calculated using vector genome titer. Data are mean ± SD of n = 3 biological replicates; unpaired two-tailed t-test; ***P < 0.001, ****P < 0.0001.

[0083] Figure 29 Shown in SYBR TM RAAV genomes were analyzed on denaturing agarose gels stained with Green II. DNase I and RNase I treatment groups were set up to identify RAAV genomes. These are Figure 3 F is the full image, and the lanes in the white box are irrelevant samples.

[0084] Figure 30 RAAV packaging specificity is shown. Figure 30 A. Differential RNA abundance of VLP fractions in the presence or absence of MCP. Figure 30 B. Only mRNA carrying the RPS (optCre) is efficiently packaged in rAAV.

[0085] Figure 31A representative flow cytometry gating scheme for an AAV / RAAV in vitro Ai9-MEF infection experiment is shown. Cells were first gated based on FSC and SSC to remove debris. Subsequently, single cells were gated based on SSC. tdTomato+ cells were gated based on an uninfected control (mock).

[0086] Figure 32 Titration of specific controls for AAV and RAAV is shown. Encapsidated DNA and RNA were quantified in the VLP fractions of AAV / RAAV and their controls by qPCR and RT-qPCR using primers targeting WPRE.

[0087] Figure 33 Figure 2 shows the effect of the transcription inhibitor actinomycin D on viral DNA and RNA levels in AAV / RAAV-DJ infected Ai9-MEFs. Figure 33 A) and RNA ( Figure 33 B) levels. MOI calculation was performed using vector genome titer. Ai9-MEFs were infected with AAV-Cre or RAAV-v3-optCre at an MOI of 1000 vg. Actinomycin D was added to cells at a concentration of 5 μg / mL 2 hours after infection, and cells were collected 6 and 24 hours after infection for analysis of viral DNA and RNA. Mock: uninfected control. Data are shown as the mean ± SD of n = 3 biological replicates.

[0088] Figure 34 Cellular DNA / mRNA is shown analyzed in AAV / RAAV-DJ infected Ai9-MEFs as a loading control. Figure 34 A. Ct value of cell housekeeping gene (36B4). Figure 34 B. Ct values ​​of cellular GAPDH mRNA. Mock: uninfected control. Data are shown as mean ± SD of n = 3 biological replicates.

[0089] Figure 35 Shown is a study of the effects of the vacuolar H+-ATPase inhibitor bafilomycin A1 and the transcription inhibitor actinomycin D on AAV / RAAV-DJ-mediated infection. Figure 35A. Schematic diagram of the experiment. HeLa cells were treated with bafilomycin A1 (100 nM) 2 h prior to infection with AAV-DJ-Cre (MOI 1,000 vg) or rAAV-DJ-v3-Cre (MOI 10,000 vg), and the transcription inhibitor actinomycin D was added at a concentration of 5 μg / mL 1 h or 6 h post-infection. DMSO was used as a solvent control. 24 h post-infection, cells were fixed and processed for RNAscope analysis. Figure 35 B. Effects of the vacuolar H+-ATPase inhibitor bafilomycin A1 and the transcription inhibitor actinomycin D on AAV / rAAV-mediated transduction. Cell nuclei were visualized using DAPI staining. Viral RNA and DNA were detected using DNA probes that bind to Cre mRNA and DNA. Scale bar, 50 μm.

[0090] Figure 36 NGS analysis of off-target effects in hTTR-gRNA-HEK293T cells treated with AAV-DJ- or RAAV-DJ-Cas12Max is shown. Another off-target site of hTTR-gRNA was predicted by Cas-OFFinder (33). 120 hours after infection, the indel at the predicted off-target site 2 was quantified by NGS. Data are shown as individual data points and mean ± SD of n = 3 biological replicates.

[0091] Figure 37 Quantification of viral DNA and RNA copy numbers in AAV / RAAV-DJ infected hippocampal tissue is shown. Mock: uninfected control. Data are shown as individual data points and mean ± range of n=2 biological replicates.

[0092] Figure 38 Two additional AAV capsids were tested in RAAV-v3. Encapsidated DNA and RNA in AAV / RAAV were quantified by qPCR and RT-qPCR using primers targeting WPRE. Data are shown as individual data points and mean ± range of n=2 biological replicates.

[0093] Figure 39 RAAV without MCP showed no infectivity. Figure 39 A. Infection of Ai9 mice with MCP-free RAAV9 in the liver 4 weeks after intravenous injection. N = 2 mice. Figure 39 B. Transduction of RAAV-PHP.eB without MCP in the brain of Ai9 mice 4 weeks after intravenous injection. N = 2 mice.

[0094] Figure 40 The cell tropism of RAAV is shown. Figure 40 A) and HEK293T Cre reporter cells ( Figure 40 B) Comparison of the infectivity of AAV and RAAV. RAAV was generated from RAAV-v2. MOI calculation was performed using vector genome titer. The infectivity of AAV and RAAV was studied by analyzing the percentage of tdTomato+ cells 5 days after infection using cytometry. Data are shown as individual data points and mean ± SD of n = 3 biological replicates.

[0095] The drawings herein are for illustration purposes only and are not necessarily drawn to scale. DETAILED DESCRIPTION

[0096] 1. Overview

[0097] Adeno-associated virus (AAV) is a common vector for DNA delivery in gene therapy. Here, the inventors have developed a system that enables AAV shells to package RNA by introducing RNA packaging components and / or modifying AAV Rep proteins. The resulting RNA-carrying AAV (RAAV) retains the characteristics of traditional AAV, including capsid composition, viral morphology, and tissue tropism. These RAAVs can mediate the transfer of RNA (e.g., mRNA) to target cells and tissues, thereby causing transient expression of functional proteins. Importantly, it has been demonstrated that intravenously injected RAAV efficiently crosses the blood-brain barrier (BBB) ​​and infects the entire mouse brain. Therefore, DNA viral vectors can be modified for RNA delivery, and the RAAV representative of the present disclosure can be used for the first efficient cross-BBB mRNA delivery system for therapeutic purposes via whole-brain infection.

[0098] Messenger RNA (mRNA) has become a novel therapeutic agent for the prevention and treatment of many diseases. In order to introduce exogenous mRNA in vivo, the delivery system needs to protect the nucleic acid from degradation and allow efficient cellular uptake and mRNA release (1). Lipid nanoparticles (LNPs) have been developed as RNA delivery systems and are clinically used to deliver siRNA drugs (2) and mRNA vaccines (3-5), as exemplified by their use in delivering antigen mRNA as a vaccine for coronavirus disease 2019 (COVID-19) (3-5). In addition, virus-like particles (VLPs) are used as mRNA delivery tools to combine the high infection efficiency of viral vectors with the transient nature of the introduced mRNA (6-10). However, systemic injection of LNPs and VLPs for delivering mRNA was found to primarily target the liver (11), with low efficiency in delivery to many other tissues, particularly the central nervous system (CNS), due to the presence of the blood-brain barrier (BBB). The use of naturally occurring and newly engineered AAV capsids is a promising strategy for targeting non-hepatic tissues such as the CNS (12), skeletal muscle (13), and heart (14). AAV is a small, non-enveloped virus that can package single-stranded DNA (ssDNA) (15) and has been engineered for DNA delivery by replacing all viral protein coding sequences with a therapeutic gene expression cassette between two desired packaging signals (inverted terminal repeats, ITRs) (16). Unlike retrovirus-derived VLPs, in which viral assembly and genome encapsidation occur simultaneously, synthetic AAV genomes are pumped into preassembled capsids in a 3' to 5' direction powered by the viral DNA helicase / ATPase activity of the Rep proteins (Rep78, Rep68, Rep52, and Rep40) (17,18). The nonstructural Rep78 / 68 proteins also serve as a "bridge" between the ssDNA genome and the preassembled AAV capsid during viral packaging ( Figure 22 A)(15, 18). Based on these findings, the present inventors hypothesized that replacing the ITR with an RNA packaging signal (RPS) and enabling the Rep78 / 68 proteins to bind to RNA bearing the RPS could convert AAV into an RNA packaging virus.

[0099] On the "left side" of the vector genome of the natural AAV virus, there are two promoters called p5 and p19, from which two overlapping messenger RNAs (mRNAs) of different lengths can be produced. Each of these overlapping messenger RNAs contains introns that can be removed by splicing or not. In view of these possibilities, four different mRNAs can be synthesized, and therefore four different Rep proteins with overlapping sequences can be synthesized. Their names represent their sizes in kilodaltons (kDa): Rep78, Rep68, Rep52, and Rep40. Rep78 and 68 can specifically bind to the hairpin structure formed by ITR in self-priming and cut at a specific region designated as the terminal dissociation site within the hairpin structure. They are also shown to be necessary for the AAVS1-specific integration of the AAV genome. All four Rep proteins are shown to bind to ATP and have helicase activity. It is also shown that these proteins upregulate transcription from the p40 promoter, but downregulate both the p5 and p19 promoters.

[0100] The present disclosure provides rAAV packaging systems with increased RNA packaging capacity (efficiency) and / or decreased DNA packaging capacity (efficiency) at least in part by using Rep proteins containing mutated helicase domains believed to have increased RNA unwinding properties and / or decreased DNA unwinding properties.

[0101] In one aspect, the present disclosure provides a Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0102] In another aspect, the present disclosure provides a polynucleotide encoding a Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0103] In yet another aspect, the present disclosure provides a polynucleotide encoding a Rep78 protein, a Rep68 protein, a Rep52 protein, and a Rep40 protein, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein, and the Rep40 protein share a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

[0104] In yet another aspect, the present disclosure provides a helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (eg, SEQ ID NO: 186).

[0105] In yet another aspect, the present disclosure provides a polynucleotide encoding a helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (eg, SEQ ID NO: 186).

[0106] In yet another aspect, the present disclosure provides a RAAV packaging system, and in particular, provides a system for packaging RNA into AAV capsids to produce recombinant RNA-packaged AAV particles (rRAAV particles).

[0107] wherein the RNA comprises:

[0108] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0109] The system comprises:

[0110] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0111] (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186);

[0112] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0113] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0114] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0115] In yet another aspect, the present disclosure provides a RAAV packaging method, and in particular, provides a method for producing recombinant RNA-packaged AAV particles (rRAAV particles), the method comprising:

[0116] a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and

[0117] b) harvesting the rRAAV particles or populations thereof;

[0118] wherein the RNA comprises:

[0119] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0120] The system comprises:

[0121] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0122] (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186);

[0123] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0124] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0125] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0126] In yet another aspect, the present disclosure provides a use of a Rep protein (e.g., Rep78, Rep68, Rep52, Rep40) or a polynucleotide encoding the Rep protein in producing recombinant RNA-packaged AAV particles (rRAAV particles), wherein the Rep protein comprises a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186), the production comprising:

[0127] a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and

[0128] b) harvesting the rRAAV particles or populations thereof;

[0129] wherein the RNA comprises:

[0130] (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule, wherein the RPS interacting molecule facilitates packaging of the RNA into the AAV capsid;

[0131] The system comprises:

[0132] (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0133] (2) one or more of the Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence;

[0134] (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence;

[0135] (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and

[0136] (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

[0137] In some embodiments, the amino acid mutation results in increased RNA unwinding properties and / or decreased DNA unwinding properties of the helicase or Rep protein comprising the amino acid mutation.

[0138] The RNA unwinding property refers to that the helicase domain of the present invention recognizes RNA and unwinds it to allow the unwound RNA to be packaged into the AAV capsid. The DNA unwinding property refers to that the helicase domain of the present invention recognizes ssDNA and unwinds it to allow the unwound ssDNA to be packaged into the AAV capsid. Since natural AAV is a DNA virus with an ssDNA vector genome, it is believed that the helicase domain contained in the wild-type Rep protein can unwind DNA. On the other hand, it is found in the embodiments of the present invention that, in the case where the wild-type Rep protein is not engineered, RNA can also be packaged into the AAV capsid, thereby proving that the wild-type Rep protein can also unwind RNA. For the purposes of the present disclosure, the reference Rep protein (e.g., wild-type Rep protein) is engineered to increase the RNA unwinding property and / or reduce the DNA unwinding property of the helicase domain contained in the reference Rep protein.

[0139] RNA unwinding properties can be measured using any suitable measurement known in the art. Alternatively, RNA unwinding properties can be indicated by the RNA packaging efficiency of the RAAV packaging system or method of the present disclosure, as it is believed that the packaging of the vector genome utilizes the unwinding properties of the helicase domain contained in the Rep protein. Therefore, an increase or decrease in RNA unwinding properties can be indicated by an increase or decrease in the RNA packaging efficiency of the RAAV packaging system or method of the present disclosure (which has the Rep protein of the present disclosure containing the amino acid mutation) compared to a control RAAV packaging system or method that does not have the amino acid mutation but is otherwise identical.

[0140] DNA unwinding properties can be measured using any suitable measurement known in the art. Alternatively, DNA unwinding properties can be indicated by the DNA packaging efficiency of the disclosed RAAV packaging system or method. Thus, an increase or decrease in DNA unwinding properties can be indicated by an increase or decrease in the DNA packaging efficiency of the disclosed RAAV packaging system or method (which has a disclosed Rep protein containing an amino acid mutation) compared to an otherwise identical control RAAV packaging system or method without the amino acid mutation.

[0141] In some embodiments, the amino acid mutation results in an increase in RNA packaging efficiency and / or a decrease in DNA packaging efficiency. An increase or decrease in RNA or DNA packaging efficiency refers to an increase or decrease in the RNA or DNA packaging capacity (efficiency) of the RAAV packaging system or method of the present disclosure (which has a Rep protein of the present disclosure that contains an amino acid mutation) compared to a control RAAV packaging system or method that does not have the amino acid mutation and is otherwise identical. The embodiments of the present disclosure provide specific examples and details for measuring the RNA or DNA packaging capacity (efficiency) of the RAAV packaging system or method of the present disclosure.

[0142] The amino acid substitutions of the present disclosure can be introduced into various reference helicase domains as shown in this disclosure, including but not limited to the helicase domain of the wild-type Rep protein of wild-type AAV2 (SEQ ID NO: 186).

[0143] In some embodiments, a reference helicase domain is a helicase domain of a reference helicase (e.g., a wild-type helicase).

[0144] In some embodiments, the reference helicase is a superfamily 3 (SF3) helicase.

[0145] In some embodiments, the reference helicase is a helicase capable of unwinding DNA.

[0146] In some embodiments, the reference helicase is a superfamily 3 (SF3) helicase capable of unwinding DNA.

[0147] In some embodiments, the reference helicase domain is the helicase domain of a reference Rep protein (eg, a wild-type Rep protein).

[0148] In some embodiments, the reference Rep protein is a reference Rep78 protein, a reference Rep68 protein, a reference Rep52 protein, or a reference Rep40 protein.

[0149] In some embodiments, the reference helicase domain is a reference helicase domain shared by a reference Rep78 protein, a reference Rep68 protein, a reference Rep52 protein, and a reference Rep40 protein of the same AAV virus.

[0150] In some embodiments, the reference Rep protein, the reference Rep78 protein, the reference Rep68 protein, the reference Rep52 protein, and the reference Rep40 protein are from a wild-type AAV virus.

[0151] In some embodiments, the wild-type AAV virus has a serotype selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, AAV-DJ, AAV.PHP.eB, Anc80L65, Anc80L65AAP, and 7m8.

[0152] In some embodiments, a reference helicase domain (eg, SEQ ID NO: 186) comprises, from N-terminus to C-terminus, a motif A, a motif B, a motif B', a motif C, and an arginine finger (R finger).

[0153] In some embodiments, motif A comprises, consists essentially of, or consists of amino acids at positions corresponding to position 329 to position 342 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO: 88.

[0154] As used in this disclosure, "a position corresponding to a position" or "positions corresponding to multiple positions" can be determined by sequence alignment. An exemplary sequence alignment of a helicase domain or viral protein is provided in Figures 27A-27D . For example, the position of the Rep protein of the present disclosure corresponding to position A344 of SEQ ID NO: 88 can be position A344 of the AAV2 Rep78 of SEQ ID NO: 88 (wherein the position is numbered according to SEQ ID NO: 88), or A346 of the AAV8 Rep78 of SEQ ID NO: 94 (wherein the position is numbered according to SEQ ID NO: 94). For another example, the position of the helicase domain of the present disclosure corresponding to position A344 of SEQ ID NO: 186 can be position A344 of the AAV8 helicase domain of SEQ ID NO: 186 (wherein the position is numbered according to SEQ ID NO: 88), or A346 of the AAV8 helicase domain of SEQ ID NO: 192 (wherein the position is numbered according to SEQ ID NO: 94).

[0155] As used in this disclosure, "wherein the position is numbered according to SEQ ID NO: X" indicates how the indicated position is numbered. In cases where the Rep protein of the disclosure contains a helicase domain of the disclosure, the positions in the helicase domain can be numbered according to the Rep protein or according to the helicase domain. For example, position A344 of AAV2 Rep78 of SEQ ID NO: 88 is numbered according to SEQ ID NO: 88; alternatively, position A344 can also be referred to as position A37, in which case the position is numbered according to SEQ ID NO: 186.

[0156] In some embodiments, motif B comprises, consists essentially of, or consists of amino acids at positions corresponding to position 374 to position 379 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO: 88.

[0157] In some embodiments, motif B' comprises, consists essentially of, or consists of amino acids at positions corresponding to position 391 to position 404 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO:88.

[0158] In some embodiments, motif C comprises, consists essentially of, or consists of amino acids at positions corresponding to positions 416 to 421 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO: 88.

[0159] In some embodiments, the arginine finger (R finger) is an arginine at a position corresponding to position 444 of the amino acid sequence of SEQ ID NO: 186, where the position is numbered according to SEQ ID NO:88.

[0160] In some embodiments, the reference Rep78 protein comprises, consists essentially of, or consists of an amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of any one of SEQ ID NOs:88-109; wherein the reference Rep68 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:284, or the amino acid sequence of SEQ ID NO: NO:89-109; wherein the reference Rep52 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:285, or the corresponding amino acid sequence contained in any one of SEQ ID NO:89-109; or wherein the reference Rep40 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:286, or the corresponding amino acid sequence contained in any one of SEQ ID NO:89-109.

[0161] In some embodiments, the reference helicase domain comprises, consists essentially of, or consists of an amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of any one of SEQ ID NOs: 186-207.

[0162] In some embodiments, the amino acid mutation is at position 308 to position 463 (positions 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359) of the amino acid sequence of any one of SEQ ID NOs: 186-207. , 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420 , 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463), optionally position 325 to position 461 (position 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398,399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433 , 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461), wherein the positions are numbered according to SEQ ID NO: 88.

[0163] In some embodiments, the amino acid mutation is at a position corresponding to a conserved amino acid position in at least 80%, at least 90%, or 100% of the Rep proteins of ssDNA viruses (e.g., SEQ ID NOs: 88-109) (e.g., a position corresponding to A344 of SEQ ID NO: 88).

[0164] In some embodiments, the amino acid mutation is located at the following positions: a position corresponding to a position in one or more of motif A, motif B, motif B', motif C of a reference helicase domain; an upstream region that is no more than about 30, 25, 20, 15, 10, or 5 amino acids from the N-terminus of any of motif A, motif B, motif B', motif C, and the arginine finger (R finger) of the reference helicase domain; and a downstream region that is no more than about 30, 25, 20, 15, 10, or 5 amino acids from the C-terminus of any of motif A, motif B, motif B', motif C, and the arginine finger (R finger) of the reference helicase domain.

[0165] In some embodiments, the Rep78 protein comprising the amino acid mutation comprises, consists essentially of, or consists of an amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%) and less than 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 88-109.

[0166] In some embodiments, the helicase domain comprising the amino acid mutation comprises, consists essentially of, or consists of an amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9%) and less than 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 186-207.

[0167] In some embodiments, the amino acid mutations comprise G325, K326, R327, N328, W331, F333, P335, A336, T337, T338, T341, N342, I343, A344, E345, A346, H349, P352, P365, N367, D368, C369, V370, D371, K372, M373, I375, W376, , W377, E378, E379, G380, C405, K406, T419, S420, N421, T422, M424, C425, Q442, D443, M445, F446, K447, E449, L450, T451, L454, D455, H456, D457, F458 and / or V461, wherein the positions are numbered according to SEQ ID NO: 88.

[0168] In some embodiments, the amino acid mutation comprises a mutation at a position corresponding to G325, R327, W331, A336, T337, 1343, A344, D371, K372, M373, 1375, E378, C405, T419, S420, T422, C425, Q442, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458, and / or V461 of the amino acid sequence of SEQ ID NO: 186, wherein the position is numbered according to SEQ ID NO: 88.

[0169] In some embodiments, the amino acid mutation comprises a mutation at a position corresponding to A336, T337, I343, A344, K372, E378, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458 and / or V461 of the amino acid sequence of SEQ ID NO: 186, wherein the position is numbered according to SEQ ID NO: 88.

[0170] In some embodiments, the amino acid mutation comprises a substitution.

[0171] In some embodiments, the amino acid mutation comprises a conservative substitution or a non-conservative substitution.

[0172] In some embodiments, the amino acid mutation comprises a substitution with a non-polar amino acid residue (such as glycine (Gly / G), alanine (Ala / A), valine (Val / V), cysteine ​​(Cys / C), proline (Pro / P), leucine (Leu / L), isoleucine (Ile / I), methionine (Met / M), tryptophan (Trp / W), phenylalanine (Phe / F)), a polar amino acid residue (such as serine (Ser / S), threonine (Thr / T), tyrosine (Tyr / Y), asparagine (Asn / N), glutamine (Gln / Q)), a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H)), or a negatively charged amino acid residue (such as aspartic acid (Asp / D), glutamic acid (Glue / E)).

[0173] In some embodiments, the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of G325P, G325I, K326E, K326R, R327P, N328V, W331I, F333H, F333Y, F333K, P335S, A336P, A336S, A336R, T337G, T338G, T341S, N342I, I343T, I343A, I343L, A344T, A344V, A344S, E345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N, A345N 346F, H349K, P352T, P365Y, N367D, D368G, C369Y, V370K, D371Q, D371G, D371N, K372Q, K372E, K372N, M373S, M3 73E, M373A, I375V, W376I, W377M, E378D, E379D, G380L, G380F, C405H, K406R, T419S, T419F, T419I, T419L, S42 0A, S420M, S420C, N421T, N421S, T422H, T422S, M424N, C425I, Q442K, Q442F, Q442H, Q442R, Q442L, Q442V, D443 S, D443R, D443Y, D443N, D443A, M445I, M445R, M445F, F446R, F446I, K447F, K447N, K447H, K447P, K447T, K447A , E449D, E449I, E449R, L450M, L450I, L450V, T451D, T451I, T451E, T451K, T451N, L454F, L454V, D455F, D455K, D455H, D455Y, D455T, D455M, H456F, H456D, H456S, D457E, D457S, D457F, F458Y, F458K, V461L and combinations thereof, wherein positions are numbered according to SEQ ID NO:88.

[0174] In some embodiments, the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of G325P, R327P, W331I, A336P, A336S, A336R, T337G, I343T, I343A, I343L, A344T, A344V, D371Q, K372Q, K372E, K372N, M373S, I375V, E378D, C405H, T419S, S420A, T422H, T422S, C425I, Q442H, Q442R, D443S, D443Y, D443N, D443A, M445I, K447F, K447N, K447T, E449D, L450M, L450I, L450V, T451D, T451E, L454F, D455F, D455Y, D455T, D455M, H456D, H456S, D457E, D457S, D457F, F458Y, V461L, and combinations thereof, wherein positions are numbered according to SEQ ID NO:88.

[0175] In some embodiments, the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of A336P, T337G, I343T, A344T, A344V, K372Q, E378D, D443S, M445I, K447F, E449D, L450M, T451D, L454F, D455F, D455T, H456D, D457E, F458Y, V461L, and combinations thereof, wherein positions are numbered according to SEQ ID NO:88.

[0176] In some embodiments, the amino acid mutations comprise or consist of a combination substitution corresponding to a combination substitution selected from the group consisting of: A336P+T337G, K372Q+E378D, D443S+M445I, D443S+L454F+D455F, K447F+E449D+T451D, K447F+L450M, K447F+F458Y, K447 F+H456D+F458Y, K447F+V461L, E449D+L450M, L450M+T451D, L454F+D455F, D455T+H 456D+D457E+F458Y, H456D+D457E+F458Y, F458Y+V461L, A344T+K372Q, A336P+A344T +K447F、A336P+A344V+K447F、I343T+K447F、I343T+L450M、A344T+K447F、A344V+K4 47F, A344T+L450M, A344V+L450M, A344T+K447F+E449D+T451D, K372Q+K447F, K372Q+ L450M, K372Q+K447F+E449D+T451D, K372Q+V461L, E378D+K447F, E378D+L450M, E378D+K447F+E449D+T451D, A344T+K372Q+K447F, A344V+K372Q+K447F, and combinations thereof, wherein positions are numbered according to SEQ ID NO:88.

[0177] In some embodiments, the amino acid mutation comprises or consists of a combined substitution corresponding to a combined substitution of A344V and K447F, wherein the positions are numbered according to SEQ ID NO: 88. For example, a combined substitution corresponding to a combined substitution of A344V and K447F can be a combined substitution of A346V and K449F, wherein the positions are numbered according to SEQ ID NO: 94.

[0178] In some embodiments, the helicase domain comprising the amino acid mutation comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 287. In this case, the reference helicase domain is the helicase domain of the wild-type Rep protein of AAV2 (SEQ ID NO: 186).

[0179] In some embodiments, the Rep protein comprising the amino acid mutation comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 288. In this case, the reference helicase domain is the helicase domain of the wild-type Rep protein of AAV2 (SEQ ID NO: 186).

[0180] In some embodiments, the helicase domain comprising the amino acid mutation comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 290. In this case, the reference helicase domain is the helicase domain of the wild-type Rep protein of AAV8 (SEQ ID NO: 192).

[0181] In some embodiments, the Rep protein comprising the amino acid mutation comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 291. In this case, the reference helicase domain is the helicase domain of the wild-type Rep protein of AAV8 (SEQ ID NO: 192).

[0182] In some embodiments, the Rep protein comprises a mutation that partially or substantially eliminates the endonuclease activity of the Rep protein, for example in the native binding domain (OBD) of the Rep protein, optionally comprising or consisting of a mutation corresponding to a Y156F mutation, a K146A+D149A+E150A mutation (KDE-mu), or an E83A+K84A+E86A mutation (EKE-mu), wherein positions are numbered according to SEQ ID NO: 88.

[0183] In some embodiments, the Rep protein comprises a combination of substitutions comprising or consisting of Y156F, A344V, and K447F, wherein positions are numbered according to SEQ ID NO:88.

[0184] In some embodiments, the Rep protein comprises the amino acid sequence of SEQ ID NO:289.

[0185] In some embodiments, the RPS interacting molecule is the Rep protein.

[0186] In some embodiments, the RPS interacting molecule comprises an RPS binding protein (RPSBP) capable of directly or indirectly binding to an RNA packaging signal (RPS).

[0187] In some embodiments, the Rep protein is fused to the RPSBP (eg, N-terminally, C-terminally, internally), optionally via a peptide linker.

[0188] In some embodiments, the RPS is located at or near the 5' end of the RSI, at or near the 3' end of the RSI, or internally within the RSI.

[0189] In some embodiments, the RNA comprises one, two, or three copies of an RPS.

[0190] In some embodiments, the RPS comprises an MS2 sequence (e.g., SEQ ID NO: 54), a PP7 binding site (e.g., SEQ ID NO: 56), and / or a Com binding site (e.g., SEQ ID NO: 58).

[0191] In some embodiments, (a) the RPS comprises an MS2 sequence (e.g., SEQ ID NO:54) and the RPSBP comprises a bacteriophage-derived MS2 coat protein (MCP) (e.g., SEQ ID NO:49); (b) the RPS comprises a PP7 binding site (e.g., SEQ ID NO:56) and the RPSBP comprises a PP7 bacteriophage coat protein (PCP) (e.g., SEQ ID NO:51), or (c) the RPS comprises a Com binding site (e.g., SEQ ID NO:58) and the RPSBP comprises a bacteriophage COM protein (COM) (e.g., SEQ ID NO:53).

[0192] In some embodiments, the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence (e.g., a transgenic vector comprising or encoding the RNA) lacks a functional DNA packaging signal, such as an AAV ITR (e.g., a 5' AAV2 ITR and / or a 3' AAV2 ITR) or its coding sequence.

[0193] In some embodiments, RNA is transcribed from a polynucleotide (eg, a transgenic plasmid) that lacks a functional DNA packaging signal or its coding sequence, such as an AAV ITR (eg, a 5' AAV2 ITR and / or a 3' AAV2 ITR).

[0194] In some embodiments, the AAV capsid comprises a capsid from an AAV having a serotype selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, AAV-DJ, AAV.PHP.eB, Anc80L65, Anc80L65AAP, and 7m8.

[0195] In some embodiments, the RNA is not associated with an AAV capsid.

[0196] In some embodiments, the RSI is an RNA coding sequence of a gene of interest (GOI), an RNA encoding a protein (e.g., a therapeutic protein, an antigenic protein, or a gene editing protein such as a CRISPR / Cas effector enzyme (abbreviated as "Cas protein"), a ZFN protein, a TALEN protein), such as an mRNA, or a non-coding functional RNA (e.g., transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), antisense RNA, antisense oligonucleotide, microRNA (miRNA), or an RNA component of a CRISPR-Cas (e.g., Cas9, Cas12, Cas13) system, including a guide RNA (or gRNA), such as a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), CRISPR RNA (crRNA), and tracr RNA), or a precursor thereof.

[0197] In some embodiments, the GOI comprises a protein (e.g., a fluorescent protein, a therapeutic protein, an antigenic protein, or a gene editing protein, such as a Cas protein, a ZFN protein, a TALEN protein), an enzyme (e.g., a Cre protein or a CRISPR / Cas effector enzyme, such as Cas9, Cas12, Cas13, or a variant thereof), a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a short hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof (including a pre-miRNA and a primary miRNA), a ribosomal RNA (rRNA), an antisense sequence or oligonucleotide (ASO), an RNA component of a CRISPR-Cas system, including a guide RNA (or gRNA), such as a single guide RNA (or sgRNA, a chimeric RNA, an RNA chimera), a CRISPR RNA (crRNA) and a tracr RNA, a guide RNA or gRNA of a CRISPR / Cas effector enzyme, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR.

[0198] In yet another aspect, the present disclosure provides a vector comprising the polynucleotide of the present disclosure; optionally, wherein the vector is a plasmid.

[0199] In yet another aspect, the disclosure provides a cell, an isolated cell, a host cell, or an isolated host cell comprising a Rep protein, helicase, polynucleotide, system, or vector of the disclosure.

[0200] In yet another aspect, the present disclosure provides a recombinant RNA-packaged AAV particle (rRAAV particle) or a population thereof produced by the method of the present disclosure.

[0201] In one aspect, the invention described herein provides a recombinant viral particle comprising a DNA viral protein shell and a "vector genome" containing RNA, such as single-stranded RNA (rather than DNA). The "vector genome" may not be typical viral RNA because, except for the RNA packaging signal (RPS) described below, it may have very few (if any) sequences of viral origin. That is, DNA viruses typically or naturally encapsidate the DNA viral vector genome within a protein shell, while the recombinant version of the DNA viral virion described herein encapsidates RNA instead. "RNA" or "ribonucleic acid" means a stretch of ribonucleotides each composed of a phosphate, a ribose, and a base (A (adenine), U (uracil), G (guanine), or C (cytosine)), each of which may be modified (e.g., base-modified, sugar-modified, phosphate-modified, e.g., oxygen-modified, fluorine-modified, sulfur-modified, pseudo-modified (e.g., pseudouridine-modified), methylated, blocked (e.g., 5-blocked)) or unmodified, and optionally directly or indirectly with a phosphate, ribose, and a base (e.g., A (adenine), U (uracil), G (guanine), or C (cytosine)). The present invention relates to a fusion of a segment of deoxynucleotides consisting of a deoxyribose sugar and a base (A (adenine), T (thymine), G (guanine), or C (cytosine)), each of which can be modified (e.g., base modification, sugar modification, phosphate modification, e.g., oxygen modification, fluorine modification, sulfur modification, pseudo-modification, methylation, blocked (e.g., 5-blocking)) or unmodified, for example, RNA-DNA chimeras, DNA-RNA-DNA chimeras, RNA-DNA-RNA chimeras.

[0202] A typical (non-limiting) example of such a recombinant DNA virus particle is adeno-associated virus (AAV), which typically / naturally encapsidates a single-stranded DNA (ssDNA) vector genome. Another non-limiting example of such a DNA virus is an oncolytic DNA virus, such as an oncolytic herpes virus (e.g., herpes simplex virus or HSV), an oncolytic adenovirus, vaccinia virus (VACV), vesicular stomatitis virus (VSV), etc.

[0203] The present invention is based, in part, on the surprising discovery that transcribed AAV ITRs in RNA form can facilitate efficient direct packaging of transcribed RNA encompassing such transcribed AAV ITRs into conventional AAV viral particles.

[0204] The invention described herein is also based in part on the surprising discovery that, in addition to transcribed AAV ITRs (RNAs), certain artificial or heterologous RNA sequences and their cognate / corresponding / natural RNA binding proteins can also be used as pairs of RNA packaging signals (RPSs) and RPS interacting proteins (RPSIPs) to replace the functions of wild-type packaging signal sequences and interacting proteins useful for DNA viral packaging, thereby packaging RNA into DNA viral protein capsids that normally / naturally encapsidate DNA vector genomes.

[0205] For example, in wild-type AAV, the ITR sequences at the 5' and 3' ends of the DNA vector genome contain sequence elements that can interact with Rep proteins (such as Rep68 and Rep78), such as Rep-binding elements (RBE) and RBE'. Rep proteins bind to ITRs and promote the packaging of AAV ssDNA vector genomes containing such ITR sequence elements into AAV virus particles.

[0206] The inventors have found that by providing transcribed ITR sequences and / or artificial or heterologous RNA sequences, such as MS2 sequences as RPS to the RNA sequence of interest (RSI), the resulting RNA sequence consisting of RPS and RSI can be effectively packaged into AAV viral protein shells in the presence of MS2 coat protein (MCP) derived from MCP-bacteriophages that naturally bind to MS2. The ability of artificial RPS / RPSIP pairs, such as MS2 / MCP, to promote RNA packaging into DNA viral protein shells is independent of the presence of natural ITR packaging signals for DNA packaging, but can function independently thereof. In a sense, the heterologous MS2-MCP pair constitutes an artificial system of RPS and RPSIP pairs that can effectively replace the natural ITR-Rep DNA packaging system, with the former effectively promoting RNA packaging. Such RNA-containing DNA viruses, such as AAV, may be referred to herein as R-DNA virus particles (or RAAV in the case of AAV), or recombinant R-DNA virus particles (or rRAAV in the case of AAV).

[0207] The R-DNA viral particles and RAAV viral particles disclosed herein can be used to deliver RNA transcripts of any transgene or gene of interest (GOI) of appropriate length (e.g., within the packaging limits of various DNA viruses or AAVs) or any guide RNA to host cells compatible with the tropism of the DNA viral protein shell or AAV viral capsid. As used herein, recombinant DNA viral particles such as recombinant AAV vectors, vector genomes, and recombinant AAV viral particles or recombinant AAV particles are referred to herein as rRAAV vectors (recombinant RNA adeno-associated viral vectors), vector genomes, and recombinant RAAV (rRAAV) viral particles or rRAAV particles, respectively ("rRAAV vectors" and "rRAAV particles" are used interchangeably herein).

[0208] In particular, in one aspect, like any normal or traditional AAV vector, the RAAV vector of the present invention can also be composed of any of the same capsids found in any wild-type AAV carrying DNA as viral genetic material. Thus, the RAAV vector of the present invention possesses all the usual advantages derived from AAV capsids, such as specific / broad tropism and low immunogenicity.

[0209] On the other hand, however, the genome of the RAAV vectors of the invention is composed of short-lived RNA (eg, mRNA), resulting in transient expression of any gene products encoded on such RNA genetic material.

[0210] Such transient expression is required in at least some cases. For example, the RAAV vectors disclosed herein are advantageous for in vivo DNA gene editing because time-limited exposure to RAAV-encoded DNA gene editors (such as the mRNA coding sequence of the CRISPR / Cas system effector enzyme Cas9 and its variants fused to base editors) can achieve effective gene editing. Compared to the continuous expression of the same DNA gene editor expressed by traditional DNA-based AAV vectors, such transiently expressed DNA editors also improve the safety profile of gene therapy by reducing off-target gene targeting and reducing immunogenicity.

[0211] Furthermore, the RAAV vectors of the present invention can carry longer transgenes compared to conventional DNA-based AAV vectors because at least the promoter (and any non-transcribed enhancer sequences that may be required) required to express the GOI encoded by the DNA-based AAV vector is eliminated.

[0212] Although the rRAAV vectors of the present invention have different sequence elements and organization compared to traditional DNA-based AAV vectors, rRAAV viral particles have the same entry and intracellular trafficking process as traditional DNA-based AAV vectors. However, they have a very different fate after entering the nucleus of the host cell. After entering the nucleus, the mRNA genome of the RAAV vector of the present invention is released and then transported to the cytoplasm, resulting in translation. It is well known that mRNA lifespan is generally short, ranging from a few minutes to a few days, and is ultimately degraded by many cellular mechanisms. However, the limited mRNA lifespan still enables the host cell to complete protein synthesis, which is generally not delayed by the second-strand cDNA synthesis in DNA-based AAV vectors, and allows the encoded protein to act rapidly.

[0213] Many such RPS / RPSIP pairs can be used to package RNA into DNA viruses. The inventors have demonstrated at least two additional such pairs, including the PP7 sequence and the PP7 bacteriophage coat protein (PCP), and the com sequence and the bacteriophage COM protein (COM), which effectively package RNA containing heterologous RPS (i.e., the PP7 and com sequences, respectively). The three demonstrated pairs of RPS / RPSIP cover at least two categories. Unlike the natural viral packaging systems MS2 / MCP and PP7 / PCP, com / COM is not a natural viral packaging system, but a transcriptional regulator known to play a role in the transcriptional initiation of the bacteriophage Mu mom gene. Many transcribed modified AAV ITR sequences can also be used as the RPS of the present disclosure.

[0214] The invention described herein is also not limited to a specific serotype of DNA virus (e.g., a specific AAV serotype). The inventors have demonstrated efficient packaging of RNA sequences with appropriate RPSs into representative AAV viruses (including AAV5, AAV8, AAV9, and AAV-DJ) in each case in combination with a compatible RPSIP.

[0215] The invention described herein is also based on the discovery that the efficiency of packaging of undesirable DNA into native DNA virus virions can be reduced by several independent approaches.

[0216] In certain embodiments, the undesirable DNA packaging efficiency can be reduced by increasing the total size of the DNA vector from which the RNA of interest is transcribed. For example, in a triple transfection method commonly used for AAV production, the gene of interest (GOI) can be carried by a first plasmid, the required Rep and Cap proteins are encoded by the rep and cap genes on a second plasmid, and the other components required for AAV packaging are provided by a third plasmid. According to this embodiment of the present disclosure, the RNA sequence to be packaged into the DNA virus can be transcribed from a first plasmid, and the total size of the first plasmid can be artificially increased by including random filler sequences (e.g., introns), such as filler sequences of at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or longer in length, or increasing the total size of the first plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or longer filler sequences, for example, to about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or longer filler sequences, etc.

[0217] In certain other embodiments, the undesirable DNA packaging efficiency can be reduced by inhibiting the function of the classical elements that promote DNA packaging. Such classical elements for DNA packaging can include DNA sequences (such as elements of AAV ITR sequences that promote DNA packaging, including trs sequences, RBE or RBE' sequences or the entire ITR sequence of AAV); and / or protein elements involved in DNA packaging, such as proteins that interact with DNA sequences (such as mutant Rep68 or Rep 78 proteins that lack or have reduced trs-nuclease activity).

[0218] Thus, one aspect of the present disclosure provides a ribonucleotide (RNA) sequence capable of being packaged into a DNA virus virion (e.g., a DNA virus that naturally packages DNA), wherein the RNA sequence comprises: (1) an RNA sequence of interest (RSI); and (2) an RNA packaging signal (RPS), wherein the RNA packaging signal is capable of interacting, e.g., binding, directly or indirectly, with an RPS interacting molecule (e.g., an RPS interacting protein or RPSIP), wherein the RPS interacting molecule facilitates the packaging of the RNA sequence into the DNA virus virion.

[0219] Such RNA sequences may comprise any RSI (RNA), which may be encoded by a "gene of interest" or "GOI" (DNA).

[0220] As used herein, "gene of interest" or "GOI" includes any coding sequence of a protein or polypeptide, including intronic and exonic sequences, and / or any non-translated RNA or non-coding RNA (ncRNA, such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or its precursors, including pre-miRNA and primary miRNA, antisense sequences or oligonucleotides (ASO), guide RNA or gRNA of CRISPR / Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.).

[0221] Similarly, representative (non-limiting) RSIs include, for example, RNA encoding a protein (e.g., a therapeutic protein, an antigenic protein, or a gene editing protein such as a CRISPR / Cas effector enzyme (abbreviated as "Cas protein"), a ZFN protein, a TALEN protein), such as an mRNA, or a non-coding functional RNA (e.g., a transfer RNA (tRNA), a ribosomal RNA (rRNA), a transfer-messenger RNA (tmRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense RNA or oligonucleotide (ASO), a microRNA (miRNA), an RNA aptamer, or an RNA component of a CRISPR-Cas (e.g., Cas9, Cas12, Cas13) system, such as a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA), and a tracr RNA), or its precursor, or RNA components of the RISC complex or RNAi pathway (such as shRNA, miRNA, or siRNA), regulatory RNA, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA) (including intergenic lincRNA, intronic ncRNA, and sense / antisense lncRNA), long intergenic / intergenic non-coding RNA (lincRNA), enhancer RNA, bacterial small RNA (sRNA), snRNA, exRNA, scaRNA, Xist, and HOTAIR and its precursors.

[0222] The RNA sequences or GOIs disclosed herein may comprise one coding sequence or more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) coding sequences. The length of the coding sequence, or the combined length of all coding sequences, may not exceed the maximum length of RNA that can be packaged into a specific or selected DNA virus virion (e.g., an AAV virion), which may differ between one specific DNA virus (e.g., AAV) virion and another.

[0223] In certain embodiments, the DNA sequence encoding or corresponding to the RNA of the present invention, or the reverse complement of the DNA sequence, has reduced, weakened, or substantially no ability to be packaged into DNA virus virions. For example, the DNA sequence can encode the RNA of the present invention (e.g., the DNA sequence has the reverse complement of the RNA of the present invention). The DNA sequence can also correspond to the RNA of the present invention because the DNA sequence has a nucleotide sequence that is otherwise identical to the RNA of the present invention, except that the DNA sequence has T instead of U in the RNA of the present invention. In any case, the DNA sequence or its reverse complement may lack a functional DNA packaging signal for packaging into DNA virus virions, such as AAVITR for AAV packaging, so that the DNA sequence or its reverse complement (DNA) has reduced, weakened, or substantially no ability to be packaged into DNA virus virions.

[0224] In certain embodiments, the RNA of the present disclosure is transcribed from a DNA construct, such as a DNA plasmid encoding the RNA sequence, wherein the DNA construct / plasmid comprises a stuffer sequence (e.g., an intron sequence) in its backbone sequence to enhance packaging of the RNA of the present disclosure, and / or to reduce unwanted packaging of the DNA into DNA viral virions. For example, the RNA of the present disclosure can be transcribed from a DNA construct / plasmid, and the total size of the DNA construct / plasmid can be artificially increased by including a random DNA stuffer sequence, such as a stuffer sequence that is at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or longer in length, or increasing the total size of the DNA construct / plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or longer, e.g., to about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or longer stuffer sequence, etc. The stuffer sequence can be located upstream (e.g., immediately upstream) of the transcription unit comprising the RNA coding sequence of the present disclosure (see Figure 9A , wherein a long stuffer sequence of >3 kb is inserted immediately upstream of a CAG promoter driving transcription of an exemplary RNA sequence of the present disclosure). In certain embodiments, the stuffer sequence is inserted immediately upstream of a promoter operably linked to the codon sequence of an RNA of the present disclosure. Optionally, in some embodiments, the coding sequence of an RNA of the present disclosure lacks a functional native DNA packaging signal for a DNA virus virion, such as lacking a functional ITR sequence that supports packaging into an AAV virion.

[0225] In certain embodiments, the RNA of the present disclosure can be packaged into DNA viral particles, which are AAV viral particles. Any AAV virus can be used to package the RNA of the present disclosure, including but not limited to AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, AAVhu32, AAVhu37, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.

[0226] In certain embodiments, the RNA of the present disclosure can be packaged into DNA virus particles, which are oncolytic virus particles. Exemplary (non-limiting) oncolytic virus particles include: oncolytic herpes virus (e.g., herpes simplex virus or HSV), oncolytic adenovirus, vaccinia virus (VACV), vesicular stomatitis virus (VSV), etc.

[0227] The position of the RPS in the RNA of the present disclosure can be flexible. In certain embodiments, the RPS is located at or near the 5' end of the RNA of the present disclosure, at or near the 3' end of the RNA of the present disclosure, or located inside the RNA of the present disclosure. In certain embodiments, the RPS is located at or near the 5' end of the RNA sequence of interest (RSI), at or near the 3' end of the RNA sequence of interest (RSI), or located inside the RNA sequence of interest (within an intron of the mRNA).

[0228] One or more RPSs may be present in the RNAs of the present disclosure. In certain embodiments, the RNA sequences of the present disclosure comprise more than one (e.g., 1, 2, 3, or more) RPSs that are identical or substantially identical. In certain embodiments, the RNAs of the present disclosure comprise more than one (e.g., 1, 2, 3, or more) RPSs, and at least two of them are different from each other.

[0229] In the case where there is more than one RPS on the RNA of the present disclosure, at least two of the more than one RPS are adjacent to each other, such as in series, with an optional linker sequence between them. The linker between any two adjacent RPS sequences can be the same or different. The linker sequence can be a randomized RNA sequence and has no substantial secondary structure, no known functional sequences or elements, and / or the GC content can be less than 50%. The length of the linker can be any length between 1-1 kb, 1-500 bases, 1-200 bases, 1 to about 100 bases, 1 to about 60 bases, about 5 to about 55 bases, about 10 to about 30 bases, or about 15-25 bases.

[0230] In certain embodiments, the RNA of the present disclosure comprises three RPS sequences adjacent to each other, separated by two linker sequences, each linker sequence being independently about 20 or about 50 bases. For example, the first two of the three identical RPS sequences can be separated by a 20-base linker, and / or the last two of these RPS sequences can be separated by a 51-base linker.

[0231] In certain embodiments, the RNA of the present disclosure comprises more than one RPS (e.g., 1, 2, 3, 4, or 5 RPSs), wherein at least two of the more than one RPSs are not adjacent to each other. For example, one of the RPSs can be located at the 5' end of the RNA of the present disclosure, while another RPS can be located at the 3' end of the RNA of the present disclosure, and an optional third RPS can be located within an intron of the mRNA as an RSI within the RNA of the present disclosure. The fourth and / or fifth RPS can be close to or adjacent to any of the first, second, or third RPSs.

[0232] In certain embodiments, the RNA of the present disclosure comprises at least two (e.g., two or more) RPS sequences that are not adjacent to each other (e.g., each located at or near one end of the RNA sequence of interest (RSI)).

[0233] In certain embodiments, the RPS comprises a transcribed modified AAV inverted terminal repeat (ITR), wherein the transcribed modified AAV ITR (a) comprises a transcribed functional Rep binding element (RBE), optionally further comprises a transcribed functional RBE'; and (b) lacks a transcribed terminal dissociation site (TRS) or a transcribed reverse complement TRS (rcTRS), or both. In certain embodiments, the transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D' sequence). In certain embodiments, the RPS interacting molecule is Rep78, Rep68, Rep52, and / or Rep40.

[0234] As used herein, "AAV viral particles" include viral particles comprising any wild-type capsid of adeno-associated virus (AAV) (of the genus Dependiovirus, which in turn belongs to the family Parvoviridae), as well as engineered variants thereof with modified sequence and / or tissue or host tropism.

[0235] As used herein, "intron" refers to a non-coding segment of DNA or RNA that is typically removed from the transcribed RNA by splicing. However, the RNA of the present disclosure may contain intron sequences, such as intron sequences from a heterologous gene ("heterologous" with respect to the gene of interest or GOI, which is expressed as a transgene delivered to a host cell by the rRAAV viral particles of the present disclosure) to enhance expression of the GOI. Such intron sequences in the RNA of the present disclosure may or may not be removed by splicing. In addition, such intron sequences may further contain an enhancer of transcription or a portion thereof, as some enhancers may be located within introns of the coding DNA.

[0236] As used herein, "exon" refers to a coding segment of DNA or RNA that is translated into a protein sequence. However, in certain embodiments, the exon sequence within the RNA of the present disclosure may encode a portion or all of a GOI that will be expressed as a transgene delivered to a host cell via the rRAAV viral particles of the present disclosure. In other embodiments, the exon sequence within the RNA of the present disclosure may belong to a heterologous gene (relative to the GOI), and the presence of such exons may enhance the expression of the GOI.

[0237] As used herein, a "coding sequence" includes a polynucleotide sequence of DNA or RNA that encodes a product, which product can be (a) a protein or polypeptide, or (2) a product other than a protein or polypeptide (e.g., ncRNA, such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or its precursors, including pre-miRNA and primary miRNA, antisense sequences or oligonucleotides (ASOs), guide RNA or gRNA for CRISPR / Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.).

[0238] Once the RNA content of the RAAV viral particle is separated from the AAV capsid and released into the cell, the ribonucleotide coding sequence of the gene of interest can be further processed within the cell. Processing of the coding sequence can produce one or more RNA products, such as siRNA, miRNA and / or mRNA, which can be further translated into one or more protein products or incorporated into other cellular machinery, such as the RISC complex or CRISPR / Cas effector enzymes (such as class 2, type II, type V or type VI effector enzymes).

[0239] As used herein, the term "transcribed" and its grammatical variants refer to a nucleotide sequence comprising ribonucleic acid (RNA) nucleotides that are transcribed from a DNA template (e.g., double-stranded DNA and / or single-stranded DNA). The transcribed RNA molecule can correspond to the positive or negative strand of the AAV ssDNA, wherein the transcribed positive strand RNA is transcribed from the negative strand of the DNA template, and the transcribed negative strand RNA is transcribed from the positive strand of the DNA template. In certain embodiments, the transcribed RNA molecule can be transcribed from the sense or antisense strand of the double-stranded DNA template. For example, when the dsDNA sequence is represented by the sequence of only one strand (such as SEQ ID NO: 1), the transcribed RNA using dsDNA as a template can have the same sequence as the sense or antisense strand, as the case may be. That is, the RNA transcribed from the double-stranded DNA shown in SEQ ID NO: 1 may have the same sequence as SEQ ID NO: 1 or its reverse complement, except that the U in the transcribed RNA replaces the T in the DNA.

[0240] The transcribed modified AAV terminal inverted repeat (ITR) sequences of the present invention are RNA sequences (as opposed to the single-stranded DNA sequences in the traditional AAV viral genome that are encapsidated within the AAV viral particle). As wild-type AAV ITR DNA sequences, the transcribed modified AAV ITR sequences (RNA) also support the binding of the RNA of the present invention to the AAV Rep protein, and are therefore capable of supporting the direct packaging of the RNA of the present invention into AAV viral particles. In certain embodiments, the transcribed modified ITR sequence comprises a transcribed Rep binding element (RBE) (e.g., a transcribed functional RBE), and optionally a transcribed RBE' (e.g., a transcribed functional RBE') for Rep binding. In certain embodiments, the transcribed modified ITR sequence supports or promotes the packaging or encapsidation of the RNA sequence into the AAV viral particle.

[0241] In certain embodiments, the modified ITR comprises a wild-type RBE.

[0242] In certain embodiments, the modified ITR comprises a functional RBE that retains at least about 60%, 70%, 80%, 90%, 95%, 100% or more of the ability of a wild-type RBE to support AAV packaging (e.g., Rep binding). In certain embodiments, the functional RBE comprises up to about 30%, 25%, 20%, 15%, 10% or 5% sequence variation compared to a wild-type RBE, due to, for example, insertions, deletions, substitutions, and / or other mutations of one or more nucleotides of the RBE.

[0243] In certain embodiments, the modified AAV ITR DNA template from which the transcribed modified AAV ITR is transcribed is defective as an ITR in that it lacks one or more functions of the corresponding wild-type AAV ITR, such as the ability to cleave at the TRS (transcriptional terminal dissociation site, see below). This may be due, for example, to the lack of a functional TRS. In one embodiment, the wild-type TRS is completely deleted, such that the modified ITR has no TRS. In one embodiment, the wild-type TRS is mutated by deletion, insertion, substitution, and / or mutation of one or more nucleotides, such that it is no longer recognized and cleaved by Rep during AAV replication.

[0244] In certain embodiments, the modified AAV ITR DNA template retains RBE or a functional variant thereof as described herein, and optionally RBE' or a functional variant thereof. In certain embodiments, RBE and / or RBE' is functional in binding to AAV Rep78 / 68.

[0245] The transcribed modified AAV inverted terminal repeats (ITRs) of the present disclosure further lack a transcribed terminal dissociation site (TRS) or a transcribed reverse complement TRS (rcTRS), or both. In certain embodiments, the TRS is located at the 5' end of the modified AAV ITR. In certain embodiments, the TRS is located between the D region sequence and the RBE.

[0246] In certain embodiments, the transcribed modified AAV ITR lacks both a transcribed TRS and a transcribed rcTRS.

[0247] As used herein, "terminal dissociation site" or "TRS" refers to a single-stranded DNA sequence in the single-stranded AAV vector genome (positive or negative strand) that is recognized and nicked by the AAV Rep protein during AAV replication. As used herein, "reverse complementary TRS (rcTRS)" refers to a single-stranded DNA sequence in the single-stranded AAV vector genome (positive or negative strand) that is the reverse complementary sequence of the TRS. The rcTRS pairs with the TRS to form a double-stranded DNA region at one end of the A region stem. See Figures 1A-1C .

[0248] In the AAV2 ITR, the TRS contains the sequence TTGGC, with the Rep cleavage site located between two T's; whereas the rcTRS contains the sequence GCCAA. A TRS is located at the junction of the D and A region sequences and is located at the 5' end of the A region sequence (e.g., between the D region sequence and the RBE). For a multiple sequence alignment of TRSs and rcTRSs in representative AAV 5' and 3' ITRs, see Figure 1B and 1C .

[0249] As used herein, a "transcribed TRS" is a single-stranded RNA sequence produced by transcription from a TRS DNA template. For an AAV2 TRS comprising TTGGC, the transcribed TRS comprises GCCAA.

[0250] As used herein, a "transcribed rcTRS" is a single-stranded RNA sequence produced by transcription from a rcTRS DNA template. For an AAV2 rcTRS comprising GCCAA, the transcribed rcTRS comprises UUGGC.

[0251] Thus, a transcribed modified AAV ITR "lacks a transcribed AAV2 TRS" if the transcribed modified AAV ITR lacks a GCCAA sequence at the position where the GCCAA sequence normally occurs in the corresponding transcribed wild-type AAV2 ITR, e.g., due to a complete absence of the GCCAA sequence, or due to insertions, deletions, substitutions, and / or other mutations of one or more nucleotides in the GCCAA sequence. This may result from transcription of a modified AAV ITR having a complete absence of the TRS (TTGGC), or due to insertions, deletions, substitutions, and / or other mutations of one or more nucleotides in the wild-type TRS.

[0252] Thus, in certain embodiments, the RNA or transcribed modified AAV ITRs of the present disclosure lack a transcribed functional TRS.

[0253] Similarly, a transcribed modified AAV ITR "lacks a transcribed AAV2 rcTRS" if the transcribed modified AAV ITR lacks a UUGGC sequence at the position where the UUGGC sequence normally occurs in the corresponding transcribed wild-type AAV2 ITR, e.g., due to a complete absence of the GCCAA sequence, or due to insertions, deletions, substitutions, and / or other mutations of one or more nucleotides in the GCCAA sequence. This may result from transcription of a modified AAV ITR with a complete absence of the rcTRS, or due to insertions, deletions, substitutions, and / or other mutations of one or more nucleotides in the wild-type rcTRS.

[0254] In certain embodiments, the transcribed modified AAV ITR further comprises a transcribed D region sequence (D or D' sequence in a wild-type AAV ITR) or a mutant D region sequence (e.g., a sequence having one or more nucleotide insertions, deletions, substitutions, and / or other mutations), wherein the mutant D region sequence substantially retains the function of the wild-type D region sequence. In other embodiments, the transcribed modified AAV ITR does not comprise a transcribed D region sequence, or does not comprise a mutant D region sequence (e.g., a sequence having one or more nucleotide insertions, deletions, substitutions, and / or other mutations), wherein the mutant D region sequence substantially retains the function of the wild-type D region sequence.

[0255] In certain embodiments, the modified AAV ITR of transcription includes a (functional) D region sequence of transcription. Optionally, the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO:3. Optionally, the modified AAV ITR of transcription includes the RNA equivalent of SEQ ID NO:3 (that is, the RNA equivalent has the base sequence identical to the DNA sequence of SEQ ID NO:3). Optionally, the modified AAV ITR of transcription includes the RNA equivalent of SEQ ID NO:3 (that is, the RNA equivalent has the base sequence identical to the DNA sequence of the reverse complementary sequence of SEQ ID NO:3).

[0256] In certain embodiments, the modified AAV ITR of transcription lacks the (functional) D region sequence of transcription. Optionally, the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO:2. Optionally, the modified AAV ITR of transcription includes the RNA equivalent of SEQ ID NO:2 (that is, the RNA equivalent has the base sequence identical to the DNA sequence of SEQ ID NO:2). Optionally, the modified AAV ITR of transcription includes the RNA equivalent of SEQ ID NO:2 reverse complementary sequence (that is, the RNA equivalent has the base sequence identical to the DNA sequence of SEQ ID NO:2 reverse complementary sequence).

[0257] As used herein, "D region sequence" refers to the D sequence or its reverse complementary sequence D' sequence. The position of the D region sequence depends on whether the ITR adopts the "forward" or "inverted" configuration. Figures 1A-1C For example, in wild-type AAV2 ITR (see Figure 2Srivastava et al., J. Viol. [Journal of Virology] 45(2):555-564, 1983, incorporated herein by reference), the positive strand ssDNA sequence comprises, from 5' to 3', palindromic sequence segments designated A, B, B', C, C', A', D, ..., D', A, C, C, B, B', and A', wherein A:A', B:B', C:C', and D:D' are reverse complements of each other and can form base-paired stem sequences (although the D and D' sequences may not actually base-pair with each other in the ssDNA AAV vector genome). The B:B' stem of the 5' ITR of the positive strand is closer to one end (5' end) of the sequence than the C:C' stem and is referred to as the forward ITR. The C:C' stem of the 3' ITR of the positive strand is closer to one end (3' end) of the sequence than the B:B' stem and is referred to as the inverted ITR.

[0258] The transcribed modified AAV ITR sequences of the present disclosure can lack a functional transcribed D region sequence (D or D' sequence) by, for example, deletion, insertion, substitution, and / or other mutation of one or more nucleotides of the transcribed wild-type D region sequence.

[0259] In certain embodiments, the RNA or transcribed modified AAV ITR sequence of the present disclosure comprises a mutated transcribed D region sequence and / or a mutated transcribed TRS sequence. In certain embodiments, the RNA or transcribed modified AAV ITR sequence of the present disclosure does not comprise a transcribed D region sequence and / or does not comprise a transcribed TRS / rcTRS sequence.

[0260] In certain embodiments, the transcribed modified AAV ITR is modified based on a transcribed wild-type forward ITR or a wild-type inverted ITR.

[0261] In certain embodiments, the wild-type forward ITR or wild-type inverted ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, AAVhu32, AAVhu37, AAVPHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8. Optionally, the wild-type inverted ITR has the nucleotide sequence of SEQ ID NO: 1.

[0262] In certain embodiments, the transcribed D region sequence is present and is not within the 3'-terminal 50 nucleotides (eg, 40 nt, 30 nt, 25 nt, or 20 nt) of the RNA.

[0263] In certain embodiments, the transcribed D region sequence is present and is within the 3'-terminal 50 nucleotides (eg, 40 nt, 30 nt, 25 nt, or 20 nt) of the RNA.

[0264] In certain embodiments, the transcribed modified AAV ITR is within 1000 nucleotides of the 3' terminus of the RNA. In certain embodiments, the transcribed modified AAV ITR is within 800 nucleotides of the 3' terminus of the RNA. In certain embodiments, the transcribed modified AAV ITR is within 500 nucleotides of the 3' terminus of the RNA. In certain embodiments, the transcribed modified AAV ITR is within 300 nucleotides of the 3' terminus of the RNA. In certain embodiments, the transcribed modified AAV ITR is within 200 nucleotides of the 3' terminus of the RNA.

[0265] In certain embodiments, the transcribed modified AAV ITR is 5' to a poly A sequence, a poly A signal sequence (eg, AAUAAA), or an RNA transcription termination sequence (eg, a histone downstream element).

[0266] As used herein, "poly A sequence" or "poly A tail" refers to a string of adenine ribonucleotides or adenosine monophosphate (e.g., a string of RNA in which each base is adenine). This poly A tail is important for nuclear export, translation, and stability of mRNA. The length of the poly A sequence can vary in different mRNAs or RNAs disclosed herein and can be about 250 nucleotides of poly A, about 230 nucleotides of poly A, about 200 nucleotides of poly A, about 180 nucleotides of poly A, about 160 nucleotides of poly A, about 140 nucleotides of poly A, about 120 nucleotides of poly A, about 100 nucleotides of poly A, or less.

[0267] As used herein, a "poly A signal sequence" refers to an RNA sequence (e.g., AAUAAA) located downstream of the most 3' exon and recognized by an RNA cleavage complex that cleaves the 3' terminal sequence of newly transcribed RNA by an RNA polymerase (e.g., Pol II), allowing polyadenylation to occur. Poly (A) polymerase then adds and extends the poly (A) tail by adding adenosine monophosphate units from ATP to the newly cleaved 3' end of the RNA. Initial RNA cleavage is typically catalyzed by the enzyme CPSF (cleavage / polyadenylation specificity factor) and occurs approximately 10-30 nucleotides downstream of its binding site - the poly A signal sequence (usually AAUAAA on the transcribed RNA). The sequence located at or immediately 5' of the RNA cleavage site is often (but not always) CA. The poly A signal sequence recognized by the RNA cleavage complex varies among different eukaryotic groups, with most human polyadenylation sites containing the AAUAAA sequence, although this sequence is less common in plant and fungal mRNAs. In addition, other variants that bind more weakly to CPSF exist. All such sequence motifs recognized by the RNA cleavage complex for RNA cleavage and subsequent polyadenylation are within the context of the poly A signal sequence.

[0268] Also as used herein, "the transcribed GU-rich region downstream of the poly A site" refers to a sequence (e.g., AAUAAA) that can be used by other proteins (such as cleavage stimulating factor or CstF) to enhance the binding specificity of CPSF to the poly A signal sequence.

[0269] In certain embodiments, the RNA of the present disclosure further comprises a recognition sequence for CFI (cleavage factor I), such as a set of UUGUAA sequences in mammals, which can recruit CPSF even if the AAUAAA poly A signal sequence is missing.

[0270] As used herein, "sequence for RNA transcription termination" includes RNA sequence motifs present at or near the 3' end of a transcribed RNA that terminates transcription (e.g., a transcribed RNA without a poly A tail). Almost all eukaryotic mRNAs, with the exception of metazoan replication-dependent histone mRNAs, are polyadenylated, where mRNA processing occurs at a site with a highly conserved stem-loop structure and a purine-rich region approximately 20 nucleotides downstream. These are a minority (if not the only) eukaryotic mRNAs that lack a poly (A) tail and end with a stem-loop structure followed by a purine-rich sequence called a histone downstream element (HDE) or histone 3'UTR stem-loop. The HDE guides the location at which the RNA is cleaved during / after transcription, thereby forming the 3' end of the histone mRNA. The HDE is involved in the nucleocytoplasmic transport of histone mRNAs, as well as the regulation of stability and translation efficiency in the cytoplasm.

[0271] In certain embodiments, the RNA of the present disclosure further comprises a second transcribed modified AAV ITR of the present disclosure. In certain embodiments, the second transcribed modified AAV ITR has a transcribed functional RBE sequence but lacks a second transcribed TRS or a second transcribed rcTRS or both; optionally, the second transcribed modified AAV ITR further comprises or lacks a second transcribed D region sequence. In certain embodiments, the second transcribed modified AAV ITR comprises a second transcribed mutated D region sequence and / or a second transcribed mutated TRS sequence.

[0272] In certain embodiments, for RNAs of the present disclosure having two transcribed modified AAV ITRs, the first transcribed modified AAV ITR and the second transcribed modified AAV ITR are identical.

[0273] In certain embodiments, for RNAs of the present disclosure having two transcribed modified AAV ITRs, the first transcribed modified AAV ITR and the second transcribed modified AAV ITR are different.

[0274] In certain embodiments, the transcribed modified AAV ITR, the second transcribed modified AAV ITR (if present), comprises a deletion from, a mutation in, or an insertion into the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS.

[0275] In certain embodiments, for an RNA of the present disclosure having two transcribed modified AAV ITRs, the second transcribed modified AAV ITR is within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the 5' terminus of the RNA sequence.

[0276] In certain embodiments, the RPS comprises an MS2 sequence, a PP7 binding site, or a com binding site, and the RPS interacting molecule comprises an RPS interacting protein (RPSIP, e.g., an RPS binding protein) that is capable of interacting directly or indirectly with the RPS, e.g., recognizing and binding, such as a bacteriophage-derived MS2 coat protein (MCP) for the MS2 sequence, a PP7 bacteriophage coat protein (PCP) for the PP7 binding site, or a bacteriophage COM protein (COM) for the com binding site. The sequences of these RPS / RPSIP pairs are described in the sequence section of the specification.

[0277] Any of the one or more RPS sequences described above, including any of the transcribed modified ITR sequences, and any of the MS2 sequences, PP7 binding sites, and / or com binding sites, alone or in combination, in the presence of suitable / compatible cognate RPSIPs, can facilitate packaging of the RNA of the present disclosure into DNA virus particles.

[0278] In certain embodiments, RPSIP is a protein component of the viral packaging system of a DNA virus virion, or is directly or indirectly associated therewith. For example, in some embodiments, RPSIP is a protein component of the viral packaging system of a DNA virus, such as Rep78, Rep68, Rep52, and / or Rep40 of AAV. For example, in some embodiments, RPSIP can be directly fused to a protein component of the viral packaging system of a DNA virus. Exemplary protein components of the viral packaging system of AAV include any one of the Rep proteins (such as Rep78 and / or Rep68 of adeno-associated virus 2 (AAV2)), and / or any one of the assembly activation proteins (AAP).

[0279] In certain embodiments, the fusion is an N-terminal fusion, wherein a RPSIP (such as MCP, PCP, or COM) is fused to the N-terminus of the Rep68 / 78 protein and / or AAP.

[0280] In certain embodiments, the fusion is an N-terminal fusion, wherein a RPSIP (such as MCP, PCP, or COM) is fused to the C-terminus of the Rep68 / 78 protein and / or AAP.

[0281] In certain embodiments, the fusion is a direct fusion, without a linker sequence in between.

[0282] In certain embodiments, the fusion is through one or more linker sequences, such as a flexible peptide linker that can include a Gly and Ser-rich linker or a GS linker. Representative GS linkers include 1, 2, 3, 4, 5 or more repeats of Gly or Ser, such as GS, GSS, GSSS (SEQ ID NO: 44), GSSSS (SEQ ID NO: 45) and repeats thereof (e.g., (GS p ) n (SEQ ID NO: 87), wherein p is an integer between 1-5 and n is an integer between 1-20). An exemplary such GS linker is the GS3 (SEQ ID NO: 44) linker or the GS4 (SEQ ID NO: 45) linker. In certain embodiments, p is 3 or 4, and n is 1.

[0283] In certain embodiments, the RNA of the present disclosure may comprise, but preferably does not comprise, a transcribed DNA packaging signal, e.g., a transcribed wild-type AAV ITR sequence. For example, the RNA of the present disclosure may comprise a transcribed modified AAV ITR sequence having additions, deletions, and / or substitutions of nucleotides of the corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capacity of the DNA virus particle.

[0284] In certain embodiments, the RNA of the present disclosure further comprises one or more of the following: (1) a coding sequence for a protein (such as an mRNA encoding a therapeutic protein or a CRISPR / Cas effector enzyme (including any of the Cas effectors described below, for example, Cas9 or a variant thereof, optionally fused to a base editor), a non-coding RNA (ncRNA), or a functional RNA (such as tRNA, ribosomal RNA (rRNA), an RNAi agent or a precursor thereof, siRNA, shRNA, miRNA or a precursor thereof, including pre-miRNA and primary miRNA, antisense RNA (ASO), piRNA, an RNA component of a CRISPR-Cas system, such as a guide RNA (or gRNA), a single guide RNA (or sgRNA, a chimeric RNA, an RNA chimera), a CRISPR RNA (crRNA), or a tracr (1) a transcribed sequence or sequence, such as a transcribed polyadenylation (polyA) signal sequence, and optionally, a transcribed polyA site and a GU-rich region downstream of the transcribed polyA site; (2) a transcribed transcriptional enhancer; (3) a transcribed intron sequence or exon sequence (such as a sequence for enhancing protein expression); (4) a 5'UTR sequence; (5) a 3'UTR sequence; (6) a poly A sequence, or a (transcribed) polyadenylation (polyA) signal sequence, and optionally, a transcribed poly A site and a GU-rich region downstream of the transcribed poly A site; (7) a post-transcriptional regulatory element or sequence, such as a transcribed woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) sequence; and / or (8) a transcriptional termination sequence (such as a histone downstream element).

[0285] In certain embodiments, the RNA of the present disclosure comprises an RPS located 3' to a post-transcriptional regulatory element or sequence and 5' to a poly A sequence or poly A signal sequence.

[0286] For example, in certain embodiments, the RNAs of the present disclosure comprise, in the 5' to 3' direction, an RSI; an optional transcribed WPRE sequence (which may or may not be present); an RPS (e.g., a transcribed modified AAV ITR, an MS2 sequence, a PP7 binding site, or a com binding site); and a poly A sequence or a poly A signal sequence.

[0287] In certain embodiments, the RNA of the present disclosure encodes, or the GOI comprises, a protein (e.g., a fluorescent protein, a therapeutic protein, an antigenic protein, or a gene editing protein, such as a Cas protein, a ZFN protein, a TALEN protein), an enzyme (e.g., a Cre protein or a CRISPR / Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or variants thereof), a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a short hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof (including a pre-miRNA and a prim-miRNA), a ribosomal RNA (rRNA), an antisense sequence or oligonucleotide (ASO), an RNA component of a CRISPR-Cas system, including a guide RNA (or gRNA), such as a single guide RNA (or sgRNA, a chimeric RNA, an RNA chimera), a CRISPR RNA (crRNA), and a tracr RNA, a guide RNA or gRNA of a CRISPR / Cas effector enzyme, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR.

[0288] The total length of the RNA disclosed herein depends on the packaging capacity of the AAV virus particles. Most AAV virus particles have a packaging capacity of about 4,700-5,200 nucleotides, but some AAV virus particles, such as AAV5 particles, can package up to 8,900 nucleotides.

[0289] Thus, in certain embodiments, the RNA of the present disclosure to be packaged into AAV viral particles is a single-stranded RNA (ssRNA) of less than about 8,900 nucleotides in length.

[0290] In certain embodiments, the RNA sequence is an ssRNA of less than about 8,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 7,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 6,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 5,200 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 4,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 3,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of less than about 2,000 nucleotides in length.

[0291] In certain embodiments, the RNA sequence is an ssRNA of about 4,700-5,200 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of about 4,700-5,000 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of about 4,700-4,800 nucleotides in length. In certain embodiments, the RNA sequence is an ssRNA of about 4,700 nucleotides in length.

[0292] Another aspect of the present disclosure provides a polynucleotide comprising a (transcription) cassette encoding an RNA of the present disclosure; optionally, the polynucleotide is a DNA sequence (e.g., a DNA plasmid), the DNA sequence optionally comprising a stuffer sequence in the backbone of the DNA plasmid, and / or optionally not comprising a functional DNA packaging signal, such as an AAV ITR.

[0293] In certain embodiments, the polynucleotide comprising the cassette is a DNA vector encoding the RNA of the present disclosure. Such a DNA vector and / or its cassette can be used to transcribe and produce the RNA of the present disclosure for further packaging into, for example, AAV virus particles.

[0294] In certain embodiments, the polynucleotide further comprises a promoter operably linked to the RNA of the disclosure encoded by the cassette and driving its transcription to produce the RNA of the disclosure.

[0295] In certain embodiments, the promoter is a ubiquitous promoter.

[0296] In certain embodiments, the promoter is a tissue-specific promoter.

[0297] In certain embodiments, the promoter is a constitutive promoter.

[0298] In certain embodiments, the promoter is an inducible promoter.

[0299] In certain embodiments, the polynucleotide further comprises an enhancer that increases transcription of the RNA sequence driven by the promoter.

[0300] Another aspect of the present disclosure provides a recombinant DNA viral particle comprising an RNA genome (e.g., an RNA of the present disclosure or an RNA sequence transcribed from a polynucleotide of the present disclosure) packaged in a protein shell (e.g., a capsid) of a DNA virus (e.g., an AAV virus, or an oncolytic virus).

[0301] In certain embodiments, the DNA virus is AAV, and the recombinant DNA virus particle is a recombinant RNA adeno-associated virus (rRAAV) particle, wherein the recombinant RNA adeno-associated virus particle comprises: (1) an AAV capsid; and (2) an RNA of the present disclosure or an RNA sequence transcribed from a polynucleotide of the present disclosure packaged in the AAV capsid.

[0302] In certain embodiments, the AAV capsid comprises a capsid from an AAV serotype of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, or 7m8.

[0303] A related aspect of the present disclosure provides a population of recombinant DNA viral particles (e.g., rRAAV particles) comprising a plurality of recombinant DNA viral particles (e.g., rRAAV particles) of the present disclosure, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant DNA viral particles (e.g., rRAAV particles) in the population have an encapsidated RNA sequence of the present disclosure or an RNA sequence transcribed from a polynucleotide of the present disclosure packaged therein.

[0304] In certain embodiments, the population of recombinant viral particles (e.g., rRAAV particles) comprises at least 1×10 4 Virus particles, at least 2×10 4 Virus particles, at least 5×10 4 Virus particles, at least 1×10 5 Virus particles, at least 2×10 5 Virus particles, at least 5×10 5 Virus particles, at least 1×10 6 Virus particles, at least 2×10 6 Virus particles, at least 5×10 6 Virus particles, at least 1×10 7 Virus particles, at least 2×10 7 Virus particles, at least 5×10 7 Virus particles, at least 1×10 8 Virus particles, at least 2×10 8 Virus particles, at least 5×10 8 Virus particles, at least 1×10 9 Virus particles, at least 2×109 Virus particles, at least 5×10 9 Virus particles, at least 1×10 10 Virus particles, at least 2×10 10 Virus particles, at least 5×10 10 Virus particles, at least 1×10 11 Virus particles, at least 2×10 11 Virus particles, at least 5×10 11 Virus particles, at least 1×10 12 Virus particles, at least 2×10 12 Virus particles, at least 5×10 12 Virus particles, at least 1×10 13 Virus particles, at least 2×10 13 Virus particles, at least 5×10 13 Virus particles, at least 1×10 14 Virus particles, at least 2×10 14 Virus particles, at least 5×10 14 Virus particles, at least 1×10 15 Virus particles, at least 2×10 15 Virus particles, at least 5×10 15 Virus particles, at least 1×10 16 Virus particles, at least 2×10 16 Virus particles, or at least 5×10 16 Virus particles.

[0305] In certain embodiments, at most 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, 1%, 0.1%, 0.01% or less of a population of recombinant viral particles have non-RNA (e.g., DNA) encapsidated within the viral particles.

[0306] Another aspect of the present disclosure provides a host cell comprising the RNA of the present disclosure, the polynucleotides of the present disclosure, an RNA sequence transcribed from the polynucleotides of the present disclosure, the recombinant DNA viral particles of the present disclosure (e.g., rRAAV particles), and / or a population of the recombinant DNA viral particles of the present disclosure (e.g., rAAV particles).

[0307] In certain embodiments, the host cell further comprises a viral packaging system that facilitates packaging of the RNA of the present disclosure or RNA sequences transcribed from the polynucleotides of the present disclosure into DNA viral particles.

[0308] In certain embodiments, the viral packaging system comprises: (1) an AAV rep gene (e.g., a coding sequence for Rep78, Rep68, Rep52, and / or Rep40) and an AAV cap gene (e.g., a coding sequence for VP1, VP2, and / or VP3, AAP, and / or MAAP), or expression products thereof, wherein the genes are under the transcriptional control of one or more promoters that drive transcription of the rep and cap genes; (2) one or more coding sequences for one or more proteins required for AAV packaging, such as adenovirus E2A, E4, and VA genes, or the one or more proteins; and (3) an RPS interacting molecule or a coding sequence thereof.

[0309] In certain embodiments, the ability of a viral packaging system to package a DNA sequence into a DNA viral virion is reduced, attenuated, or substantially eliminated by, for example, (1) removing part or all of a DNA packaging signal, such as an AAV ITR, from a polynucleotide encoding an RNA of the present disclosure or a polynucleotide of the present disclosure, (2) modifying, such as mutating, the AAV rep gene, the AAV cap gene, and / or the coding sequence(s) for one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of a DNA sequence into a DNA viral virion (e.g., a Y156F mutation, KDE-mu, or EKE-mu in the consensus sequence of Rep78 and Rep68 proteins); and / or (3) increasing the size of a polynucleotide encoding an RNA of the present disclosure or a polynucleotide of the present disclosure. In embodiments, the size of a polynucleotide encoding an RNA of the present disclosure or a polynucleotide of the present disclosure is increased by inserting a stuffer sequence (e.g., an intron) into (e.g., the backbone of) a polynucleotide (e.g., a DNA plasmid).

[0310] In certain embodiments, the AAV rep gene, the AAV cap gene, and / or proteins required for AAV packaging comprise mutations that attenuate or reduce the ability to facilitate packaging of DNA into DNA viral virions.

[0311] In certain embodiments, the Rep68 / Rep78 protein required for DNA packaging comprises a mutation that impairs or reduces its trs-endonuclease activity. Trs-endonuclease activity is believed to be required for the dissociation of AAV replication (DNA) intermediates at the trs sequence or site, thereby allowing for the dissociation of individual units of AAV ssDNA prior to packaging into AAV capsids.

[0312] In certain embodiments, the trs-endonuclease mutation comprises a Y156F mutation in the consensus sequence of the Rep78 and Rep68 proteins.

[0313] In certain embodiments, the Rep78 / Rep68 protein comprises a KDE-mu mutation (see sequence in the Sequence section below).

[0314] In certain embodiments, the Rep78 / Rep68 protein comprises an EKE-mu mutation (see sequence in the Sequence section below).

[0315] In certain embodiments, the Rep78 / Rep68 protein comprises two or more mutations selected from the group consisting of a Y156F mutation, a KDE-mu mutation, and an EKE-mu mutation.

[0316] In certain embodiments, Rep68 / Rep78 is from any of AAV serotypes AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8, and has corresponding trs-endonuclease mutations of Y156F mutation, KDE-mu mutation, and / or EKE-mu mutation.

[0317] In certain embodiments, the host cell further comprises: (1) coding sequences for the AAV rep gene and the AAV cap gene, which are under the transcriptional control of one or more promoters that drive transcription of the rep gene and the cap gene; and (2) coding sequences for proteins required for AAV packaging, such as the adenovirus E2A, E4, and VA genes.

[0318] In certain embodiments, the host cell is a mammalian cell, such as a HEK293 cell or a variant thereof (eg, a HEK293T cell), or an insect cell, such as an Sf9 or Sf21 cell.

[0319] Another aspect of the present disclosure provides a method for producing a recombinant DNA viral particle (e.g., rRAAV particle) or a population of recombinant DNA viral particles (e.g., rRAAV particles) of the present disclosure, the method comprising: a) culturing a host cell of the present disclosure for a sufficient time, and b) harvesting the recombinant DNA viral particle or the population of recombinant DNA viral particles.

[0320] In certain embodiments, the method further comprises isolating or purifying the recombinant DNA virus particle or a population of recombinant DNA virus particles.

[0321] Another aspect of the present disclosure provides a method for producing recombinant DNA viral particles (e.g., rRAAV particles) or a population of recombinant DNA viral particles, the method comprising: a) contacting a viral packaging system (e.g., an AAV packaging system) with an RNA of the present disclosure or an RNA sequence transcribed from a polynucleotide of the present disclosure for a period of time sufficient to produce the recombinant DNA viral particles of the present disclosure or the population of recombinant DNA viral particles of the present disclosure, and b) harvesting the recombinant DNA viral particles of the present disclosure or the population of recombinant DNA viral particles of the present disclosure; and optionally, c) isolating or purifying the harvested recombinant DNA viral particles of the present disclosure or the population of recombinant DNA viral particles of the present disclosure.

[0322] In certain embodiments, the viral packaging system (e.g., an AAV packaging system) comprises: (1) one or more proteins for assembling the protein shell of the DNA virus virus particle for packaging the RNA sequence (e.g., VP1, VP2, and / or VP3 for assembling the AAV capsid), or one or more coding sequences thereof; (2) one or more proteins for promoting the assembly of the protein shell and / or the packaging of the RNA sequence into the protein shell of the DNA virus virus particle (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging), or one or more coding sequences thereof (e.g., adenovirus E2a, E4, and VA genes); and (3) an RPS interacting molecule or its coding sequence. Optionally, the ability of the viral packaging system to package the DNA sequence into DNA viral virions is reduced, attenuated, or substantially eliminated by, for example: (1) removing part or all of the DNA packaging signal, such as the AAV ITR, on the polynucleotide encoding the RNA of the present disclosure or on the polynucleotide of the present disclosure, (2) modifying, such as mutating, the one or more coding sequences of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into the DNA viral virions (e.g., Y156F mutation, KDE-mu, or EKE-mu in the consensus sequence of Rep78 and Rep68 proteins); and / or (3) increasing the size of the polynucleotide encoding the RNA of the present disclosure or the polynucleotide of the present disclosure.

[0323] Another aspect of the present disclosure provides a system for packaging the RNA of the present disclosure or the RNA sequence transcribed from the polynucleotide of the present disclosure into DNA virus particles, the system comprising: (1) one or more proteins for assembling the protein shell of the DNA virus particles for packaging the RNA sequence (e.g., VP1, VP2, and / or VP3 for assembling AAV capsids), or one or more coding sequences thereof; (2) one or more proteins for promoting the assembly of the protein shell and / or packaging of the RNA of the present disclosure into the protein shell of the DNA virus particles (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging), or one or more coding sequences thereof (e.g., adenovirus E2a, E4, and VA genes); and (3) an RPS interacting molecule or its coding sequence. Optionally, the ability of the viral packaging system to package the DNA sequence into the DNA viral virion is reduced, attenuated, or substantially eliminated by, for example: (1) removing part or all of the DNA packaging signal, such as the AAV ITR, on the polynucleotide encoding the RNA of the present disclosure or on the polynucleotide of the present disclosure, (2) modifying, such as mutating, the one or more coding sequences of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into the DNA viral virion (e.g., Y156F mutation, KDE-mu, or EKE-mu in the consensus sequence of Rep78 and Rep68 proteins); and / or (3) increasing the size of the polynucleotide encoding the RNA of the present disclosure or the polynucleotide of the present disclosure.

[0324] Another aspect of the present disclosure provides a method of delivering an RNA sequence of interest (RSI) to a cell, plant, or animal, the method comprising contacting the cell, plant, or animal with a recombinant DNA viral particle (e.g., rRAAV particle) of the present disclosure, a population of recombinant DNA viral particles (e.g., rRAAV particles) of the present disclosure, or a recombinant DNA viral particle (e.g., rRAAV particle) or a population of recombinant DNA viral particles (e.g., rRAAV particles) produced by a method of the present disclosure, wherein the GOI is optionally encoded by an RNA of the present disclosure.

[0325] Another aspect of the present disclosure provides a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount or dose of a population of recombinant DNA viral particles (e.g., rRAAV particles) of the present disclosure or produced by the methods of the present disclosure.

[0326] Another aspect of the present disclosure provides use of a recombinant DNA viral particle (e.g., rRAAV particle) of the present disclosure, a population of recombinant DNA viral particles (e.g., rRAAV particles) of the present disclosure, or a recombinant DNA viral particle (e.g., rRAAV particle) or a population of recombinant DNA viral particles (e.g., rRAAV particles) produced by a method of the present disclosure in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.

[0327] Another aspect of the present disclosure provides a fusion protein or conjugate comprising the RPSIP of the present disclosure fused or conjugated to a protein component of the viral packaging system of a DNA virus, wherein the RPSIP interacts / binds with the RPS on the RNA of the present disclosure to facilitate packaging of the RNA sequence into the DNA virus.

[0328] In certain embodiments, the RPS is MS2 and the RPSIP is MCP.

[0329] In certain embodiments, the RPS is a PP7 binding site and the RPSIP is a PCP.

[0330] In certain embodiments, the RPS is com and the RPSIP is a bacteriophage COM protein.

[0331] In certain embodiments, the fusion or conjugate comprises more than one RPSIP, each of which independently binds to one or more RPSs on the RNA of the present disclosure. In certain embodiments, at least two of the more than one RPSIPs are the same. In certain embodiments, at least two of the more than one RPSIPs are different.

[0332] In certain embodiments, the fusion or conjugate comprises two MCPs in tandem.

[0333] In certain embodiments, the protein component of the viral packaging system of a DNA virus comprises the Rep protein of AAV, such as Rep68 or Rep78 of AAV.

[0334] In certain embodiments, the Rep protein comprises one or more mutations that impair or reduce trs-endonuclease activity. In certain embodiments, the mutation comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation.

[0335] In certain embodiments, the protein component of the viral packaging system of a DNA virus comprises an assembly activating protein (AAP).

[0336] In certain embodiments, RPSIP is directly fused to a protein component of the viral packaging system of a DNA virus (eg, Rep protein or AAP).

[0337] In certain embodiments, RPSIP is fused to a protein component of the viral packaging system of a DNA virus (eg, Rep protein or AAP) via a peptide linker.

[0338] In certain embodiments, the peptide linker is a flexible linker, such as a linker containing Gly and Ser. In certain embodiments, the linker containing Gly and Ser comprises GS n 1-20 repeats (e.g., 1-5 or 1-3 repeats) of , wherein n is 1, 2, 3, 4, or 5. In certain embodiments, GS n The linker is GS2, GS3 (SEQ ID NO: 44) or GS4 (SEQ ID NO: 45) with 1-4 (eg, 2) repeats. In certain embodiments, the linker is GSSGSS (SEQ ID NO: 46).

[0339] In certain embodiments, the fusion protein comprises MCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, MCP is fused to the N-terminus of Rep (MCP-Rep). In certain embodiments, the Rep fused to MCP comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, the MCP-Rep fusion is synthesized by GS n In some embodiments, the MCP-Rep comprises two MCPs in series (e.g., without any linker between the two MCP moieties). n The C-terminus of a linker such as GSSGSS (SEQ ID NO: 46).

[0340] In certain embodiments, the fusion protein comprises PCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, PCP is fused to the N-terminus of Rep (PCP-Rep). In certain embodiments, the Rep fused to PCP comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, the PCP-Rep fusion is synthesized by GS nIn some embodiments, the PCP-Rep comprises two PCPs in series (e.g., without any linker between the two PCP moieties). In some embodiments, the PCP is located within another GS n The C-terminus of a linker such as GSSGSS (SEQ ID NO: 46).

[0341] In certain embodiments, the fusion protein comprises COM and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, COM is fused to the N-terminus of Rep (COM-Rep). In certain embodiments, the Rep fused to COM comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In certain embodiments, the COM-Rep fusion is synthesized by GS n In some embodiments, the COM-Rep comprises two COMs in series (e.g., without any linker between the two COM moieties). In some embodiments, the COM is located within another GS n The C-terminus of a linker such as GSSGSS (SEQ ID NO: 46).

[0342] In certain embodiments, the fusion protein comprises MCP and AAP. In certain embodiments, MCP is fused to the N-terminus of AAP (MCP-AAP, or MA). In certain embodiments, MCP is fused to the C-terminus of AAP (AAP-MCP, or AM). In certain embodiments, the MCP-AAP or AAP-MCP fusion is synthesized by GS. n In certain embodiments, the MCP-AAP fusion is linked to another GS n The C-terminus of the linker is GSSGSS (SEQ ID NO: 46). In certain embodiments, the AAP-MCP fusion is at the C-terminus of another GS n The N-terminus of a linker such as GSSGSS (SEQ ID NO: 46).

[0343] Another aspect of the present disclosure provides a polynucleotide encoding any of the fusions between the RPSIP of the present disclosure and a protein component of the viral packaging system of a DNA virus (eg, AAP or Rep protein).

[0344] With respect to the general aspects of the disclosure described above, the following sections provide additional details of specific elements of the disclosure described herein. It is contemplated that each specific element can be combined with any one or more additional elements of the disclosure, even if all possible combinations or permutations of elements are not explicitly listed.

[0345] 2. AAV serotype

[0346] The AAV particles packaging the ribopolynucleotides of the present disclosure may comprise or be derived from any natural or recombinant AAV serotype.

[0347] According to the present disclosure, the AAV particles may utilize or be based on a serotype selected from any of the following serotypes and variants thereof, including but not limited to: AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV 12. AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV13 0.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu.l1 , AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAVl-7 / rh.48, A AVl-8 / rh.49, AAV2, AAV2.5T, AAV2-15 / rh.62, AAV223.1, AAV223.2, AAV223.4, AAV 223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh .51, AAV27.3, AAV29.3 / bb.l, AAV29.5 / bb.2, AAV2G9, AAV-2-precursor miRNA-101, AAV3 , AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.l7, AAV33. 4 / hu.l5, AAV33.8 / hu.l6, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, A AV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-1b, AAV42 -2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV 42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r 11.64, AAV4-8 / rh.64, AAV4-9 / rh.54, AAV5, AAV52.1 / hu.20, AAV52 / hu.19, AAV5-22 / rh.58, AAV5-3 / rh.57、AAV54.1 / hu.21、AAV54.2 / hu.22、AAV54.4R / hu.27、AAV54.5 / hu.23、AAV54.7 / hu.24、AAV58.2 / hu.25、AAV6、AAV6.1、AAV6.1.2、AAV6.2、AAV7、AAV7.2、AAV7.3 / hu.7、AAV8、AAV-8b、AAV-8h、AAV9、AAV9.11、AAV9.13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAV A3.3、AAV A3.4、AAV A3.5、AAV A3.7、AAV-b、AAVC1、AAVC2、AAVC5、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5Rl、 AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAV-h、AAVH-1 / hu.l、AAVH2、AAVCy. AVH-5 / hu.3、AAVH6、AAVhE1.1、AAVhER1.14、AAVhErl.16、AAVhErl.18、AAVhER1.23、AAVhErl.35、AAVhErl. 36、AAVhErl.5、AAVhErl.7、AAVhErl.8、AAVhEr2.16、AAVhEr2.29、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AA VhEr2.4、AAVhEr3.1、AAVhu.l、AAVhu.10、AAVhu.ll、AAVhu.l、AAVhu.12、AAVhu.13、AAVhu.14 / 9、AAVhu.15 、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.19、AAVhu.2、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.2 4、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.3、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.3 5、AAVhu.37、AAVhu.39、AAVhu.4、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44Rl、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48Rl、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5、AAVhu.51、AAVhu.52、AAVhu. u.53、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.6、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.7、AAVhu. u.8、AAVhu.9、AAVhu.t19、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVLG-9 / hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK04、AAV-LK04 AV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、 AAVN721-8 / rh.43, AAV-PAEC, AAV-PAEC11, AAV-PAEC12, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAVpi.l, AAVpi.2, AAVpi.3, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.l3R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.2, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, A AVrh.25、AAVrh.2R、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.43、AAVrh.44、AAVrh.45、AAVrh.46、AAVrh.47、AAVrh.48、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.50、AAVrh.51、AAVrh.52. AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.64Rl, A AVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, goat AAV, Japanese AAV 10, authentic AAV (ttAAV), UPENN AAV 10, AAV-LK16, AAAV, AAV shuffled 100-1, AAV shuffled 100-2, AAV shuffled 100-3, AAV shuffled 100-7, AAV shuffled 10-2, AAV shuffled 10-6, AAV shuffled 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0348] In certain embodiments, the AAV serotype may comprise a mutation in the AAV9 sequence, such as the sequence described by Pulicherla et al. (Molecular Therapy 19(6):1070-1078, 2011), such as AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[0349] In certain embodiments, the AAV serotype may comprise a sequence described in US 6,156,303, such as AAV3B (SEQ ID NOs: 1 and 10 in US 6,156,303), AAV6 (SEQ ID NOs: 2, 7, and 11 in US 6,156,303), AAV2 (SEQ ID NOs: 3 and 8 in US 6,156,303), AAV3A (SEQ ID NOs: 4 and 9 in US 6,156,303), or a derivative thereof.

[0350] In certain embodiments, the serotype may be AAV-DJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8) described by Grimm et al. (Journal of Virology 82(12):5887-5911, 2008). The amino acid sequence of AAV-DJ8 may comprise two or more mutations to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in US Pat. No. 7,588,772 may comprise two mutations: (1) R587Q (Arg at amino acid 587 to glutamine Gln), and (2) R590T. As another non-limiting example, the AAV-DJ sequence may comprise three mutations: (1) K406R, (2) R587Q, and (3) R590T.

[0351] In certain embodiments, the AAV serotype may comprise a sequence described in WO 2015 / 121501, such as authentic AAV (ttAAV) (SEQ ID NO: 2 in WO 2015 / 121501), the so-called UPenn AAV10 (SEQ ID NO: 8 in WO 2015 / 121501), or the so-called Japanese AAV10 (SEQ ID NO: 9 in WO 2015 / 121501), or a variant thereof.

[0352] The selection or use of an AAV capsid serotype may be from a variety of species. In certain embodiments, the AAV may be an avian AAV (aAAV). The aAAV serotype may comprise a sequence described in US 9,238,800, such as aAAV (SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14 in US 9,238,800), or a variant thereof.

[0353] In certain embodiments, the AAV may be a bovine AAV (bAAV). The bAAV serotype may comprise a sequence described in US 9,193,769, such as bAAV (SEQ ID NOs: 1 and 6 in US 9,193,769), or a variant thereof. The bAAV serotype may comprise a sequence described in US 7,427,396, such as bAAV (SEQ ID NOs: 5 and 6 in US 7,427,396), or a variant thereof.

[0354] In certain embodiments, the AAV may be a goat AAV. The goat AAV serotype may comprise the sequence described in US 7,427,396, such as goat AAV (SEQ ID NO: 3 in US 7,427,396), or a variant thereof.

[0355] In certain embodiments, an AAV can be engineered as a hybrid AAV derived from two or more parental serotypes.

[0356] In certain embodiments, the AAV may be AAV2G9, which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may comprise sequences described in US 2016-0017005 A1. (incorporated herein by reference).

[0357] In certain embodiments, the AAV can be a serotype generated from an AAV9 capsid library having mutations in amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy 19(6):1070-1078, 2011, incorporated herein by reference). The serotypes and corresponding nucleotide and amino acid substitutions can be, but are not limited to: AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G120 3A, G1785T, W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720 T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.4 4(A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W5 09R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50(A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134 Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510 A; P504T), AAV9.80 (G1441A; G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T14 64C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L4 39R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474 R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L), and AAV9.95 (T1605A; F535L). .

[0358] In certain embodiments, AAV can be an AAV capsid comprising at least one CD8 + Serotype of the T-cell epitope. As non-limiting examples, the serotype can be AAV1, AAV2, or AAV8.

[0359] In certain embodiments, the AAV may be a variant, such as PHP.A or PHP.B described in Deverman (Nature Biotechnology. 34(2):204-209, 2016, incorporated herein by reference).

[0360] In certain embodiments, the AAV can be a serotype generated by Cre-based AAV targeted evolution (CREATE) described by Deverman et al. (Nature Biotechnology 34(2):204-209, 2016, incorporated herein by reference). In certain embodiments, the AAV serotype generated in this manner has improved CNS transduction and / or neuronal and astrocytic tropism compared to other AAV serotypes.

[0361] In some embodiments, the AAV serotype can be an AAV9 derivative having a 7 amino acid insertion between amino acids 588 and 589. Non-limiting examples of these 7 amino acid insertions include PHP.A, PHP.B, PHP.B2, PHP.B3, PHP.N, PHP.S, G2A12, G2A15, G2A3, G2B4, and G2B5.

[0362] In certain embodiments, the AAV can be any serotype selected from SEQ ID NOs: 4,734-5,302 and Table 2 of WO 2018 / 002719A1 (incorporated herein by reference). In certain embodiments, the AAV can be encoded by a sequence, fragment, or variant as set forth in SEQ ID NOs: 4,734-5,302 of WO 2018 / 002719A1 (incorporated herein by reference).

[0363] In certain embodiments, the AAV VP1 capsid sequence is one of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, or 7m8.

[0364] 3. Modified AAV ITR

[0365] According to the disclosure herein, any transcribed AAV ITR sequence (RNA) can be modified by engineering the encoding modified AAV ITR DNA template to, for example, eliminate or inactivate the TRS or its equivalent, and / or eliminate its D region sequence. The transcribed modified AAV ITR resulting from transcribing such a modified AAV ITR DNA template retains the ability to facilitate packaging of the disclosed RNA into AAV viral particles.

[0366] During AAV DNA replication, the ITR is nicked at the terminal dissociation site (TRS) by the virally encoded Rep protein. This initiation function requires three DNA sequence elements: the Rep binding element (RBE), a small palindromic sequence containing a single tip of an internal hairpin within the terminal repeat (RBE'), and the TRS. During TRS nicking, Rep is tethered to the RBE (DNA) in a specific orientation. This orientation appears to align Rep within the AAV ITR, allowing specific nucleotides to contact the RBE' and guide nicking of the TRS. Changes in the polarity or position of the RBE relative to the TRS significantly inhibit Rep nicking. Substitutions within the RBE' also reduce Rep specific activity, but to a lesser extent. During TRS nicking, Rep's interactions with the RBE and RBE' are functionally distinct, as Rep's contact with the RBE is required for both DNA helicase activity and TRS cleavage. Conversely, Rep's interaction with the RBE' is primarily required for ITR unwinding and formation of the TRS stem-loop structure, rather than for TRS cleavage.

[0367] There is at least one transcribed modified ITR sequence (RNA) of the present disclosure on the RNA of the present disclosure. The transcribed modified ITR sequence of the present disclosure is preferably closer to the 3' end of the RNA of the present disclosure.

[0368] In certain embodiments, the RNA of the present disclosure comprises two transcribed modified ITR sequences.

[0369] In certain embodiments, both transcribed modified ITR sequences may be derived from the same AAV serotype.

[0370] In another embodiment, the two transcribed modified ITR sequences may be derived from two different AAVs of different serotypes.

[0371] In certain embodiments, one or more transcribed modified ITR sequences comprise insertions, deletions, and / or mutations.

[0372] In some embodiments, the rRAAV RNA sequences disclosed herein comprise one transcribed modified / mutated ITR sequence and one transcribed wild-type ITR sequence.

[0373] In some embodiments, one or more transcribed modified ITR sequences are based on wild-type ITRs in either forward or reverse orientation.

[0374] The transcribed modified ITR sequence of the present invention or its encoding DNA sequence can be easily prepared based on the wild-type ITR sequence known in the art.

[0375] Representative (non-limiting) wild-type ITR sequences (DNA) include at least the following sequences listed in Table 1. Figure 1B and 1C The multiple sequence alignment of the 5' ITR sequences and the multiple sequence alignment of the 3' ITR sequences of AAV1-AAV7, including the consensus sequence, TRS, RBE and D region sequences, are shown respectively.

[0376] As used herein, "RBE sequence" or "RBE" refers to AAV ITR sequences within the A:A' palindromic stem sequence, which, when base-paired, form the stem (usually a double-stranded region of about 21-23 or about 22 bp) and promote binding of the ITR to AAV Rep proteins (Rep78 and Rep68). Figure 1A Representative RBE sequences are shown in both the forward and inverted configurations of wild-type AAV2 ITRs.

[0377] Wild-type ITR sequences for many AAV serotypes known in the art are readily available, and each can be aligned with other AAV ITRs, such as Figure 1B and 1C The alignment results can be used to identify the RBE sequence of any AAV ITR.

[0378] "Transcribed (functional) RBE" refers to a transcribed RNA corresponding to an RBE DNA template, which is a wild-type RBE or a functional variant thereof having one or more nucleotide insertions, deletions, substitutions, and / or other mutations, as long as the functional variant RBE substantially retains the ability to bind to Rep (e.g., retains at least about 60%, 70%, 80%, 90%, 95% or enhanced binding to Rep of the same serotype). In certain embodiments, the RBE DNA template or the transcribed RBE RNA differs from the wild-type sequence by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides. In certain embodiments, the functional RBE comprises up to about 30%, 25%, 20%, 15%, 10%, or 5% sequence variation compared to wild-type RBE, due to, for example, insertions, deletions, substitutions, and / or other mutations of one or more nucleotides of RBE.

[0379] In certain embodiments, the nucleotide sequence differences do not result in the loss of paired base pairs (e.g., a GC pair in a wild-type RBE can be changed to a CG, AT / AU, or TA / UA in a variant RBE without losing the original paired base pairs).

[0380] In certain embodiments, the transcribed modified ITR sequence (RNA) retains a transcribed Rep-binding element (transcribed RBE) or a functional variant thereof to facilitate Rep-mediated packaging. For example, the RBE DNA sequence of the wild-type AAV2 ITR is SEQ ID NO: 5.

[0381] In certain embodiments, the transcribed modified ITR sequence (RNA) further retains the sequence of the transcribed Rep-binding element (of the transcribed RBE). Figure 1A In the example, the CTTTG DNA sequence that forms a hairpin or loop structure in the B:B' segment of the forward ITR is the RBE' sequence.

[0382] In certain embodiments, the transcribed modified ITR sequence lacks a transcribed TRS, and / or a transcribed rcTRS, or both.

[0383] In certain embodiments, the RNAs of the present disclosure lack a transcribed (functional) TRS sequence because their corresponding DNA sequences lack certain sequence elements of a wild-type TRS, such that wild-type TRS function is lost in the DNA (e.g., the sequence or internal strand typically occupied by a wild-type TRS sequence between the A:A' segment and the D region sequence, which is typically recognized and cleaved by nucleases during AAV replication, is not cleaved if present in the ssDNA vector genome of the AAV ITR).

[0384] For example, in some embodiments, the reverse complement of the TRS can be deleted or mutated, such as in the dITR and dITR-D sequences used in the Examples.

[0385] Alternatively or additionally, the TRS generally between the A:A' segment and the D region sequence may lack one or more nucleotides, or have one or more nucleotide substitutions or mutations (such as 4 nucleotides lacking or substituted / mutated in the dITR sequence used in the examples).

[0386] In certain embodiments, all or substantially all of the TRS / rcTRS in the wild-type sequence is deleted such that the resulting RNA transcript lacks a functional TRS sequence.

[0387] In certain embodiments, a portion of a wild-type TRS / rcTRS sequence is altered / mutated, for example, by having insertions, deletions, substitutions, and / or other mutations in the wild-type sequence, such that the mutated TRS / rcTRS produces a corresponding RNA transcript that lacks a transcribed, functional TRS. For example, in certain embodiments, 1, 2, 3, 4, or 5 consecutive or non-consecutive TRS nucleotides and / or rcTRS nucleotides can be deleted or substituted in the mutated sequence.

[0388] In certain embodiments, the transcribed modified ITR sequence is transcribed from a modified ITR that lacks a D region sequence or at least lacks a functional D region sequence (D sequence or D' sequence, depending on the forward or reverse configuration). For example, in some embodiments, the entire D region sequence is deleted, such that the resulting RNA transcript lacks a transcribed functional D region sequence. In other embodiments, at least a portion of the D region sequence is mutated (e.g., having a deletion, insertion, substitution, and / or other mutation) such that the resulting RNA transcript lacks a transcribed functional D region sequence. In certain embodiments, the mutated D region sequence has no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of the wild-type sequence.

[0389] In certain embodiments, the modified ITR sequence (DNA template) lacks 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at the 5' end of the wild-type ITR sequence. For example, both the dITR sequence (SEQ ID NO: 2) and the dITR-D sequence (SEQ ID NO: 3) lack the 5' end 8 nucleotides compared to the wild-type ITR sequence (SEQ ID NO: 1).

[0390] The corresponding DNA sequences encoding any of the above-mentioned transcribed RNA coding sequences (DNA coding sequences of GOI), transcribed modified AAV ITRs (modified AAV ITRs), transcribed functional RBEs (functional RBEs), transcribed functional D region sequences (functional D region sequences), and transcribed functional TRS sequences (functional TRS sequences) are specifically considered to be within the scope of the present disclosure.

[0391] 4. Introns, exons, UTRs, enhancers, and other elements

[0392] The RNA sequence of the present disclosure to be encapsidated in the rRAAV viral particles of the present disclosure may further comprise additional optional sequence elements (eg, expression control elements) that can enhance or regulate the expression of the GOI.

[0393] The expression control elements present in the RNA of the present disclosure facilitate proper transcription and / or translation of the heterologous polynucleotide (e.g., GOI), including, for example, splicing signals of introns, maintenance of the correct reading frame of the gene to allow in-frame translation of the mRNA and stop codons, etc.

[0394] Typically, expression control elements (some in the RNA of the present invention, while others are present on the DNA encoding the RNA of the present invention) are one or more nucleic acid sequences, such as promoters and enhancers, that affect the expression of an operably linked heterologous polynucleotide (e.g., GOI). These elements typically act in cis, but may also act in trans. Expression control can be performed at the levels of transcription, translation, splicing, message stability, etc. Typically, expression control elements that regulate transcription are juxtaposed near the 5' end (i.e., "upstream") of the transcribed polynucleotide. Expression control elements can also be located at the 3' end (i.e., "downstream") of the transcribed sequence or within the transcript (e.g., in an intron). Expression control elements can be located at a distance away from the transcribed gene sequence of interest (e.g., 100 to 500, 500 to 1000, 2,000 to 5,000 or more nucleotides from the gene polynucleotide of interest). However, due to polynucleotide length limitations of viral vectors (eg, AAV vectors), these expression control elements will typically be within 1-1,000, 1-500, 1-250, or 1-100 nucleotides of the transcribed gene sequence of interest.

[0395] Some non-limiting expression control elements that may be present on the RNA of the disclosure or DNA encoding the RNA of the disclosure are described in further detail below.

[0396] introns

[0397] Introns are known to contain post-transcriptional regulatory elements that can effectively induce mRNA transport out of the nucleus and enhance mRNA stability.

[0398] In certain embodiments, rRAAV can include one or more introns or fragments thereof. In some embodiments, the one or more introns are fragments of a gene of interest. In some embodiments, the one or more introns are heterologous to the gene of interest.

[0399] It is reported that introns affect gene expression levels. This effect is called intron-mediated enhancement of gene expression (IME) (Lu et al., Mol Genet Genomics [Molecular Genetics Genomics] 279: 563-572, 2008). In some embodiments, compared with the gene expression of the sequence without the one or more introns, the gene expression level increases by about 1.5 times, about 2 times, about 2.5 times, about 3 times, about 3.5 times, about 4 times, about 4.5 times, about 5 times, about 5.5 times, about 6 times, about 6.5 times, about 7 times, about 7.5 times, about 8 times, about 8.5 times, about 9 times, about 9.5 times or about 10 times.

[0400] Non-limiting introns include the SV40 intron, the beta globin intron, and the short chimeric intron (CIB). Other introns include the ColE2-RNA-OUT, OIPR, and R6K-RNA-OUT introns described in Lu et al., Hum Gene Ther. 2017; 28(1): 125-134 (incorporated by reference); the human hemoglobin subunit beta (HBB2) synthetic intron (Snyder et al., Hum Gene Ther., 8(1997), pp. 1891-1900, incorporated by reference).

[0401] In some embodiments, one or more introns may be less than 25 nucleotides, less than 50 nucleotides, less than 100 nucleotides, less than 150 nucleotides, less than 200 nucleotides, less than 250 nucleotides, less than 300 nucleotides, less than 350 nucleotides, less than 400 nucleotides, less than 450 nucleotides, or less than 500 nucleotides.

[0402] In some embodiments, one or more introns may be greater than 25 nucleotides, greater than 50 nucleotides, greater than 100 nucleotides, greater than 150 nucleotides, greater than 200 nucleotides, greater than 250 nucleotides, greater than 300 nucleotides, greater than 350 nucleotides, greater than 400 nucleotides, greater than 450 nucleotides, or greater than 500 nucleotides.

[0403] In some embodiments, the one or more introns can be about 50 to about 100 nucleotides, about 50 to about 200 nucleotides, about 50 to about 300 nucleotides, about 50 to about 400 nucleotides, about 50 to about 500 nucleotides, about 100 to about 200 nucleotides, about 100 to about 300 nucleotides, about 100 to about 400 nucleotides, about 100 to about 500 nucleotides, about 200 to about 300 nucleotides, about 200 to about 400 nucleotides, about 200 to about 500 nucleotides, about 300 to about 400 nucleotides, about 300 to about 500 nucleotides, or about 400 to about 500 nucleotides.

[0404] enhancer

[0405] As used herein, the term "enhancer" can refer to a sequence located near a gene of interest. An enhancer element is typically located upstream of a promoter element in the DNA encoding the RNA of the present disclosure, but can also be located downstream or within an intron sequence (e.g., a gene of interest) and remain functional. Thus, an enhancer or a portion thereof can be present in a transcribed RNA sequence of the present disclosure.

[0406] Non-limiting examples of suitable enhancers include the CMV enhancer.

[0407] In certain embodiments, enhancer elements can be located 100 base pairs, 200 base pairs, or 300 or more base pairs upstream or downstream of a gene of interest (e.g., in an RNA of the present disclosure or its DNA coding sequence). Enhancer elements typically increase the expression of a gene of interest above that provided by a promoter element.

[0408] Untranslated region (UTR)

[0409] As used herein, "untranslated region" ("UTR") refers to RNA that is not translated after transcription. For example, the 5'UTR is located upstream of the start codon of the gene of interest, and the 3'UTR is located downstream of the stop codon of the gene of interest. In some embodiments, the 5' and / or 3'UTR may have insertions, deletions, or modifications to enhance the stability of the transcribed gene of interest. For example, the 5'UTR may comprise a translation initiation sequence, such as, but not limited to, a Kozak sequence and an internal ribosome entry site (IRES). The Kozak sequence has a consensus CCR(A / G)CCAUG G (SEQ ID NO: 47), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another 'G'.

[0410] The 3′ UTR is known to have a stretch of adenosine and uridine embedded within it. These AU-rich features are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al., 1995): Class I AREs contain several dispersed copies of the AUUUA motif within a U-rich region. c-Myc and MyoD contain class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are less well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. While most proteins that bind to AREs are known to destabilize the messenger, members of the ELAV family, particularly HuR, have been shown to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3′ UTR of a nucleic acid molecule results in HuR binding, thereby stabilizing the messenger in vivo. Any of these 5' and / or 3' UTR sequences may be present in the RNAs of the present disclosure.

[0411] In some embodiments, the 5'UTR and / or 3'UTR may comprise sequences that are heterologous to the gene of interest. In some embodiments, the 5'UTR and / or 3'UTR is native to the gene of interest.

[0412] In certain embodiments, 5'UTRs and / or 3'UTRs from mRNAs that are normally expressed in specific tissues or organs, such as lung, liver, pancreas, endothelial cells, CNS, neurons, astrocytes, skeletal muscle, cardiac muscle, smooth muscle, blood, hematopoietic cells, can be used in the RNAs of the present disclosure comprising a GOI that targets one or more of these tissues.

[0413] polyadenylation sequence

[0414] In certain embodiments, the RNA of the present disclosure comprises a transcribed modified AAV ITR 5' to a poly A sequence, a poly A signal sequence (e.g., AAUAAA), or an RNA transcription termination sequence (e.g., a histone downstream element).

[0415] "Poly A sequence", "poly A tail", "poly A signal sequence" and "sequence for termination of RNA transcription" are defined above.

[0416] In certain embodiments, the RNA of the present disclosure comprises a poly A tail. Such RNA sequences can be packaged into rRAAV viral particles of the present disclosure and delivered directly into target cells, and the GOI encoded by the RNA of the present disclosure can be directly translated.

[0417] In certain embodiments, the RNA of the present disclosure comprises a poly A signal sequence and, optionally, a transcribed GU-rich region downstream of the poly A site. Such RNA sequences can be packaged into rRAAV viral particles of the present disclosure and delivered directly into target cells. Once inside the target cell, the poly A signal sequence can be recognized and further processed by cytoplasmic poly A addition enzymes to produce a poly A tail, and then the GOI encoded by the RNA of the present disclosure is translated.

[0418] Representative poly A signal sequences and surrounding sequences include the human growth hormone (hGH) poly A sequence (see Liu et al., Gene Ther. 20:308–317, 2013, incorporated by reference), the bovine growth hormone polyadenylation signal (bGHpA) (Goodwin and Rottman, J Biol Chem. 1992 Aug 15;267(23):16330-4, incorporated by reference), the SV40 early or late polyadenylation signal, and the synthetic poly A signal used in Choi et al. (Mol Brain. 2014;7:17, incorporated herein by reference).

[0419] transcriptional enhancers

[0420] As used herein, "transcription enhancer" refers to a cis-acting nucleotide sequence that can increase transcription of a gene of interest. In some embodiments, the transcription enhancer can be located in an intron or partially in an exon region of the transcribed RAAV RNA sequence of the present disclosure.

[0421] WPRE

[0422] In certain embodiments, the RNA of the present disclosure comprises a transcribed WPRE sequence encoded by a WPRE sequence on the encoding DNA.

[0423] The woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) is a DNA sequence of approximately 600 bp that generates a tertiary structure that enhances expression during transcription.

[0424] WPRE is commonly used in molecular biology to increase the expression of genes delivered by viral vectors. It is a tripartite regulatory element with γ, α, and β components. The α component is 80 bp long:

[0425] GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT (SEQ ID NO: 39). Used alone, the alpha component is only 9% as active as the complete triplet WPRE sequence, which is 100% identical to base pairs 1093-1684 of the woodchuck hepatitis B virus (WHV8) genome.

[0426] In certain embodiments, the transcribed WPRE sequence or a portion thereof (such as the γ, α, and β elements, preferably in the given order) is present in the 3'UTR region of the GOI on the RNA sequence of the present invention encapsidated in the rRAAV virus particles of the present invention to greatly improve the stability and protein production of the RNA of the present invention.

[0427] In certain embodiments, the WPRE sequence is a short WPRE (WPRE2) containing a minimal gamma element and a partial alpha-beta element (see Kalev-Zylinska, J Neurosci. 2007, 27: 10456-10467, incorporated by reference).

[0428] In certain embodiments, the WPRE sequence is a short WPRE (WPRE3) containing minimal gamma and alpha elements (see Choi et al., Mol Brain 7, 17 (2014), incorporated by reference).

[0429] In certain embodiments, the RNA of the present disclosure comprises a WPRE sequence and a GOI lacking introns.

[0430] promoter

[0431] As used herein, the term "promoter" is defined as a DNA sequence recognized by the cellular synthetic machinery or introduced synthetic machinery required to initiate specific transcription of a polynucleotide sequence.

[0432] Therefore, the RNA of the present disclosure does not comprise a promoter.On the other hand, the DNA encoding the RNA of the present disclosure (such as an expression cassette or expression vector encoding the RNA of the present disclosure) comprises a promoter for transcribing the RNA of the present disclosure.

[0433] As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence required for the expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence. In other cases, this sequence may also include an enhancer sequence and other regulatory elements required for the expression of the gene product. The promoter / regulatory sequence may be, for example, a promoter / regulatory sequence that expresses a gene product (e.g., RNA of the present disclosure) in a tissue or cell type specific manner.

[0434] As used herein, the term "operably linked" or "operably linked" refers to the physical or functional juxtaposition of the components so described to permit them to function in their intended manner. In embodiments of an expression control element operably linked to a heterologous polynucleotide, this relationship allows the control element to regulate the expression of the heterologous polynucleotide. More specifically, for example, two DNA sequences that are operably linked means that the two DNA sequences are arranged in a relationship (cis or trans) such that at least one of the DNA sequences is capable of exerting a physiological effect on the other sequence.

[0435] In certain embodiments, the promoter is a constitutive promoter.

[0436] As used herein, a "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0437] In certain embodiments, promoters that can be used to constitutively drive expression of the RNA of the present invention from DNA encoding the RNA may include: the β-glucuronidase (GUSB) promoter, the cytomegalovirus (CMV) immediate-early (Ie) enhancer and / or promoter, the chicken β-actin (CBA) promoter or derivatives thereof, such as the CAG promoter, the CB promoter, the (human) elongation factor 1α-subunit (EF1α) promoter, and the ubiquitin C (UBC) promoter.

[0438] In certain embodiments, the promoter is an inducible promoter.

[0439] As used herein, an "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell essentially only when an inducer corresponding to the promoter is present in the cell.

[0440] In certain embodiments, the promoter is a tissue-specific promoter, a species-specific promoter, or a cell cycle-specific promoter. See Parr et al., Nat. Med. 3: 1145-9, 1997 (incorporated herein by reference in its entirety).

[0441] As used herein, a "tissue- or cell-type-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, preferentially results in the production of the gene product in a particular cell type or a particular tissue because, for example, the cell / tissue is a cell type or tissue type in which the promoter is normally active.

[0442] Tissue- or cell-type-specific promoters may include neuronal tissue-specific promoters; CNS- or PNS-specific promoters, such as astrocyte, oligodendrocyte, or neuronal promoters; hematopoietic lineage-specific promoters, such as B cell promoters, T cell promoters, NK cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters; endothelial cell promoters; pancreatic promoters; liver / hepatic cell promoters; lung tissue promoters, etc.

[0443] Representative tissue-specific promoters include the prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), synapsin (Syn), synapsin 1 (Syn1), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk), and excitatory amino acid transporter 2 (EAAT2) promoters.

[0444] Astrocyte-specific promoters include the glial fibrillary acidic protein (GFAP) and EAAT2 promoters.

[0445] Oligodendrocyte-specific promoters include the myelin basic protein (MBP) promoter.

[0446] In some embodiments, the promoter is heterologous to the gene of interest. In some embodiments, the promoter is the native promoter of the gene of interest. In some embodiments, the heterologous promoter comprises insertion, deletion, substitution, and / or other mutations. In some embodiments, the native promoter comprises insertion, deletion, substitution, and / or other mutations.

[0447] In certain embodiments, the promoter is a Pol II promoter. In certain embodiments, the promoter is a Pol III promoter, such as a U6 promoter.

[0448] 5. Vector (plasmid or bacmid)

[0449] As used herein, "vector" generally refers to a composition of matter that contains an isolated nucleic acid (DNA or RNA) and can be used to deliver the isolated nucleic acid to the interior of a cell.

[0450] An "expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all expression vectors known in the art, such as cosmids, plasmids, bacmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate a recombinant polynucleotide.

[0451] The rRAAV RNA sequences of the present disclosure comprising a GOI are vectors for delivering the GOI into target / host cells via rRAAV viral particles encapsulating the vector.

[0452] In certain embodiments, the rRAAV RNA sequences disclosed herein are encoded by a DNA expression vector, such as a plasmid or bacmid (e.g., a vector that can be maintained or replicated like a baculovirus in insect cells). Such a DNA expression vector can transcribe the RNA disclosed herein in a suitable host cell, such as a mammalian packaging cell (e.g., HEK293T cell) or an insect packaging cell (e.g., Sf9 cell), thereby producing the rRAAV viral particles of the present invention in the presence of other elements required for rRAAV packaging (e.g., rep and cap coding sequences).

[0453] Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic compounds or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and the like.

[0454] In some embodiments, the RAAV is transcribed from a plasmid or bacmid. The plasmid or bacmid can include a gene sequence of interest. In some embodiments, a promoter is operably linked to the gene of interest and is located upstream of the gene of interest. In some embodiments, the promoter is not present in the transcribed RAAV.

[0455] 6. AAV Particles and AAV Particle Populations

[0456] In certain embodiments, the present invention provides isolated rRAAV viral particles comprising any of the disclosed RNAs encapsidated within any of the AAV capsids or viral particles described herein.

[0457] In some embodiments, the AAV capsid or viral particle is of a serotype or a combination of one or more serotypes described herein.

[0458] In the rRAAV vectors or RNAs of the present disclosure, the rRAAV genome (RNA) can be a single-stranded (ss) nucleic acid or a double-stranded (ds), self-complementary (sc) nucleic acid.

[0459] A related aspect of the present disclosure provides a population of recombinant viral particles (e.g., rRAAV particles) comprising a plurality of recombinant viral particles (e.g., rRAAV particles) of the present disclosure, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant viral particles (e.g., rRAAV particles) in the population have an encapsidation RNA sequence of the present disclosure.

[0460] In some embodiments, a population of rRAAV particles contains a plurality of rRAAV viral particles of the disclosure, wherein about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the rRAAV particles in the population have an encapsidation RNA sequence of the disclosure.

[0461] In certain embodiments, the population of recombinant viral particles (e.g., rRAAV particles) comprises at least 1×10 4Virus particles, at least 2×10 4 Virus particles, at least 5×10 4 Virus particles, at least 1×10 5 Virus particles, at least 2×10 5 Virus particles, at least 5×10 5 Virus particles, at least 1×10 6 Virus particles, at least 2×10 6 Virus particles, at least 5×10 6 Virus particles, at least 1×10 7 Virus particles, at least 2×10 7 Virus particles, at least 5×10 7 Virus particles, at least 1×10 8 Virus particles, at least 2×10 8 Virus particles, at least 5×10 8 Virus particles, at least 1×10 9 Virus particles, at least 2×10 9 Virus particles, at least 5×10 9 Virus particles, at least 1×10 10 Virus particles, at least 2×10 10 Virus particles, at least 5×10 10 Virus particles, at least 1×10 11 Virus particles, at least 2×10 11 Virus particles, at least 5×10 11 Virus particles, at least 1×10 12 Virus particles, at least 2×10 12 Virus particles, at least 5×10 12 Virus particles, at least 1×10 13 Virus particles, at least 2×10 13 Virus particles, at least 5×10 13 Virus particles, at least 1×10 14 Virus particles, at least 2×10 14 Virus particles, at least 5×10 14 Virus particles, at least 1×10 15 Virus particles, at least 2×10 15 Virus particles, at least 5×10 15 Virus particles, at least 1×10 16 Virus particles, at least 2×10 16 Virus particles, or at least 5×10 16 Virus particles.

[0462] In certain embodiments, at most 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, 1%, 0.1%, 0.01% or less of a population of recombinant viral particles have non-RNA (e.g., DNA) encapsidated within the viral particles.

[0463] 7. Host Cells and AAV Production

[0464] The general principles of rAAV production are known in the art. See, for example, Carter (Current Opinions in Biotechnology, 1533-539, 1992); and Muzyczka, Curr. Topics in Microbial, and Immunol. 158:97-129, 1992, both of which are incorporated herein by reference for review). Various methods are described in the following literature: Ratschin et al. (Mol. Cell. Biol. 4:2072, 1984; Hermonat et al. (Proc. Natl. Acad. Sci. USA 81:6466, 1984); Tratschin et al. (Mol. Cell. Biol. 5:3251, 1985); McLaughlin et al. (J. Virol. 62:1963, 1988); and Lebkowski et al. (Mol. Cell. Biol. 7:349, 1988), Samulski et al. (J. Virol. 63:3822-3828, 1989); U.S. Pat. No. 5,173,414; WO 95 / 13365 and U.S. Pat. No. 5,658,776; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441; WO 97 / 08298; WO 97 / 21825; WO 97 / 06243; WO 99 / 11764; Perrin et al. (Vaccine 13:1244-1250, 1995; Paul et al. (Human Gene Therapy 4:609-615, 1993); Clark et al. (Gene Therapy 3:1124-1132, 1996; U.S. Pat. No. 5,786,211; U.S. Pat. No. 5,871,982; and U.S. Pat. No. 6,258,595.

[0465] The AAV vector serotype can be matched to the target cell type. For example, Table 2 of WO 2018002719A1 lists exemplary cell types that can be transduced by the indicated AAV serotypes (incorporated herein by reference).

[0466] Packaging cells are used to form viral particles that can infect host cells. Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus.

[0467] Viral vectors used in gene therapy are usually generated by a production cell line that packages nucleic acid vectors into viral particles. The vector typically contains the minimum viral sequences required for packaging and subsequent integration into the host (if appropriate), with other viral sequences replaced by expression cassettes encoding proteins to be expressed. The missing viral functions can be provided by the packaging cell line in trans, usually as a result of the expression of these viral functions / proteins (such as the rep and cap genes of AAV) as a transgene integrated into the packaging cell or as a transgene on a second viral vector or expression vector introduced into the packaging cell.

[0468] For example, the AAV vector used in gene therapy typically has only an inverted terminal repeat (ITR) sequence from the AAV genome, which is required for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid encoding other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in large quantities due to the lack of ITR sequences. Adenovirus contamination can be reduced by, for example, performing a heat treatment to which adenovirus is more sensitive than AAV.

[0469] In some embodiments, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. Patent No. 6,001,650). Typically, recombinant AAV is produced by transfecting host cells with a recombinant AAV vector (comprising a gene of interest), an AAV auxiliary function vector, and an auxiliary function vector to be packaged into AAV particles. The AAV auxiliary function vector encodes "AAV auxiliary function" sequences (e.g., rep and cap), which act in trans for productive AAV replication and encapsidation. Preferably, the AAV auxiliary function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The auxiliary function vector encodes a nucleotide sequence for the non-AAV-derived viral and / or cellular functions (e.g., "auxiliary functions") that AAV relies on for replication. Auxiliary functions include those functions required for AAV replication, including but not limited to those parts involved in activating AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, cap expression product synthesis, and AAV capsid assembly. Viral-based helper functions can be derived from any of the known helper viruses, such as adenovirus, herpes virus (except herpes simplex virus-1), and vaccinia virus.

[0470] In some embodiments, the rRAAV of the present invention is produced using a baculovirus expression system packaged in insect cells (e.g., Sf9 cells). See, for example, WO 2007046703, WO 2007148971, WO 2009014445, WO2009104964, WO 2013036118, WO 2011112089, WO 2016083560, WO 2015137802, and WO2019016349, all of which are incorporated herein by reference.

[0471] Vector titers are typically expressed as viral genomes / ml (vg / ml). In certain embodiments, the viral titer is greater than 1×10 9 , higher than 5×10 10 , higher than 1×10 11 , higher than 5×10 11 , higher than 1×10 12 , higher than 5×10 12 , or higher than 1×10 13 vg / ml.

[0472] 8. Gene of Interest (GOI) or RNA Sequence of Interest (RSI)

[0473] The rRAAV particles of the present disclosure can be used to deliver any gene of interest (GOI) or RNA sequence of interest (RSI) to a host cell for any purpose, so long as the GOI is an RNA that fits within the packaging limits of the selected AAV viral capsid or AAV viral particle shell, such as a total length of about 4,700 nucleotides for most AAV viral particles and up to about 8,900 nucleotides for certain large-capacity AAV viral particles (e.g., AAV5).

[0474] In certain embodiments, representative (non-limiting) RNA sequences of interest (RSIs) include, for example, protein-coding RNA, mRNA, non-coding RNA (ncRNA), tRNA, ribosomal RNA (rRNA), transfer-messenger RNA (tmRNA), antisense oligonucleotides (ASOs), RNA aptamers, RNA components of a CRISPR-Cas system such as a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), CRISPR RNA (crRNA), tracr RNA, or RNA components of a RISC complex or RNAi pathway (such as shRNA, miRNA, or siRNA), regulatory RNA, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA) (including intergenic lincRNA, intronic ncRNA, and sense / antisense lncRNA), long intergenic / intergenic non-coding RNA (lincRNA), enhancer RNA, bacterial small RNA (sRNA), snRNA, exRNA, scaRNA, Xist, and HOTAIR and their precursors.

[0475] In certain embodiments, the RNA of the present disclosure comprises a coding sequence for a protein or polypeptide.

[0476] In certain embodiments, the protein or polypeptide is a wild-type protein or a functional equivalent or variant thereof (eg, an enzyme or structural protein) that can be used to replace a defective protein in a target cell, tissue, or organism.

[0477] In certain embodiments, the protein or polypeptide is a wild-type protein or a functional equivalent or variant thereof (such as an enzyme or structural protein) that can be used to antagonize the adverse effects of a compound (a small molecule compound or a macromolecule, such as a lipid, fatty acid, protein, nucleic acid, etc.) in a target cell, tissue, or organism.

[0478] For example, in certain embodiments, the RNA of the present disclosure comprises a coding sequence for an effector enzyme of the IscB system (IscB polypeptide). In certain embodiments, IscB polypeptides are disclosed in PCT / CN2023 / 129167 and PCT / CN2023 / 125069 (each of which is incorporated herein by reference in its entirety).

[0479] For example, in certain embodiments, the RNA of the present disclosure comprises a coding sequence for an effector enzyme of a CRISPR / Cas system.

[0480] In certain embodiments, the CRISPR-Cas system is a class 1 system and the effector enzyme is a type I, III, or IV effector enzyme.

[0481] In certain embodiments, the CRISPR-Cas system is a class 2 system and the effector enzyme is a type II, V, or VI effector enzyme.

[0482] For example, in some embodiments, the effector enzyme is a Class 2 type II enzyme, such as Cas9, including Streptococcus pyogenes (SpCas9) or SaCas9 (see WO 2014 / 093622

[0483] (PCT / US2013 / 074667), incorporated by reference).

[0484] In certain embodiments, the Cas effector enzyme is a Class 2, type V Cas protein (Cas12 protein), including Cas12a (formerly known as Cpf1, e.g., Francisella novicida Cas12a), C2c1 and C2c3, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas12l, Cas12m, Cas12n. Exemplary Cas12 proteins are disclosed in PCT / CN2023 / 090695 and PCT / CN2023 / 090685 (each of which is incorporated herein by reference in its entirety).

[0485] In certain embodiments, the Cas effector enzyme is a 2-type VI Cas protein (Cas13 protein), including Cas13a (also known as C2c2), Cas13b, Cas13c, Cas13d, Cas13e, and Cas13f. These Cas proteins use their crRNA to recognize target RNA sequences, rather than the target DNA sequences in Cas9 and Cas12a. Exemplary Cas13 proteins are disclosed in PCT / CN2020 / 077211, PCT / CN2021 / 121926, PCT / CN2023 / 084489, and PCT / CN2022 / 101884 (each of which is incorporated herein by reference in its entirety).

[0486] In certain embodiments, the Cas effector enzyme is any one of the Cas effector enzymes described in WO 2020 / 028555 (incorporated herein by reference in its entirety), including any one of Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12c, Cas12d, etc.), Cas13 (e.g., Cas13a, Cas13b (e.g., Cas13b-t1, Cas13b-t2, Cas13b-t3), Cas13c, Cas13d, etc.), Cas14, CasX, and CasY.

[0487] In certain embodiments, the Cas effector enzyme is fused to a DNA and / or RNA base editor, such as a cytosine or adenine base editor (CBE or ABE). In certain embodiments, the base editor preferably edits a DNA base and optionally has reduced or substantially no off-target RNA base editing ability. In certain embodiments, the base editor preferably edits an RNA base and optionally has reduced or substantially no off-target DNA base editing ability. In certain embodiments, the base editor edits both DNA and RNA bases.

[0488] In certain embodiments, the base editor is a first, second (BE2), third (BE3), or fourth generation (BE4) base editor. In certain embodiments, the base editor is a dual base editor.

[0489] In certain embodiments, the base editor is an RNA adenosine deaminase (ADAR), such as ADAR1, ADAR2, or ADARDD including ADAR2DD(E488Q).

[0490] In any of the above embodiments, the RNA of the present disclosure may further comprise a guide RNA sequence designed to be loaded into an encoded CRISPR / Cas effector enzyme for binding to a target polynucleotide sequence complementary to the guide RNA. After the rRAAV viral particles of the present disclosure deliver the RNA of the present disclosure to the target host cell, such a gRNA sequence can be processed by cellular nucleases and released / separated from the RNA of the present disclosure. For example, the gRNA can be present in an unpaired 5' or 3' flanking region sequence of a primary miRNA hairpin structure that is part of the RNA of the present disclosure, and after the primary miRNA is processed by a cellular enzyme such as Drosha, it is released / separated from the initial primary miRNA transcript.

[0491] In certain embodiments, the RNA of the present disclosure comprises a coding sequence for an effector enzyme of the CRISPR / Cas system and further comprises a coding sequence for a DNA or RNA base editing enzyme or domain, such that a fusion of the Cas effector enzyme and the DNA / RNA base editing enzyme / domain is encoded by the RNA sequence. In certain embodiments, the Cas effector enzyme is defective in nuclease activity, such that it can bind to a target polynucleotide sequence through its bound guide RNA, but cannot cleave the DNA / RNA target polynucleotide.

[0492] In certain embodiments, the RNA of the present disclosure comprises a coding sequence of a variant or derivative of a CRISPR / Cas system effector enzyme, wherein the variant comprises a deletion (such as an N and / or C-terminal deletion, for example, a deletion of no more than 210 residues at the N-terminus of Cas13e or Cas13f, and / or a deletion of no more than 180 residues at the C-terminus), an insertion or a substitution of a wild-type CRISPR / Cas system effector enzyme, but substantially retains the ability of the wild-type effector enzyme to bind to the gRNA and / or cut the target polynucleotide. In certain embodiments, the variant lacks the activity of cutting the target polynucleotide.

[0493] In certain embodiments, the RNA base editing domain encoded by the disclosed RNA is an adenosine deaminase, such as a double-stranded RNA-specific adenosine deaminase (e.g., ADAR1 or ADAR2); a catalytic polypeptide-like apolipoprotein B mRNA editing enzyme (APOBEC); or an activation-induced cytidine deaminase (AID).

[0494] In certain embodiments, the RNA base editing domain encoded by the RNA of the present disclosure comprises an adenosine deaminase and / or a cytidine deaminase, such as a cytidine deaminase acting on RNA (CDAR), such as a double-stranded RNA-specific adenosine deaminase (ADAR) (e.g., ADAR1 or ADAR2), an apolipoprotein B mRNA editing enzyme, a catalytic polypeptide-like (APOBEC, such as APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4), activation-induced cytidine deaminase (AID), cytidine deaminase 1 (CDA1), or a mutant thereof.

[0495] In certain embodiments, the ADAR has an E488Q / T375G double mutation or is ADAR2DD.

[0496] In certain embodiments, the base editing domain is further fused to an RNA binding domain, such as MS2.

[0497] In certain embodiments, the encoded variant or derivative of the CRISPR / Cas effector enzyme further comprises an RNA methyltransferase, an RNA demethylase, an RNA splicing modifier, a localization factor, or a translation modifier.

[0498] In certain embodiments, the Cas effector enzyme, variant / derivative or functional fragment thereof comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES).

[0499] In certain embodiments, the Cas effector enzyme, its variant / derivative, or its functional fragment is fused to a heterologous functional domain. In certain embodiments, the heterologous functional domain comprises: a nuclear localization signal (NLS), a reporter protein or detection tag (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), a localization signal, a protein targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD), an epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc.), a transcriptional activation domain (e.g., VP64 or VPR), a transcriptional repression domain (e.g., a KRAB portion or a SID portion), a nuclease (e.g., FokI), a deamination domain (e.g., ADAR1, ADAR2, APOBEC, AID or TAD), a methylase, a demethylase, a transcription release factor, an HDAC, a polypeptide having ssRNA cleavage activity, a polypeptide having dsRNA cleavage activity, a polypeptide having ssDNA cleavage activity, a polypeptide having dsDNA cleavage activity, a DNA or RNA ligase, or any combination thereof. In certain embodiments, the heterologous functional domain is fused at the N-terminus, C-terminus, or internally of the fusion protein.

[0500] In certain embodiments, the heterologous functional domain is fused at the N-terminus, C-terminus, or internally of the fusion protein.

[0501] In certain embodiments, the RNA of the present disclosure encodes a codon-optimized polynucleotide encoding a wild-type CasPR (e.g., Cas5d, Cas6, or Csf5), a homolog thereof, a direct homolog thereof, a paralog thereof, a variant or derivative thereof, or a functional fragment thereof, wherein the polynucleotide is codon-optimized for mammalian (e.g., human) expression, and optionally, the wild-type CasPR has an amino acid sequence of any one of sequence 1-11. In certain embodiments, the codon-optimized polynucleotide has an amino acid sequence of any one of sequence 34-44. In certain embodiments, the codon-optimized polynucleotide further comprises a sequence encoding a heterologous functional domain. In certain embodiments, the heterologous functional domain comprises an RNA base editor.

[0502] In certain embodiments, the RNA of the present disclosure encodes a non-naturally occurring polynucleotide comprising a derivative of any one of sequences 12-33, wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, substitutions, and / or other mutations compared to any one of sequences 12-33; (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the sequence identity to any one of sequences 12-33. %, 80%, 90%, 95% or 97% sequence identity; (iii) hybridizes under stringent conditions with any one of sequences 12-33 or any one of (i) and (ii); or (iv) is a complementary sequence to any one of (i)-(iii), provided that the derivative is not any one of sequences 12-33, and the derivative encodes an RNA (or is an RNA) that retains substantially the same secondary structure (e.g., stem, loop, bulge, single-stranded region) as any RNA encoded by sequences 12-33. In certain embodiments, the derivative is used as the DR sequence of any one of the CasPRs disclosed herein, its orthologs, its paralogs, its variants, its derivatives, or its functional fragments.

[0503] In certain embodiments, the RNA of the present disclosure comprises a coding sequence for an engineered clustered regularly interspaced short palindromic repeats (CRISPR)-Cas13 effector enzyme, wherein the engineered Cas13: (1) comprises a mutation in a region that is spatially proximal to the endonuclease catalytic domain of the corresponding wild-type Cas13 effector enzyme; (2) substantially retains the guide sequence-specific endonuclease cleavage activity of wild-type Cas13 against a target RNA complementary to the guide sequence; and (3) substantially lacks the guide sequence-independent side-cutting endonuclease cleavage activity of wild-type Cas13 against a non-target RNA that does not bind to the guide sequence.

[0504] In certain embodiments, the Cas13 is Cas13a, Cas13b, Cas13c, Cas13d (including CasRx), Cas13e, or Cas13f.

[0505] In certain embodiments, the Cas13e has the amino acid sequence of SEQ ID NO: 4 in PCT / CN2020 / 119559 (incorporated herein by reference).

[0506] In certain embodiments, the engineered Cas13 of the present disclosure has an amino acid sequence of any one of SEQ ID NOs: 6-10 in PCT / CN2020 / 119559 (incorporated by reference). In certain embodiments, the engineered Cas13 of the present disclosure has an amino acid sequence of SEQ ID NOs: 9 or 10 in PCT / CN2020 / 119559 (incorporated by reference).

[0507] In certain embodiments, the engineered Cas13 of the present disclosure further comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES). In certain embodiments, the engineered Cas13 comprises an N-terminal and / or C-terminal NLS.

[0508] In certain embodiments, the RNAs of the present disclosure encoding the engineered CRISPR / Cas13 effector enzymes of the present disclosure are codon-optimized for expression in eukaryotes, mammals (e.g., humans or non-human mammals), plants, insects, birds, reptiles, rodents (e.g., mice, rats), fish, worms / nematodes, or yeast.

[0509] In certain embodiments, the RNA of the present disclosure comprises a coding sequence for an engineered clustered regularly interspaced short palindromic repeats (CRISPR)-Cas13 effector enzyme that (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, substitutions, and / or other mutations compared to the wild-type sequence; (ii) has at least 50%, 60%, 70%, 80%, 90%, 95%, or 97% sequence identity to the wild-type sequence; (iii) hybridizes under stringent conditions to the wild-type sequence or any one of (i) and (ii); or (iv) is the complement of any one of (i)-(iii).

[0510] In certain embodiments, the RNA of the present disclosure comprises the following coding sequences: non-coding RNA (ncRNA), such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or its precursors, including pre-miRNA and primary miRNA, antisense sequences or oligonucleotides (ASO), guide RNA or gRNA of CRISPR / Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.

[0511] 9. How to use

[0512] The rRAAV viral particles and RNA sequences disclosed herein can be used to deliver any GOI / RSI to any suitable target cell, tissue, or organism for any gene therapy.

[0513] In certain embodiments, the rRAAV viral particles and RNA sequences disclosed herein can be used in therapeutic methods, wherein a functional version of a gene can replace a functionally deficient or lost disease gene to restore the lost function. For example, in certain embodiments, a wild-type coding sequence or a variant coding sequence encoding a wild-type protein that retains at least one desired function of the wild-type protein can be delivered to a target cell / tissue / organ, and the encoded wild-type variant is expressed to compensate for the lost function of the disease gene.

[0514] In certain other embodiments, the rRAAV viral particles and RNA sequences disclosed herein can be used in therapeutic methods, wherein functional defects or functional gain-of-function disease genes can be knocked out, knocked down or otherwise down-regulated by gene targeting agents to alleviate the adverse effects of the disease gene. The gene targeting agent can be a CRISPR / Cas effector enzyme (engineered Cas9 or Cas13 effector enzyme as described herein), which optionally has a guide RNA provided simultaneously (or separately), and the guide RNA targets the disease gene together. In certain embodiments, the gene targeting agent can be a Cas effector enzyme connected to a DNA or RNA base editor for DNA-RNA base editing. In certain embodiments, the gene targeting agent is siRNA, shRNA, microRNA, or antisense RNA.

[0515] In certain embodiments, the present invention provides a method for modifying a target RNA in a target cell, the method comprising contacting the target cell with an rRAAV viral particle or RNA sequence of the present disclosure encoding a CasPR or an engineered CRISPR / Cas effector enzyme described herein (or an ortholog, paralog, variant, derivative, or functional fragment thereof), wherein the guide sequence of the CasPR / Cas effector enzyme is complementary to at least 15 nucleotides of the target RNA, and wherein the CasPR / engineered Cas effector enzyme associates with the guide sequence to form a complex that binds and modifies the target RNA.

[0516] In certain embodiments, the present invention provides a method of treating a condition or disease in a subject in need thereof, the method comprising administering to the subject a composition comprising an rRAAV viral particle or RNA sequence of the present disclosure encoding a CasPR or an engineered CRISPR / Cas effector enzyme described herein (or an ortholog, paralog, variant, derivative, or functional fragment thereof), wherein the guide sequence of the CasPR / Cas effector enzyme is complementary to at least 15 nucleotides of the target RNA, and wherein the CasPR / engineered Cas effector enzyme associates with the guide sequence to form a complex that binds and modifies the target RNA, thereby treating the condition or disease in the subject.

[0517] In certain embodiments, the target RNA is modified by cutting by a CasPR or engineered Cas effector enzyme complex. In certain embodiments, the target RNA is modified by deamination by a derivative comprising a double-stranded RNA-specific adenosine and / or cytidine deaminase. In certain embodiments, the target RNA is mRNA, tRNA, rRNA, non-coding RNA, lncRNA or nuclear RNA. In certain embodiments, the target RNA is intracellular. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is infected by an infectious agent. In certain embodiments, the infectious agent is a virus, a prion, a protozoan, a fungus or a parasite. In certain embodiments, the cell is a neuronal cell (e.g., an astrocyte, a glial cell (e.g., Muller glia cell, oligodendrocyte, ependymal cell, Schwann cell, NG2 cell or satellite cell)).

[0518] In certain embodiments, the disease or disease are cancer or infectious diseases. In certain embodiments, the cancer is Wilms tumor, Ewing's sarcoma, neuroendocrine tumor, glioblastoma, neuroblastoma, melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, kidney cancer, pancreatic cancer, lung cancer, bile duct cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid cancer, ovarian cancer, glioma, lymphoma, leukemia, myeloma, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma or bladder cancer. In certain embodiments, the method is in vitro method, in vivo method or ex vivo method. In certain embodiments, after the complex is combined with the target RNA, the engineered Cas13 will not show substantial (or detectable) side-cutting RNA enzyme activity.

[0519] In certain embodiments, the disorder or disease is a neurological disorder, such as glaucoma, age-related RGC loss, optic nerve damage, retinal ischemia, Leber's hereditary optic neuropathy, a neurological disorder associated with degeneration of RGC neurons, a neurological disorder associated with degeneration of functional neurons in the striatum of a subject in need thereof, Parkinson's disease, Alzheimer's disease, Huntington's disease, schizophrenia, depression, drug addiction, movement disorders, such as chorea, choreoathetosis and movement disorders, bipolar disorder, autism spectrum disorder (ASD), or a functional disorder.

[0520] In certain embodiments, the methods of the present disclosure result in one or more of the following: (i) induction of cellular senescence in vitro or in vivo; (ii) cell cycle arrest in vitro or in vivo; (iii) cell growth inhibition and / or cell growth suppression in vitro or in vivo; (iv) induction of anergy in vitro or in vivo; (v) induction of apoptosis in vitro or in vivo; and (vi) induction of necrosis in vitro or in vivo.

[0521] Example

[0522] The following examples are provided to further illustrate some embodiments of the present disclosure but are not intended to limit the scope of the present disclosure; by their exemplary nature it will be understood that other procedures, methods or techniques known to those skilled in the art may alternatively be used.

[0523] Materials and methods

[0524] Cell culture

[0525] Human embryonic kidney cells (HEK-293T), mouse embryonic fibroblasts (MEFs), and HeLa cells were maintained at 37°C, 5% CO2 in DMEM (Hyclone, H30243.01) supplemented with 10% fetal bovine serum (Gibco, 10099-141C), 1% MEM non-essential amino acids solution (Gibco, 11140050), and 1% penicillin-streptomycin-glutamine (Gibco, 10378016).

[0526] plasmids

[0527] A list of relevant plasmids can be found in Table S5. Plasmids were cloned using PCR amplification with Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505-d1) and assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L).

[0528] mice

[0529] Homozygous Ai9 mice were obtained from the Jackson Laboratory. Heterozygous Ai9 mice were obtained by crossing wild-type C57BL / 6J female mice with homozygous Ai9 male mice. All feeding and procedures were carried out according to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) of Huida Gene Therapeutics Co., Ltd. All mice were housed in a room maintained at a 12-hour light and dark cycle and were free to eat standard rodent diet and water. Animals were randomly assigned to each experimental group. AAV and RAAV were injected into the hippocampus by stereotactic injection and injected into mice by intravenous injection.

[0530] Generation of AAV and RAAV

[0531] Both AAV and RAAV were produced and purified in the same manner. HEK293T cells were maintained in DMEM with 10% fetal bovine serum in 150-mm culture dishes and passaged every 2-3 days. The day before polyethylenimine (Polysciences 24765-1) transfection, cells were seeded at 1.5E7 cells / 15 cm culture dish. Then, 15 μg AAV / RAAV transgenic plasmid, 15 μg AAV / RAAV packaging plasmid, and 30 μg pAd-Helper auxiliary plasmid were transfected per plate. The day after transfection, the culture medium was replaced with fresh DMEM with 2% fetal bovine serum. The supernatant of the transfected cells was collected on the 2nd and 5th day after transfection. On day 5, cells were scraped off with a rubber cell scraper, pelleted by centrifugation at 3000 g for 10 min, resuspended in 500 μL of hypertonic lysis buffer (10 mM Tris base, 150 mM NaCl, and 10 mM MgCl2) per plate, and lysed through three repeated freeze / thaw cycles. 125 U mL -1 Benzonase nuclease (Sigma, E1014-25KU) was added and incubated at 37°C for 1 h to remove cellular nucleic acids and residual plasmids. The collected supernatant was mixed with a 5× solution of 40% poly(ethylene glycol) (PEG) dissolved in 2.5 M NaCl (final concentration: 8% PEG / 500 mM NaCl), incubated on ice overnight to promote PEG precipitation, and spun at 3000 g for 15 min. The pellet was resuspended in 500 μL lysis buffer per plate and spun at 37°C with 100 U mL -1Benzonase nuclease (Sigma, E1014-25KU) treatment for 1 h. The resuspended virus from the concentrated supernatant was combined with the cell lysate and the crude virus obtained was clarified by centrifugation at 3000 g for 10 min and added to a Beckman Quick-Seal tube (Beckman, 342414) via a sterile Pasteur pipette (Kimble, 63B95P) plugged with cotton. A discontinuous iodixanol gradient was formed by sequentially floating each layer: 15% iodixanol in 9 mL of lysis buffer with 1 M NaCl, 7 mL each of 25% iodixanol and 40% iodixanol in lysis buffer, and 58% iodixanol in 5 mL of lysis buffer. The final concentration was 1 μg mL -1 Phenol red was added to the 25% and 58% layers to facilitate identification. Ultracentrifugation was performed at 68,000 rpm for 1 h 30 min at 18 ° C in an OPTIMA XE-90 ultracentrifuge (Beckman Coulter) using a 70-type Ti rotor. After ultracentrifugation, 5 mL of the solution was taken out from the 40%-58% iodixanol interface via a 14-gauge needle and dialyzed using PBS containing 0.001% F-68 using a 100-kD MWCO column (EMD Millipore). The concentrated viral solution was sterile filtered using a 0.22-μm filter. The final AAV / RAAV preparation was aliquoted and stored at -80 ° C until use.

[0532] Extraction and quantification of viral genomes

[0533] Purified AAV and RAAV were first subjected to nuclease treatment (including DNase I and RNase I) at 37°C for 3 hours to remove unencapsidated DNA and RNA. Following nuclease digestion, AAV and RAAV were treated with proteinase K (0.5 mg / mL) at 65°C in a buffer containing 25 mM Tris-HCl (pH 7.4), 10 mM EDTA, 100 mM NaCl, and 0.5% SDS for approximately 3 hours to disrupt viral particles and release packaged genomes. The nuclease-resistant viral genomes were then purified by phenol / chloroform extraction, recovered by isopropanol precipitation (1 μg of vector DNA was added to each sample), and dissolved in nuclease-free water.

[0534] The extracted viral genome was directly subjected to qPCR to quantify viral DNA titers. To quantify viral RNA titers, the extracted genome was first digested with gDNA wiper mix (Novozyme, R223-01) to remove viral DNA. The undigested viral RNA was then reverse transcribed into cDNA and quantified via qPCR. Primer pairs targeting the AAV / RAAV genome were designed (Table S6).

[0535] Transmission electron microscopy analysis

[0536] In sample preparation for negative stain electron microscopy, 10 μL of purified AAV and RAAV were dropped onto a 300 mesh copper grid coated with a continuous carbon film. The sample was allowed to adsorb for 2 minutes, after which the excess solution was removed with a kimwipe. Subsequently, 10 μL of a negative stain solution containing 3% aqueous phosphotungstic acid was dropped onto the TEM grid and incubated for 2 minutes, and the excess solution was removed by touching the edge with a kimwipe. The sample was allowed to dry and then observed under a Talos L120C transmission electron microscope at a magnification of 73,000. The microscope was used to analyze the negative staining results of the TEM grid. TM )Image captured by a CETA 16 4Kx4K CMOS camera.

[0537] Silver staining

[0538] Samples from purified AAV / RAAV vectors were loaded onto 4%-20% Bis-Tris gradient precast gels (Tanon, 180-9115H) and run using 1xMOPS running buffer (Tanon, BT8100-2002). The gels were stained with a fast silver staining kit (Beyotime, P0017S).

[0539] Sedimentation velocity AUC

[0540] Sedimentation velocity analytical ultracentrifugation (SV-AUC) analysis was performed using Proteome Lab XL-I (Beckman Coulter, Indianapolis, Indiana). 400 μL of sample was loaded into the sample sector of a dual sector velocity pool, and 400 μL of PBS (containing 0.001% F-68) was loaded into the corresponding reference sector. The sample was placed in a four-hole rotor and allowed to balance in the instrument for one hour with a temperature and complete vacuum maintained at 20°C. Sedimentation velocity was centrifuged at 20,000 rpm and 20°C. Absorbance (260 nm) optics was used to record radial concentration changes over time until the lightest sedimentation component passed through the optical window completely (1.2 hours).

[0541] The percentage of viral particles containing complete genomes was determined by analyzing approximately 200 scans using an absorbance detection method and the SEDFIT (NIH / www.analyticalultracentrifugation.com) continuous size C(S) distribution model. Second-order (2nd) derivative regularization was applied to the fit, with a confidence level of the F statistic of 0.68. The following C(S) parameters were kept constant: resolution = 200S, S min = 1, S max = 200, and friction ratio = 1.0. RI and TI noise subtraction were applied, and the meniscus position was allowed to float, allowing the software to select the optimal position. This model fits the data to the Lamm equation, and the resulting size distribution is a "distribution of sedimentation coefficients," which is similar to a chromatogram, with the area under each peak proportional to the concentration, which is measured in interference fringes or OD260 units. The sedimentation coefficient (in Svedberg units) and relative concentration (in OD) of each component in the distribution were determined. The results of the AUC analysis were plotted as a graph of the normalized differential coefficient distribution value C(S) versus the sedimentation coefficient (S).

[0542] Analysis of viral genomes on denaturing agarose gels

[0543] 10 ng of viral genome was mixed with 0.5 volume of glyoxal loading dye (Invitrogen, AM8551) and the sample was incubated at 50°C for 1 h. The samples were then run on a 1% glyoxal denaturing agarose gel (with 1 / 5000 SYBR TM Denatured viral genomes were separated on 4% 4% 4% 5% 5% 1% 1% 2% 1 ...

[0544] Mouse embryonic fibroblast (MEF) isolation

[0545] Embryos from homozygous Ai9 mice were isolated between E12.5 and E18.5. After removing the head, tail, limbs, and most internal organs, the embryos were minced and trypsinized for 20 minutes and then seeded into 10 cm cell culture dishes containing 10 mL of complete DMEM medium. When freshly confluent, cells were split at a ratio of 1:2–1:3, passaged two or three times to obtain morphologically homogeneous cultures, and then frozen or expanded for further study.

[0546] HEK293T Cre reporter cell line generation

[0547] HEK293T Cre reporter cell line was generated with the PiggyBac transposon system. The PB-T-loxP-tdTomato box was subcloned from Ai9 (Addgene #22799) into the PB-T plasmid to generate the PB-T-loxP-tdTomato box. HEK293T reporter cell line was generated by seeding cells at 50% confluence in 6-well plates. The next day, the PB-T-loxP-tdTomato construct was co-transfected with the helper plasmid pCAG-PB transposase (PBase) using polyethyleneimine. Transfected cells were selected in puromycin (Thermo Fisher, A1113803) for 2 weeks and then cultured on a BD FACSAria TM Sorting was performed based on GFP on a Sigma-Aldrich III cell sorter. Single sorted cells were deposited into 96-well plates to obtain monoclonal cell lines.

[0548] mRNA sequencing of whole-cell RNA and viral vector genomes

[0549] RAAV and its MCP-free control (ten 15 cm culture dishes per group) were generated, and VLP RNA was extracted according to the above-mentioned viral vector genome extraction method. Whole-cell RNA was extracted with TRIzol reagent (Invitrogen, 15596018) and purified using phenol-chloroform extraction method. Subsequently, 1 μg RNA was used for the following library preparation. To alleviate the potential bias caused by the small amount of VLP RNA used during library preparation, the inventors supplemented the viral vector genome with 1 μg carrier RNA. Poly (A) mRNA was isolated using Oligo (dT) magnetic beads, and the DNA was isolated using a DNA sequencing platform for Illumina. Universal V8RNA-seq Library Prep Kit (Novozyme, NR605) was used to prepare multiple RNA sequencing libraries. According to the manufacturer's instructions, the library was sequenced on an Illumina novaseq 6000 using a 2x150 double-end sequencing (PE) configuration. Quality control was performed using Cutadapt (V1.9.1, phred cutoff value: 20, error rate: 0.1, linker overlap: 1 bp, minimum length: 75, N ratio: 0.1). Clean data were aligned to the reference genome (GRCh38.p13+optCre) using the software Hisat2 (v2.2.1). Differential gene expression analysis was performed using the DESeq2 Bioconductor software package (based on a model of negative binomial distribution). The estimation of discreteness and logarithmic fold change was combined with a data-driven prior distribution, where the Padj of the gene was set to <= 0.05 to detect differentially expressed genes. Geneious prime was used to generate complete read alignments.

[0550] AAV and RAAV infections

[0551] For all Ai9-MEF infection experiments, cells were seeded on 48-well plates at a density of 5E4 cells / well 24 hours before infection. Purified AAV and rAAV were added to Ai9-MEF in triplicate. MOI was calculated using vector genome titer. Infected cells were collected at different time points for analysis of Cre DNA, Cre RNA, and Cre protein, or maintained for 5 days before flow cytometry analysis. To investigate the source of viral RNA in infected cells, the transcription inhibitor actinomycin D (AAT Bioquest 17505) was added to the cells at a concentration of 5 μg / mL 2 hours after infection.

[0552] For HEK293T Cre reporter cell line infection experiments, cells were seeded at a density of 8E4 cells per well in 48-well plates 24 hours prior to infection. Purified AAV and rAAV were added to the HEK293T Cre reporter cells in triplicate. MOI calculations were performed using vector genome titers. Cells were maintained for 5 days prior to flow cytometric analysis.

[0553] qPCR and RT-qPCR

[0554] Total cellular DNA was extracted using the TIANamp genomic DNA kit (TIANGEN, DP304-03). Total cellular RNA was extracted using TRIzol reagent (Invitrogen, 15596018) and purified using a phenol-chloroform extraction method. Total RNA was reverse transcribed using HiScript IIQ RT SuperMix (+ gDNA wipe) (Novozymes, R223-01) for qPCR according to the manufacturer's instructions. Gene-specific primers for qPCR and RT-qPCR are shown in Table S6. TM qPCR was performed on a real-time PCR system (Bio-Rad) using AceQ qPCR SYBR Green Master Mix (Novozymes, Q111-02).

[0555] Flow cytometric analysis

[0556] Five days after transduction, the transduced Ai9-MEF or HEK293T Cre reporter cells were washed once with 1x PBS and dissociated with 0.25% trypsin-EDTA. The cells were resuspended in DMEM (containing 10% FBS) and the rescued tdTomato signal was determined using flow cytometry (Beckman CytoFlex). FlowJo v10.7 (BD Biosciences) was used for analysis. Representative gating schemes are shown in Figure S5.

[0557] RNAScope assay

[0558] 24 hours before infection, HeLa (human cervical cancer) cells were seeded at a density of 8E3 cells per chamber in 8-well glass chamber slides (MERCK, #PEZGS0816). The cells were then infected with RAAV-DJ (MOI = 10,000 vg) or AAV-DJ (MOI = 1,000 vg) in DMEM (containing 2% FBS). 1 hour before infection, bafilomycin A1 (Selleck, #S1413) was applied to the cells at a concentration of 100 nM and maintained in the culture medium for 24 hours following infection. Actinomycin D (AAT Bioquest, #17505) was added at a final concentration of 5 μg / ml 1 or 6 hours after transfection. At different time points after infection, cells were fixed and processed for RNAscope analysis.

[0559] According to RNAscope TMRNAscope assays were performed using the manufacturer's protocol for the Multiplex Fluorescence Reagent Kit v2 (ACD, #323100). Briefly, fixed cells were pretreated with Universal Pretreatment Reagent (ACD, #322380). A chemically modified Cre probe (ACD, #474001) consisted of 22 ZZ pairs. Pretreated cells were hybridized with the target probe at 40°C for 2 h and labeled with TSA Vivid fluorescent dye 520 (ACD, #323271) at a concentration of 1:1000. DAPI staining was used to visualize the cell nuclei. Imaging was performed using a confocal microscope (Nikon C2si, Nikon).

[0560] Western blotting

[0561] For all Western blotting experiments, cells are cracked in LDS sample buffer (Biofuraw 180-8201D). Protein is separated using SDS-polyacrylamide gel electrophoresis, and transferred to polyvinylidene fluoride membrane. Film is blocked 1h with 5% fat-free milk dissolved in TBS / 0.05% Tween-20 (TBST), and incubated 3 hours at 4 DEG C with anti-Cre monoclonal antibody (1: 1000, Cell Signaling Technology, Inc. (Cell Signaling Technology, 15036S), washed 5 times in 1x TBST, incubated 1h at room temperature with anti-rabbit secondary antibody (1: 1000, Cell Signaling Technology, Inc., 7074S), washed 3 times in 1xTBST, and then imaged with Tanon 4600. Tubulin is detected using anti-tubulin polyclonal antibody (1: 3000, Bioworld, AP0064).

[0562] Stereotactic injection (into the hippocampus) & intravenous injection

[0563] To study the infectivity of AAV and RAAV in the mouse hippocampus, Ai9 mice (8 weeks old) were anesthetized with a mixture of zoletil (60 μg / g) and xylazine (10 μg / g), and then 1 μL of AAV-Cre (two doses: 1E8 vg / mouse and 1E7 vg / mouse) or 1 μL of RAAV-Cre (1E8 vg / mouse) was unilaterally stereotaxically injected into the dentate gyrus region of the right hippocampus according to the following coordinates: anteroposterior (A / P) = -1.7 mm, mediolateral (M / L) = -1.0 mm, dorsoventral (D / V) = -2.1 mm.

[0564] To investigate the tropism of AAV and RAAV in the mouse brain, Ai9 mice (8 weeks old) were anesthetized and intravenously injected with 300 μL of AAV-Cre (1E11 vg / mouse) or RAAV-Cre (three doses: 1E11 vg / mouse, 3E11 vg / mouse, and 1E12 vg / mouse).

[0565] Immunofluorescence staining and imaging of tissues.

[0566] To investigate the infectivity and persistence of AAV and RAAV in mice, paraformaldehyde-fixed cryostat tissue sections (brain and liver) were prepared 4 weeks after injection. Tissue sections were stained with anti-Cre antibody (1:800, Cell Signaling Technology, 15036S) and subsequently with Alexa Fluor 488-AffiniPure donkey anti-rabbit IgG (H+L) (1:1000, Jackson ImmunoResearch, 711-545-152). Cell nuclei were stained with DAPI (D3571, Invitrogen) and mounted on slides with SlowFade Diamond Antifade mounting medium (Invitrogen, S36972). Images were taken using a confocal microscope (Nikon C2si, Nikon).

[0567] gRNA-guided cell line generation

[0568] Under the control of the U6 promoter, the guide for the human TTR gene was cloned into a customized PB-T vector using NEBuilder HiFi DNA assembly. HEK293T cells were seeded in 6-well plates at 50% confluence. The next day, the PB-T-U6-gRNA construct was co-transfected with the helper plasmid pCAG-PB transposase (PBase) using polyethyleneimine. The transfected cells were selected in puromycin (Thermo Fisher, A1113803) for 2 weeks and then cultured in a BD FACSAria TM Sorting was performed based on BFP on a Sigma-Aldrich III cell sorter. Single sorted cells were deposited into 96-well plates to obtain monoclonal cell lines.

[0569] Indel sequencing of in vitro edited cells

[0570] In vitro, 96-well plates with tissue culture cells were infected with AAV-DJ-Cas12Max and RAAV-DJ-Cas12Max, and 5 days after infection, the cells were lysed with 20 μL lysis buffer from a one-step mouse genotyping kit (One Step Mouse Genotyping Kit) (Novozyme, PD101-01). The target region was amplified from genomic DNA by nested PCR using the primers described in Table S7. The PCR products with barcodes were merged together, purified with a gel extraction kit (OMEGA, D2500-02), and sequenced on an Illumina HiSeq system (150-bp double-end sequencing reads). Insertions and deletions were quantified according to the resulting library using the script deposited on github (https: / / github.com / yszhou2016 / Cas12f / blob / main / 0.Cas-Finder / 3.Indel_Calculate.pl).

[0571] Helicase sequence alignment and phylogenetic analysis

[0572] The present inventors downloaded 98 viral protein sequences containing SF3 helicases (22 ssDNA viral helicases and 76 ssRNA viral helicases) from Genbank and Uniprot (Table S1). The core sequences of these 98 helicases were aligned and phylogenetic analysis was performed using AlignX ( Figure 27A and Figure 27B These 98 core sequences were also aligned using MUSCLE, and the complete sequences of 23 randomly selected helicase-containing proteins were aligned using AlignX ( Figure 27C and Figure 27D ). The sequences in the alignment were arranged according to their genetic similarity as determined by the phylogenetic tree (Figure 27).

[0573] statistics

[0574] Data were analyzed using GraphPad Prism 8. Quantitative data are presented as mean ± SD, with n = 3 biological replicates per condition. Unless otherwise stated, biological replicates represent independent treatments in separate virus batches, culture wells, or mice. Statistical significance was calculated using an unpaired t-test. The specific statistical methods applied and descriptions of the replicates are provided in the figure legends. Asterisks indicate statistical significance; unless otherwise stated, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant.

[0575] Example 1: Multi-step AAV engineering for RNA carrying capacity

[0576] AAV is usually produced by co-transfection of a transgene plasmid, a packaging plasmid (Rep-Cap plasmid), and a helper plasmid (pAd-Helper).

[0577] In the first step of the new AAV design of this embodiment, the inventors removed two ITRs from the transgenic plasmid (expressing tdTomato) and introduced one or three copies (1× or 3×MS2) of the MS2 stem-loop at the 3' end of the transgenic cassette (between the WPRE and the poly(A) tail) RNA packaging signal (RPS). The construct of this transgenic plasmid does not contain 5' and 3' ITRs, and contains a promoter (CAG), a Kozak sequence, a tdTomato coding sequence (transgene), WPRE, 1× or 3×MS2, and an SV40 poly(A) signal ( Figure 22 B). In parallel, a transgenic plasmid without ITR and RPS (MS2) was constructed as a negative control ( Figure 22 B). See Table B for the sequence of the RNA packaging signal.

[0578] For packaging plasmids, the present inventors fused MS2 coat protein (MCP; capable of binding to MS2; used as RPS binding protein (RBP)) to the N-terminus of AAV2 Rep78 / 68 on the packaging plasmid (this fusion includes MP (the first two amino acids of AAV2 Rep78 / 68), MCP, and the remaining AAV2 Rep78 / 68 from the N-terminus to the C-terminus) to enable it to bind to MS2 in a specific RNA transcribed from a transgenic plasmid carrying RPS. This packaging plasmid contains a polynucleotide encoding the RBP-Rep fusion protein and a polynucleotide encoding the AAV-DJ Cap protein from 5' to 3'. Figure 22 B). Another packaging plasmid without MCP was used as a negative control ( Figure 22 B). The sequence of RBP is shown in Table A. The sequence of RBP-Rep fusion protein is shown in Table C.

[0579] The present inventors co-transfected HEK293T cells with a new transgenic plasmid carrying RPS and a new packaging plasmid carrying RPS binding protein in the presence of pAd-Helper to produce RNA-carrying AAV (referred to as "RAAV") ( Figure 22 B). The present inventors also generated conventional AAV for comparison ( Figure 22 A).

[0580] After harvesting RAAV particles from production cells and supernatants, the inventors analyzed the packaged nucleic acids of the RAAV particles to determine whether the AAV capsids of the RAAV particles packaged RNA containing MS2. To avoid high background plasmid signals, the inventors treated the viral stock with nucleases before extracting the (packaged) nucleic acids protected by the AAV capsids. The extracted nuclease-resistant RNA and DNA (if present) were quantified by RT-qPCR and qPCR. In addition, two pairs of qPCR primers were designed to distinguish between packaged DNA and packaged RNA. In particular, primers targeting CAG were used only to detect DNA, while primers targeting WPRE detected both DNA and RNA. As expected, DNA packaging was essentially eliminated after removing the ITR from the transgenic plasmid, as the detected DNA titers were approximately 4 orders of magnitude lower than those found in traditional AAV prepared using transgenic plasmids with ITRs ( Figure 22 C and Figure 22 D). At the same time, RNA-containing RPSs with 1× or 3× MS2 were efficiently packaged into AAV capsids, which is believed to be due to the introduction of MCP-fused Rep78 / 68 into the packaging system after ITR removal. This resulted in RNA titers of the '1× MS2' and '3× MS2' groups that were 47 times and 127 times higher than those of the MCP-free group, respectively. The present inventors therefore used a combination of 3× MS2 and MCP as a first-generation RAAV system (referred to as "RAAV-v1") ( Figure 22 C and Figure 22 D). The present inventors also demonstrated that Cre mRNA can be packaged at a titer similar to that of tdTomato mRNA ( Figure 22 E), demonstrating that rAAV-v1 can be efficiently used to package various RNA transgenes.

[0581] Although the majority of the packaged nucleic acid in the above RAAV was found to be RNA, the present inventors detected a small amount of DNA (4.8% of the packaged nucleic acid) ( Figure 22 E). The present inventors speculated that these DNAs in the RAAV vector may come from the non-specific recognition and cleavage of the transfected plasmid by the nuclease activity of the expressed Rep78 / 68 protein. The present inventors therefore introduced the 'Y156F' mutation into the MCP fusion Rep78 / 68 protein in RAAV-v1 (MCP-Rep78 / 68 Y156F ) to eliminate the endonuclease activity but retain the helicase / ATPase activity of the Rep78 / 68 protein and construct the "RAAV-v2" system ( Figure 22 F). Compared to the results of RAAV-v1, RAAV-v2 did show a significant reduction in DNA packaging without affecting RNA packaging ( Figure 22 G).

[0582] To demonstrate that the method of using RPS and RBP in AAV engineering to generate RAAV can be generalized, the present inventors examined the RNA packaging efficiency of the RAAV-v2 system using two other pairs of RPS and RBP: (1) PP7 binding site and PP7 bacteriophage coat protein (PP7 / PCP) and (2) Com binding site and phage COM protein (com / COM). Transgenic plasmids carrying three copies of RPS (3×PP7 or 3×com) and their corresponding packaging plasmids (containing Rep78 / 68 fused to PCP or COM) were constructed. Y156F RAAV was generated, purified and titrated as described above. The present inventors found that both the PP7 / PCP pair and the com / COM pair did confer significantly improved RNA packaging capacity to RAAV compared to the results of studies on conventional AAV ( Figure 22 H). In addition, the present inventors tested more AAV capsids (capsids 5, 8, and 9) and found that the RNA packaging efficiency of rAAV (with MS2 / MCP or com / COM pairs) was slightly higher when AAV capsids other than capsid DJ were used (capsids 5, 8, and 9). Figure 22 I).

[0583] Example 2: Helicase Engineering and Loading Sequence Optimization

[0584] Although the above engineering procedures have significantly improved the specific RNA packaging of RAAV and reduced undesirable DNA packaging, it is desirable to further increase the titer of RNA packaged in RAAV. The Rep protein of AAV contains a helicase / ATPase (abbreviated as "helicase") for DNA packaging ( Figure 23 A). For example, the Rep proteins of AAV2, namely AAV2 Rep78 (SEQ ID NO: 88), AAV2 Rep68 (SEQ ID NO: 284), AAV2 Rep52 (SEQ ID NO: 285) and AAV2 Rep40 (SEQ ID NO: 286) share a common helicase domain (SEQ ID NO: 186). Although the above results demonstrate that this helicase can also transport RNA, the present inventors speculate that RNA packaging efficiency can be improved by engineering the helicase through mutagenesis. AAV helicase belongs to superfamily 3 (SF3) helicase, which contains four conserved motifs that constitute the core of the helicase domain: motif A, motif B, motif B' and motif C ( Figure 23A). The conserved arginine finger is located after motif C. SF3 helicases can be encoded by both DNA and RNA viruses. The present inventors downloaded 98 viral protein sequences containing SF3 helicases (22 ssDNA and 76 ssRNA viral proteins) from GenBank and UniProt (Table S1). The helicase domains of these 98 helicases were aligned and phylogenetically analyzed using AlignX ( Figure 23 B; Figure 27A and Figure 27B They were also aligned by MUSCLE, and the complete sequences of 23 randomly selected helicase-containing viral proteins were aligned via AlignX ( Figure 27C and Figure 27D These analyses revealed several highly conserved regions in all viral helicases, as well as some differential locations (locus) between ssDNA and ssRNA viruses ( FIG. 27B to FIG. 27D For example, each amino acid residue at a position corresponding to position 344 (numbered according to SEQ ID NO: 88; or position 37 (numbered according to SEQ ID NO: 186)) of the helicase domain of AAV2 Rep78 (SEQ ID NO: 88) is an A, such as A344 (numbered according to SEQ ID NO: 88; or position 37 (numbered according to SEQ ID NO: 186) of the helicase domain of AAV2 Rep78 (SEQ ID NO: 88), A346 (numbered according to SEQ ID NO: 94; or A37 (numbered according to SEQ ID NO: 192)) of the helicase domain of AAV8 Rep78 (SEQ ID NO: 94), and A347 (numbered according to SEQ ID NO: 192) of the helicase domain of 76 ssDNA viruses. The majority (54) of the amino acid residues at the position corresponding to position 344 (numbering according to SEQ ID NO: 88; or position 37 according to numbering according to SEQ ID NO: 186) of the helicase domain of AAV2 Rep78 (SEQ ID NO: 88) (SEQ ID NO: 186) are not A. Therefore, the position (locus) of the helicase domain of the ssDNA virus corresponding to position 344 of the helicase domain of AAV2 Rep78 (SEQ ID NO: 88) (SEQ ID NO: 186) is a position (locus) that is different between ssDNA viruses and ssRNA viruses.

[0585] The present inventors focused on differential loci within conserved regions and identified 114 amino acids as candidates for mutagenesis ( Figures 27B to 27D The present inventors located 54 positions (e.g., G325, K326, ..., F458, V461) in Table S2 in the helicase domain (SEQ ID NOs: 88 and 284-286) shared by the AAV2 Rep proteins of RAAV-v2. NO:186), and identified 114 single substitutions (at 30 positions: G325, R327, W331, A336, T337, I343, A344, D371, K372, M373, I375, E378, C405, T419, S420, T422, C425, Q442, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458, V461) that showed increased RNA packaging efficiency compared to the negative control without such substitutions, and 13 single substitutions (at positions 30: G325, R327, W331, A336, T337, I343, A344, D371, K372, M373, I375, E378, C405, T419, S420, T422, C425, Q442, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458, V461) that showed more than 3-fold enhancement of RNA packaging efficiency compared to the negative control without such substitutions. Figure 23 C, Table S2).

[0586] Based on the above single substitutions, subsequent motif-directed combinatorial mutagenesis of multiple (2 to 5) amino acid substitutions resulted in 68 mutant helicase domains with multiple mutations at the same or different motifs. Six of these 68 mutant helicase domains produced RNA packaging capacities that were at least 4.1-fold greater than those found in negative controls without such substitutions. The combined mutations of A344V and K447F achieved the highest (12.7-fold) RNA packaging efficiency ( Figure 23 D and Figure 23 E, Table S3), and this mutant helicase domain / mutated AAV2 Rep78 / 68 / 52 / 40 was used as the "RAAV-v3" system in subsequent experiments. In addition, the DNA titer of RAAV-v2 was 5 times that of this RAAV-v3 ( Figure 23 E). Overall, the RAAV-v3 system now achieves about 6,000 times more RNA packaging than conventional AAV, and conventional AAV's DNA packaging is about 14,100 times greater than the RAAV-v3 system. Therefore, the DNA titer in AAV is only 8.93 times the RNA titer in RAAV-v3 ( Figure 23F). Although the helicase mutations tested herein are based on the helicase domain (SEQ ID NO: 186) of the AAV2 Rep protein (SEQ ID NOs: 88 and 284-286), similar or corresponding mutations in Rep proteins from other AAV or DNA viruses (e.g., AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10) are also within the scope of the present disclosure.

[0587] In addition to the ability of selective RNA packaging, the efficiency of RAAV in expressing exogenous proteins in cells may also depend on the translation of the delivered RNA. Therefore, the inventors further pursued codon optimization of RNA to improve its protein translation. The Cre coding sequence was optimized using two codon optimization online tools (Table S4). The inventors introduced RAAV (with capsid DJ) carrying optimized Cre coding sequences (RAAV-Cre opt1 to opt4) into cultured mouse embryonic fibroblasts (MEFs) isolated from Cre reporter mice (Ai9 mice with loxP-tdTomato). RAAV-v3 carrying the original Cre coding sequence (RAAV-Cre) was used for comparison. Five days after infection, the inventors found that at the same multiplicity of infection (MOI, calculated as vector genomes / cell), RAAV-Cre opt4 produced tdTomato. + The percentage of cells was significantly higher than that of RAAV-Cre without affecting the RNA titer ( Figure 28 ), indicating elevated Cre protein expression. Therefore, unless otherwise stated, RAAV-v3 with Cre mRNA using opt4 (RAAV-v3-optCre), generated by a combination of helicase mutagenesis and Cre coding sequence optimization, is currently the most efficient RAAV vector ( Figure 23 F) and used in all following experiments.

[0588] Example 3: Further Characterization of RAAV

[0589] The properties of RAAV-v3-optCre were further comprehensively evaluated by silver staining the protein composition of RAAV using SDS-PAGE and visualizing RAAV particles using transmission electron microscopy. The present inventors found that RAAV and AAV were indistinguishable in capsid composition and morphology ( Figure 24 A and Figure 24B). Sedimentation velocity analytical ultracentrifugation (SV-AUC) was used to further examine the particle heterogeneity of RAAV-v3-optCre. RAAV-v3-optCre vectors containing full-length RNA were represented by a sedimentation peak at 88S, which accounted for 35.1% of the entire RAAV-v3-optCre preparation ( Figure 24 D) and lower than that observed in conventional AAV formulations (75.3%) ( Figure 24 C). Further optimization of the production and purification process could increase the relative amount of intact RNA loaded into rAAV, as is commonly done to improve the quality of AAV translational applications (16,29).

[0590] To evaluate the specificity and integrity of the RAAV genome, the present inventors extracted the genomes of RAAV-v3-optCre and AAV-Cre and used SYBR TM The present inventors observed a 2000 to 2400 nt band (consistent with the expected size of Cre mRNA in RAAV) that was resistant to DNase I but not RNase I, indicating that most of the packaged genome in RAAV is intact RNA ( Figure 24 E and Figure 24 F. Figure 29 ), while the 3265 nt ssDNA in AAV-Cre is highly susceptible to degradation by DNase I but not by RNase I. In addition, RNA sequencing of whole cell lysates and virus-like particle (VLP) fractions (after removal of residual unencapsidated RNA by nucleases) was performed to identify various RNA species in the VLP fraction in the presence and absence of MCP ( Figure 24 G). The present inventors found that MCP significantly and specifically increased the amount of full-length optCre transcripts in the VLP fraction, but only slightly increased optCre transcripts in whole cell lysates ( Figure 24 H and Figure 24 I. Figure 30 ).

[0591] The upper limit of ssDNA packaging of conventional AAV is approximately 4.7K nt. The present inventors next examined the packaging capacity of RAAV-v3 by generating RAAV containing RNA of different lengths (2029, 3857, and 4337 nt) but with identical sequences at both ends. These RAAVs were then titrated using four pairs of qPCR primers targeting different regions of the RNA genome ( Figure 24 J). The present inventors found no difference in titer between WPRE and stuffer sequences (primers closer to RPS) among various RAAV with different genome sizes ( Figure 24K). However, the titers of 3'-Cre and 5'-Cre (primers further away from the RPS) decreased with increasing RNA length. The WPRE titers of 3857 and 4337 nt RNAs were 5.6 and 36.9 times higher than those of 5'-Cre, respectively ( Figure 24 K). Therefore, RNA size may affect its full-length packaging in rAAV, and this may also be influenced by other factors such as RNA stability and heterogeneity.

[0592] Example 4: Transient protein expression of RAAV-delivered RNA in cells

[0593] Next, the inventors explored the cellular infectivity of RAAV in parallel with traditional AAV using the Cre reporter system (loxP-tdTomato) and used vector genome (vg) titer for MOI calculation. RAAV-Cre and traditional AAV-Cre vectors were applied to cultured Ai9-MEFs for 12 hours, and tdTomato expression was analyzed by flow cytometry 5 days after infection. + The percentage of cells ( Figure 25 A). The results showed that RAAV-v2-Cre, RAAV-v3-Cre, and RAAV-v3-optCre all achieved successful Cre mRNA transfer and expression of functional Cre protein, as indicated by tdTomato fluorescence, and that the infectivity of RAAV-v3-optCre was comparable to that of AAV-Cre ( Figure 25 B. Figure 31 ). In contrast, negative controls of RAAV-v3-optCre (no MS2, no MCP, or no Cap) were also prepared, and none of these negative controls showed significant infectivity ( Figure 25 B). For infection assays, the amount of DNA in RAAV, RAAV without MS2, and RAAV without MCP was normalized, and the infection volume of RAAV and RAAV without Cap was normalized. Since the RAAV negative control contained significantly less RNA than RAAV ( Figure 32 ), thus the infectivity of RAAV can be attributed to encapsidated RNA rather than residual DNA.

[0594] To determine the exact levels and lifespan of viral vector-derived mRNA and translated Cre recombinase, we infected cultured Ai9-MEFs with rAAV-v3-optCre and harvested cells at different time points for determination of Cre DNA, mRNA, and protein levels ( Figure 25A). The inventors found that Cre DNA levels in cells infected with RAAV with and without MCP were equivalent to background levels found in uninfected control (mock) cells ( Figure 25 C). RAAV-derived mRNA can be detected in these cells as early as 2 hours after infection, reaches a peak at 6 hours, and then decreases to a lower level of approximately 30% of the peak level by day 5 ( Figure 25 D). In contrast, the amount of Cre mRNA in AAV-Cre-infected cells was extremely low 2 hours after infection (about 0.01% of the amount in the RAAV group), and then significantly increased 7,400-fold on day 3 ( Figure 25 As expected, the transcription inhibitor actinomycin D largely abolished the mRNA elevation induced by AAV infection but had no effect on the mRNA elevation induced by RAAV infection ( Figure 33 In addition, the present inventors found that neither infection affected the expression of mGAPDH housekeeping mRNA and 36B4 DNA (30), thus confirming the specific infection and gene expression induced by the viral vector ( Figure 34 At the protein level, unlike AAV-Cre, which continuously expresses Cre after infection, Cre expression in RAAV-infected cells can be detected as early as 17 hours after infection and disappears after one day ( Figure 25 E). To express the same amount of Cre at 17 hours after infection, the viral genome copy number of RAAV (MOI=3,000 vg) was found to be approximately 10 times that of AAV (MOI=300 vg) ( Figure 25 E), which is consistent with the inventors' expectation that infected AAV-Cre can transcribe multiple copies of Cre mRNA, thereby making the amount of expressed protein higher. In addition, RNAscope assay showed that like conventional AAV, RAAV entered the nucleus as early as 8 hours after infection of HeLa cells (29) ( Figure 25 F), and nuclear entry of RAAV can be inhibited by bafilomycin A1, which interferes with viral infection (31), but not by actinomycin D, which only affects AAV-induced mRNA transcription ( Figure 35 ). Notably, although qPCR assays showed that mRNA remained detectable 5 days after RAAV infection, Cre protein expression disappeared within 1 day, indicating that mRNA expression ceased. This is consistent with the finding that although mRNA exit from the nucleus was observed as early as 8 hours after infection, this was followed by increased cytoplasmic accumulation of mRNA (possibly involving mRNA sequestration within P bodies), a process known to downregulate translation (32) ( Figure 25 D and Figure 25F). In summary, the inventors' findings indicate that rAAV can mediate successful mRNA transfer into cultured cells and transiently express functional proteins through nuclear transport similar to that of conventional AAV. Therefore, rAAV can also be used to introduce exogenous RNA that modulates nuclear RNA in cells.

[0595] To expand the applicability of the RAAV system, the present inventors examined whether RAAV-v3 could mediate the functional transfer of a large CRISPR-Cas12Max transcript (3774 nt), which exhibits editing activity comparable to that of Cas9 (33). The present inventors incubated RAAV-v3-Cas12Max with 293T cells constitutively expressing a guide RNA (gRNA) targeting hTTR (33) and analyzed gene editing efficacy 5 days after infection. The results showed that RAAV was able to functionally transfer Cas12Max mRNA, generating 41.3% ± 1.9% insertions and deletions (indels) in recipient cells at an MOI of 10,000 vg, and background levels of editing at predicted off-target sites were comparable to those observed in untreated cultured cells ( Figure 25 G and Figure 25 H. Figure 36 Furthermore, at a similar level of on-target editing efficiency, the editing rate of AAV-Cas12Max (MOI of 3,000 vg) was 4.4 times higher than that of RAAV-Cas12Max (MOI of 10,000 vg) at the off-target site 1 ( Figure 25 G and Figure 25 H. Figure 36 Finally, only trace amounts of viral vector DNA were detected in RAAV-Cas12Max-infected cells ( Figure 25 I), greatly reducing the possibility of DNA insertional mutagenesis (34). Overall, these results suggest that RAAV-mediated mRNA delivery provides a gene editing method with reduced off-target effects.

[0596] Example 5: RAAV delivery of RNA exhibits tissue tropism

[0597] To evaluate the in vivo delivery efficacy of RAAV, the present inventors injected RAAV-v3-Cre, RAAV-v3-optCre, and AAV-Cre with capsid DJ into the hippocampus of adult Ai9 mice. Four weeks after injection, the present inventors analyzed the hippocampal expression of tdTomato and Cre ( Figure 26A). The mean percentage of tdTomato+ cells in hippocampi injected with RAAV-v3-Cre (24.2% ± 7.1%, n = 3) and RAAV-v3-optCre (29.9% ± 6.0%) was lower than that observed in hippocampi injected with AAV-Cre at the same genome dose (1E8 vg / hippocampus) (60.2% ± 24.0%) but comparable to that in hippocampi injected with a lower dose (1E7 vg / hippocampus) of AAV-Cre (30.8% ± 4.6%) ( Figure 26 B and Figure 26 C). In addition, Cre expression could only be detected in the hippocampus infected with AAV-Cre ( Figure 26 B and Figure 26 C), while no Cre DNA, RNA or protein related to the viral vector was detected in the RAAV-Cre infected hippocampus ( Figure 26 B and Figure 26 C. Figure 37 In contrast, no tdTomato expression was observed in control mice treated with RAAV without MCP. + or Cre + cell( Figure 26 B and Figure 26 C) Therefore, rAAV can efficiently deliver Cre mRNA into the mouse hippocampus and transiently express functional Cre protein.

[0598] AAV capsids isolated from various mammals (35) or artificially engineered (29) exhibit a variety of cell and tissue tropisms. Since the capsid is the main determinant of the cell / tissue tropism of AAV (35), the inventors next examined whether RAAV vectors could retain their original capsid tropism. Compared with AAV with capsid 9, intravenous injection of AAV with capsid PHP.eB is known to show higher infection efficiency in the brain and lower infection rate in the liver (12,36,37). The inventors generated Cre-encoding RAAV and AAV with capsid PHP.eB or capsid 9 ( Figure 38 ), and each viral vector was intravenously injected into Cre reporter mice Ai9. Mice were killed 4 weeks after infection to analyze tdTomato and Cre expression in liver and brain tissues ( Figure 26 D) Regarding capsid 9, the present inventors found that tdTomato in the liver of mice injected with AAV9-Cre (at a dose of 1E11 vg) + cells (74.7%) and Cre +In contrast, as the vector dose increased from 1E11 vg to 1E12 vg, the tdTomato expression in the liver of mice injected with RAAV9-v3-optCre was significantly increased. + The percentage of cells increased from 4.8% to 74%, whereas, as expected, no Cre was detected in the livers of RAAV9-v3-optCre-infected mice. + cell( Figure 26 E to Figure 26 G). In addition, neither AAV9-Cre nor RAAV9-v3-optCre produced significant infection in the brain ( Figure 26 H). As for the capsid PHP.eB, the present inventors found that the liver infection of mice infected with AAV-PHP.eB-Cre and RAAV-PHP.eB-Cre was much lower than that of mice infected with the same dose of AAV9-Cre and RAAV9-Cre, respectively ( Figure 26 E). In contrast, the present inventors found that the infection tropism for brain tissue was obvious, and the percentage of cells expressing tdTomato in various brain tissues of AAV-PHP.eB-Cre-infected mice was significantly higher than that found in mice injected with AAV9-Cre (at a dose of 1E11 vg). + The percentage of cells was high (12.6%, cortex; 6.4%, hippocampus; 21.4%, thalamus; 11.3%, striatum; 20.9%, midbrain) ( Figure 26 H to 26J), consistent with previous studies (12, 36, 37). Interestingly, the present inventors found that RAAV-PHP.eB-v3-optCre-infected mice also efficiently infected the whole brain, showing a high percentage of tdTomato at a dose of 1E12 vg. + cells (36.1%, cortex; 9.4%, hippocampus; 43.4%, thalamus; 37.6%, striatum; 38.9%, midbrain) ( Figure 26 H to 26J), indicating that RAAV-PHP.eB shares the same tropism as AAV-PHP.eB. However, due to the short lifespan of the mRNA delivered by RAAV-PHP.eB and the translated Cre, the present inventors observed Cre expression only in the brain infected with AAV-PHP.eB, but not in the brain infected with RAAV-PHP.eB ( Figure 26 K). As a control, very little tdTomato was observed in control mice treated with RAAV9 or RAAV-PHP.eB without MCP. + cell( Figure 39 In addition to its tissue tropism, RAAV also retains its cell tropism, as shown by the results of using RAAV with various capsids to infect different types of cultured cells ( Figure 40 Collectively, these results demonstrate that rAAV retains the infectious tropism derived from its capsid and can mediate specific infection of target cells, tissues, and organs to transiently express functional proteins of interest.

[0599] In summary, through multi-step engineering, the inventors have developed an RNA delivery vector RAAV from the DNA virus AAV, which exhibits high RNA selectivity and very low residual DNA packaging (about 0.005%). The RAAV system combines the transient nature of RNA with the multiple tissue tropisms of the AAV capsid, making it an ideal choice for broad-spectrum or tissue-specific RNA delivery. The results of this study demonstrate the feasibility of using rational engineering to change the type of viral genome. Our strategy for developing RAAV can be extended to other DNA viruses to give them RNA packaging capabilities. Further optimization of the RAAV system disclosed herein can be achieved by improving RNA packaging specificity, vector productivity, translation efficiency, and the integrity and stability of the packaged genome, especially for large-sized RNA. However, the RAAV disclosed herein represents the first cross-BBB RNA delivery system that can efficiently infect the entire brain for basic neuroscience research and therapeutic applications.

[0600] Table S1. List of 98 helicase-containing viral protein sequences used for alignment.

[0601]

[0602]

[0603]

[0604]

[0605]

[0606] Table S2. List of single helicase mutations.

[0607]

[0608]

[0609]

[0610]

[0611] Table S3. List of combinatorial helicase mutations.

[0612]

[0613]

[0614] Table S4. Optimized Cre coding sequences.

[0615]

[0616]

[0617]

[0618]

[0619] Table S5. Plasmid information table.

[0620]

[0621]

[0622]

[0623] Table S6. Primers used in qPCR and RT-qPCR.

[0624]

[0625] Table S7. Primers used to amplify on-target and predicted off-target sites for NGS.

[0626]

[0627] Example 6: Efficient packaging of RNA into RAAV viral particles

[0628] This example demonstrates that RNA vector genomes can be efficiently packaged into AAV viral capsids, particularly using modified / recombinant RNA designed for direct packaging into AAV capsids.

[0629] First, it was unexpectedly shown that, when transcribed (as RNA), the AAV packaging signal - ITR (DNA) is capable of promoting the packaging of the disclosed RNA (e.g., rRAAV vector genomic RNA) into AAV particles, particularly when it is present in certain configurations (e.g., when the transcribed modified AAV ITR sequence is close to the 3' end of the transcribed RNA sequence of the disclosure).

[0630] Specifically, the wild-type and modified AAV ITR sequences (DNA) from the ends of the AAV vector genome were moved to their respective transgene expression cassettes to ensure that all transgene transcripts (RNA) contained the candidate packaging signal. To block the production of traditional AAV vectors with ssDNA genomes during AAV production, optimized ITRs (dITR (SEQ ID NO: 2) and dITR-D (SEQ ID NO: 3)) were used in place of the wild-type ITR (SEQ ID NO: 1).

[0631]

[0632] Specifically, in the wild-type AAV2 ITR (ITR2) sequence in an inverted configuration, the TRS ("TTGGC") is located at the 5' end of the ITR, and its reverse complement sequence GCCAA is double underlined. This sequence can be cloned into the encoding plasmid in either orientation (i.e., the sequence shown in SEQ ID NO: 1 or its reverse complement can be used as a template to transcribe the RNA disclosed herein). In the experiments herein, the wild-type AAV2 ITR sequence was cloned in such an orientation that the transcribed RNA had the same sequence as SEQ ID NO: 1 (or SEQ ID NO: 2 or 3 below), except that the T in the transcribed RNA was replaced by U. In any case, after transcribing this sequence or its reverse transcript, the resulting wild-type ITR2 transcribed RNA contained a palindromic transcribed RBE (grey shading). In the experiments herein, the transcribed RNA contained a transcribed wild-type AAV2 ITR that was identical to SEQ ID NO: 1 except that all Ts were replaced by U. If the reverse complement of SEQ ID NO: 1 is used as a DNA template, the transcribed RNA will contain a transcribed TRS (UUGGC) encoded by GCCAA. The transcribed TRS is located between the transcribed RBE and the transcribed D sequence.

[0633] One modified ITR sequence is a "ΔITR" (or "dITR" for short), which is defective because the dITR lacks the D region sequence (bold italics), the 5' end TRS, and the reverse complement TRS sequence ("GCCAA") (except for the first G). After transcription of this sequence, the transcribed RNA of the dITR also contains a palindromic transcribed RBE (grey shading) and a transcribed defective ITR lacking the transcribed TRS (UUGGC) encoded by GCCAA. However, in this experiment, the reverse complement of SEQ ID NO: 2 was used as the DNA template, so that the transcribed RNA contained a transcribed modified AAV2 ITR (transcribed dITR) having the same sequence as SEQ ID NO: 2, except that all Ts were replaced by Us.

[0634] Another modified ITR sequence is "dITR-D", which is also defective because it retains its D sequence ("CTCCATCACTAGGGGTTCCT", SEQ ID NO: 4), but lacks the 5' terminal TRS (TTGGC). In addition, only the first G in the reverse complementary TRS (GCCAA) is retained in dITR-D, and the remaining CCAA sequence is replaced by an unrelated ACTAG sequence. In this experiment, the reverse complementary sequence of SEQ ID NO: 3 was used as a DNA template, so that the transcribed RNA contained a transcribed modified AAV2 ITR (transcribed dITR-D) having the same sequence as SEQ ID NO: 3, except that all Ts were replaced by Us.

[0635] Note that both the dITR and dITR-D sequences retain the shaded palindromic RBE sequence SEQ ID NOs: 42-43 (CTGCGCGCTCGCTCGCTCACTG...CAGTGAGCGAGCGAGCGCGCAG), respectively, and their corresponding transcribed modified ITRs also have RBE sequences.

[0636] This optimized ITR coding sequence (DNA) was inserted into two positions of the tdTomato expression cassette, one between the promoter and the tdTomato coding sequence, and the other between the woodchuck hepatitis virus (WHP) posttranscriptional regulatory element (WPRE) and the SV40 poly A signal.

[0637] A series of different ITR-based RAAV vectors were constructed based on the sequence, number, and position of the optimized ITRs used (see Figure 3 ).

[0638] A traditional AAV vector with an ssDNA vector genome and no ITR sequences at both ends ("CTWS", representing the sequence elements CAG promoter, tdTomato transgene, WPRE sequence, and SV40 poly A signal sequence) was used as a control. For this experiment, AAV serotype DJ was selected because it has excellent transduction efficiency in the cultured cells used. AAV-DJ is a synthetic serotype with a chimeric capsid of AAV-2, 8, and 9. Its capsid contains a heparin-binding domain that can efficiently transduce a variety of cell types and evade immune neutralization (Grimm et al., J. Virol. [Journal of Virology] 82: 5887-5911, 2008).

[0639] Various RAAV-ITR virus particles and control virus particles were generated using a three-plasmid transfection system ( Figure 4 ).

[0640] Specifically, RAAV vectors were generated by co-transfecting a transgenic plasmid, a packaging plasmid, and a helper plasmid (weight ratio of 1:1:2) into HEK293T cells. HEK293T cells were cultured in competent DMEM medium and seeded 24 hours before transfection. Before transfection, the medium was replaced with fresh DMEM containing 2% FBS. PEI-MAX was used as a transfection reagent. Supernatants were then collected on days 2 and 5 after transfection, and transfected cells were harvested on day 5. RAAV vectors were purified by ultracentrifugation using iodixanol density gradients.

[0641] Virus titers (DNA titer and RNA titer) were determined by Q-PCR and reverse transcription-PCR (RT-PCR), respectively. Figure 5A The program in is determined.

[0642] Briefly, harvested and purified RAAV viral particles were first treated with DNase I and RNase I at 37°C for 2 hours to remove all nucleic acids outside the viral particle protein shell. Next, the nucleases were denatured at 100°C for approximately 30 minutes, and the RAAV viral particles were denatured and disrupted to release the RAAV nucleic acid content for further analysis.

[0643] Q-PCR is used to analyze nuclease-resistant products to titrate the DNA vector genome encapsidated within RAAV virions. Specifically, a primer pair specific for the promoter sequence is used in one set of Q-PCR to detect / quantify any functional DNA, and a primer pair specific for the WPRE sequence is used in another set of Q-PCR to detect / quantify any DNA vector genome encapsidated within RAAV virions. Figure 5B .

[0644] In parallel, in another sample, any rAAV encapsidated DNA was first removed by DNase I digestion, and the remaining RNA was then reverse transcribed, and the resulting cDNA was used as a Q-PCR template to detect / quantify the WPRE sequence transcribed into RNA. To detect / quantify any residual DNA that may be present after incomplete DNA removal, the sample after the DNA removal step was directly amplified using Q-PCR to detect any WPRE (DNA) sequence that may be present in the sample. See Figure 5A .

[0645] To test the packaging efficiency of the CITWS construct (see Figure 6A), when using traditional pssDNA constructs (with wild-type ITR sequences at both ends) to generate viral particles, the vast majority of viral particles contain a functional DNA vector genome with a promoter sequence and a WPRE sequence. Very occasionally (two orders of magnitude, or about 1% of the time), an RNA vector genome is also packaged into viral particles (see the bar labeled "RNA," which is about two orders of magnitude lower than the bars labeled "DNA" and "Functional DNA"). Residual DNA is one order of magnitude lower than the packaged RNA vector genome.

[0646] At the same time, removal of the ITR sequences from both ends of the AAV vector genome essentially eliminated packaging- Figure 6A The CTWS construct in (without ITRs) produced 2-2.5 orders of magnitude less packaged DNA and even less RNA.

[0647] Adding only one optimized ITR sequence (dITR or dITR-D sequence) between the 3' promoter and the 5' GOI coding sequence does not appear to enhance RNA packaging compared to the CTWS control, although DNA packaging appears to be slightly improved. Figure 6A .

[0648] Interestingly, in Figure 6B Very different results were obtained in , where CTWIS constructs were tested. In particular, with regard to packaging pssDNA constructs (compare Figure 6A and Figure 6B ), essentially the same results were obtained—the majority of packaged viral particles contained DNA (99% or more) and negligible amounts (1% or less) of RNA. However, the addition of an optimized ITR sequence (dITR) between the 3' end of the WPRE sequence and the 5' end of the poly A sequence significantly reduced or even reversed the difference in packaging efficiency between DNA and RNA. This effect was even more pronounced when the dITR-D sequence was used, when the vast majority of the packaged nucleic acid was RNA (1-2 orders of magnitude higher than the packaged DNA).

[0649] Essentially the same results were obtained if an additional (i.e. second) optimized ITR sequence was inserted between the promoter and the GOI coding sequence in the CITWIS construct. Figure 6C .

[0650] These results demonstrate that optimized ITRs (dITR and dITR-D) impair the replication of conventional AAV vectors, resulting in reduced DNA packaging into AAV viral particles.

[0651] Compared to the control vector CTWS (no ITR) and the RAAV-dITR vector, RAAV vectors with dITR-D optimized ITRs appear to have a better ability to direct encapsidation of transcribed mRNA into RAAV particles, especially when the dITR-D ITR is located downstream of the mRNA coding sequence and the WPRE sequence (e.g., just 5' of the poly A signal). Figures 6A-6C In contrast, a dITR-D sequence located upstream of the mRNA coding sequence (e.g., just after the promoter sequence in the expression construct) barely promoted direct packaging of the mRNA into RAAV viral particles. At the same time, if another dITR-D sequence was inserted downstream of the mRNA coding sequence (e.g., just 5' of the poly A sequence), the packaging of the resulting RAAV mRNA was similarly highly increased ( Figure 6C ).

[0652] In conclusion, CITWIS-D, which carries dITR-D signals at both ends of its mRNA genome, has the best ability to encapsidate specific mRNA, although the yield (mRNA-carrying particles) of conventional AAV vectors with ssDNA vector genomes (pssAAV group) is 20 times higher. Unlike conventional AAV vectors, the RAAV vector CITWIS-D has impaired DNA packaging, with its DNA-carrying particles accounting for only about 20% or less of the RAAV vector stock, and the percentage of particles carrying functional DNA is even lower (e.g., less than 10%) ( Figures 6A-6C ).

[0653] Due to the limited packaging capacity of AAV (<4700 nt), undesirable AAV DNA packaging can be reduced by increasing the size of the transgene plasmid. Functional DNA packaging can be further reduced by increasing the length of the transgene cassette, for example, by inserting cis-acting elements (such as enhancers, introns, etc.) or non-functional stuffer sequences into the cassette.

[0654] Example 7: RAAV virus particles are functional

[0655] This example demonstrates that the RAAV-dITR-D vector of the present invention is infectious and can be used as a gene delivery vector.

[0656] 2 × 10 cells were infected in vitro with the same volume of purified rAAV-dITR-D (CITWIS-D) vector at the same MOI of approximately 50,000 (the MOI of CITWIS-D vector was calculated from the sum of the number of DNA particles and the number of mRNA particles). 5 HEK293T cells.

[0657] Specifically, HEK293T cells were seeded in 24-well plates approximately 24 hours before infection. The RAAV vector was then thoroughly mixed with 1 mL of DMEM (containing 2% FBS). The cell culture medium was then removed, and the cells were incubated with the mixed RAAV vector overnight. Fluorescence images were taken 3 and 5 days after infection.

[0658] The results showed that the CITWIS-D vector expressed tdTomato faster than other vectors, but the expression was also rapidly downregulated (see Figure 7B This rapid expression and degradation phenomenon may be due to the short lifespan of its mRNA genome ( Figure 7B ).

[0659] Interestingly, the CTWS construct, lacking any ITR sequences, was apparently packaged to some extent, although the precise mechanism underlying this packaging remains unclear. At least two possibilities could explain the packaging of the mRNA vector genome when using the CTWS vector: overexpressed cellular mRNA could be nonspecifically packaged into the rAAV vector, or the CTWS mRNA might possess RNA structures that interact with Rep2 or Cap-DJ. Furthermore, the CTWS DNA packaging could be due to the small size of the CTWS plasmid, and increasing the size of the CTWS plasmid could reduce DNA packaging.

[0660] Example 8: Efficient RNA packaging into RAAV particles

[0661] This example demonstrates that RNA genomes can be efficiently packaged into AAV capsids, particularly using the modified / recombinant RNAs designed herein for direct packaging into AAV capsids to produce AAV particles.

[0662] 1. Design

[0663] The inventors have devised a strategy that exploits the strong interaction between the bacteriophage-derived MS2 coat protein (MCP) and its recognition stem-loop MS2 as a novel packaging signal for packaging heterologous RNA into DNA virus virions.

[0664] First, in order to inhibit / reduce the production of conventional AAV particles with packaged ssDNA genomes during RAAV production, the conventional AAV packaging signal, the ITR, was removed. Instead, one or three copies of the RNA packaging signal (RPS), namely the MS2 stem-loop (or "MS2" for short, see Table B for its sequence) were inserted into the tdTomato expression cassette, located between the woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) and the SV40 poly A signal, to ensure that all transcribed mRNAs have the RPS and are thus recognized by the binding protein, namely the bacteriophage-derived MS2 coat protein (or "MCP" for short, see Table A for its sequence) (corresponding to MS2). Figure 8A ).

[0665] Since AAV Rep proteins are nonstructural proteins and they usually act as a bridge between the ITRs of the ssDNA genome and the AAV capsid during the AAV packaging process, MCP was fused to the N-termini of the Rep78 and Rep68 proteins from AAV2 (Rep68 is a C-terminal truncation of Rep78; see Table C for its sequence listing). The ability of these MCP-Rep78 / 68 fusions to interact with the MS2 sequence within the RNA genome and promote the packaging of the RNA genome into the AAV capsid was verified.

[0666] The conventional AAV vector pssAAV-tdTomato (with two wild-type functional ITRs) and CTWS ("CTWS", representing the sequence elements CAG promoter, tdTomato transgene, WPRE sequence, and SV40 poly A signal sequence) without functional wild-type ITRs were used as controls ( Figure 8A In this example, AAV serotype DJ ("AAV-DJ" or "DJ") was selected for use due to its excellent transduction efficiency in the cultured HEK293T cells used in this example. AAV-DJ is a synthetic serotype with a chimeric capsid of AAV-2, 8, and 9.

[0667] 2.RAAV packaging and production

[0668] In this paper, we used the traditional three-plasmid transfection system with necessary modifications to co-transfect the corresponding transgenic plasmid, packaging plasmid, and helper plasmid into HEK293T cells at a mass ratio of 1:1:2 to produce rAAV and control AAV particles.

[0669] Specifically, HEK293T cells were cultured in competent DMEM medium and seeded 24 hours before transfection. Shortly before transfection, the medium was replaced with fresh DMEM containing 2% FBS. PEI-MAX was used as a transfection reagent. After transfection into infected cells, the transgenic plasmid carrying the RPS was transcribed to generate the RNA genome to be packaged. Supernatants were then collected on days 2 and 5 after transfection, and transfected cells were harvested on day 5. RAAV and control AAV particles were purified by ultracentrifugation using iodixanol density gradients.

[0670] 3. Detection of Packaged Genomes

[0671] Purified RAAV and control AAV particles were first treated with nucleases (including DNase I and RNase I) at 37°C for 2 hours to remove nucleic acids that may be present outside the viral particles. Next, the nucleases and RAAV or control AAV particles were denatured by proteinase K / SDS digestion at 65°C for about 3 hours to disrupt the viral particles and release the genome packaged therein. The nuclease-resistant polynucleotide containing the released viral genome was then extracted and purified by phenol / chloroform extraction.

[0672] To determine the DNA genome titer of control AAV and rAAV particles, direct analysis of nuclease-resistant polynucleotides was performed using Q-PCR. A pair of WPRE primers specific for the WPRE sequence on the viral genome (shown in the sequence listing below) was used in Q-PCR to detect and quantify any DNA genome encapsidated in control AAV or rAAV particles.

[0673] To measure the RNA genome titer of control AAV and rAAV particles, any control AAV- or rAAV-encapsidated DNA genomes were removed by DNAse I digestion prior to reverse transcription of the encapsidated RNA genomes, and the resulting cDNA was used as a Q-PCR template using the same WPRE primer pair described above to detect and quantify the WPRE sequence. To detect and quantify any potential residual DNA that may be present due to incomplete DNA removal, samples were amplified directly (without reverse transcription) using Q-PCR after the DNA removal step using the same WPRE primer pair described above to detect the WPRE (DNA) sequence, which was also used in all other PCR reactions specific for the WPRE sequence.

[0674] 4. Comparison of packaging efficiency

[0675] When a conventional transgenic plasmid containing a pssAAV-tdTomato construct (with wild-type ITRs at both ends) and a conventional packaging plasmid for AAV-DJ were used to produce control AAV particles, the vast majority of particles contained DNA genomes with WPRE sequences. Very occasionally, RNA genomes were also packaged into the particles (see the bar labeled "RNA," which is about 5 orders of magnitude lower than the bar labeled "DNA"). The presence of residual DNA was comparable to that of RNA, which may be due to low efficiency of DNase I digestion of the packaged DNA genome prior to reverse transcription.

[0676] Interestingly, when the recombinant packaging plasmid DJ-MCP (MCP fused to the N-termini of Rep78 and 68 proteins) was used instead of DJ, the packaging of the DNA genome was slightly reduced (by about 0.5 orders of magnitude), but the pattern of viral genome distribution was almost the same, with DNA packaging being about 5 orders of magnitude higher than RNA packaging. This result suggests that fusing MCP to the N-termini of Rep78 / 68 proteins does not significantly impair their natural function ( Figure 8B ).

[0677] Meanwhile, removal of the ITRs from both ends of the pssAAV-tdTomato construct, resulting in the CTWS construct, significantly abolished DNA packaging. Regardless of which packaging plasmid (DJ or DJ-MCP) was used, the CTWS construct (without ITRs) produced approximately four orders of magnitude less packaged DNA and even less packaged RNA.

[0678] In addition, by adding one or three copies of RPS (MS2) between the 3' of WPRE and the 5' of SV40 poly A signal on the ITR-less viral genome, rAAV transgenic plasmids, CTWMS and CTWM3S, were generated, respectively. In the absence of MCP, the CTWMS and CTWM3S constructs were barely encapsidated as either DNA or RNA genomes, as was the case with the CTWS genome distribution pattern. Surprisingly, using DJ-MCP instead of DJ as the packaging plasmid significantly reversed the difference in packaging efficiency between DNA and RNA genomes, and the vast majority of the packaged genome was RNA.

[0679] The number of RNA genomes packaged by CTWMS / DJ-MCP and CTWM3S / DJ-MCP was 100 times and 400 times that of CTWS / DJ-MCP, respectively, while there was no significant difference in the number of DNA packages among the three. This result indicates that the MCP-Rep78 / 68 fusion can specifically recognize RPS and MS2 embedded in the RNA transcripts of CTWMS and CTWM3S plasmids and promote their RNA packaging into rAAV particles. In addition, three copies of RPS in the CTWM3S construct provide better RNA packaging efficiency than one copy ( Figure 8B ).

[0680] In summary, introduction of the MS2 / MCP pair into the conventional AAV packaging system enabled the packaging of MS2-carrying RNA genomes into AAV particles in the presence of the MCP-Rep78 / 68 fusion, thereby generating rAAV particles. Undesirable DNA packaging accounted for only approximately 10% of the total viral particle population produced using CTWM3S / DJ-MCP.

[0681] In other words, an artificial / heterologous RNA packaging signal (RPS) - the MS2 sequence - can be used together with its cognate binding protein MCP to replace the natural DNA virus packaging signal pair (i.e., ITR and Rep) to significantly enhance the efficiency of RNA packaging into another DNA virus while inhibiting its intrinsic packaging into the same DNA virus.

[0682] Example 9: Enlarged plasmid backbone reduces undesirable DNA packaging of RAAV

[0683] This example demonstrates that increasing the backbone size of an AAV transgene plasmid by inserting a stuffer sequence into the plasmid backbone can reduce undesired DNA packaging into AAV particles.

[0684] Although the CTWMS and CTWM3S constructs used for RAAV particles in Example 3 lack ITRs and reverse packaging is absent in RAAV production, it is speculated that the relatively small size of RAAV transgenic plasmids (5-6 kb) may still result in undesirable DNA packaging.

[0685] Therefore, a 3266 bp non-coding sequence (stuffer sequence; see sequence listing below) was inserted upstream of the tdTomato expression cassette of CTWM3S to increase the backbone length of the CTWM3S transgenic plasmid, and the resulting construct was named L-CTWM3S. Figure 9A shown.

[0686] The traditional AAV genome construct pssAAV-tdTomato and the RAAV genome construct CTWM3S used in Example 3 were used as controls herein. As in Example 3, RAAV particles were prepared by co-transfecting the CTWM3S or L-CTWM3S transgenic plasmid with the packaging plasmid DJ-MCP and helper plasmid into HEK293T cells, and the resulting RAAV particles were purified and the viral genome was quantified. The same pair of WPRE primers was used to detect and quantify any DNA and RNA genome encapsidated in AAV and RAAV particles, and another pair of CAG primers specific for the CAG promoter sequence in the viral genome was used in Q-PCR to detect and quantify any functional DNA (i.e., DNA containing a CAG promoter sequence and capable of expressing a functional transgenic protein).

[0687] Note that packaged RNA genomes cannot be detected with CAG primers because they do not contain a CAG promoter, and the RNA bar in the figure with CAG primers represents the background RNA signal (see Figure 9B ).

[0688] Surprisingly, the titer of the CTWM3S group was approximately twice that of the DNA genome titer of the L-CTWM3S group, regardless of which primer pair was used in Q-PCR (see Figure 9B and 9C The RNA genome titers of the CTWM3S and L-CTWM3S groups were essentially equivalent (see Figure 9C Since there is no CAG promoter sequence in the transcribed RNA from the CTWM3S and L-CTWM3S transgenic plasmids, the packaged RNA genome can only be detected using a pair of WPRE primers ( Figure 9C ).

[0689] In summary, increasing the backbone length of the transgenic plasmid can reduce the undesirable DNA packaging of RAAV particles without interfering with their RNA packaging, indicating that the disassembly of the DNA packaging system and the establishment of the RNA packaging system in AAV particles are two separate lines, and this long stuffer sequence was used for the RAAV transgenic plasmid in subsequent examples.

[0690] Example 10: Use of the rAAV-MS2 / MCP system for additional transgenes

[0691] To validate the general applicability of the rAAV-MS2 / MCP system for additional transgenes and to ensure that the observed RNA packaging was not simply an artifact associated with the reporter gene used, a series of AAV and rAAV transgene plasmids containing a Cre recombinase expression cassette were generated.

[0692] The traditional pssAAV-Cre ( Figure 8A The tdTomato coding sequence in the pssAAV-tdTomato construct was replaced with the Cre coding sequence) and the corresponding L-CCWS construct ( Figure 8A The tdTomato coding sequence in CTWS was replaced with the Cre coding sequence, and the stuffer sequence in Example 4 was inserted as a control, where the second C represents the Cre recombinase transgene. After replacing the tdTomato coding sequence with the Cre coding sequence, the L-CTWM3S construct in Example 4 was also redesigned into the L-CCWM3S construct.

[0693] Cre transgenic plasmids were co-transfected with packaging plasmids DJ or DJ-MCP and helper plasmids into HEK293T cells to produce AAV and rAAV particles, respectively. The resulting viral particles were purified and the viral genome was quantified as described in Example 3.

[0694] For AAV-Cre and RAAV-Cre, the same viral genome distribution results as for AAV-tdTomato and RAAV-tdTomato were obtained. For pssAAV-Cre, most viral particles contained DNA genomes, and the DNA genome titer was about 4-5 orders of magnitude higher than the RNA genome titer. For L-CCWS, due to the lack of both DNA and RNA packaging signals, there was almost no encapsidation of DNA and RNA genomes. For L-CCWM3S, RNA packaging in the DJ-MCP case was significantly improved by about 200 times compared to L-CCWS / DJ-MCP, and the undesired DNA-carrying viral particles accounted for only about 1% of the entire viral particle population ( Figure 10A and 10B ).

[0695] Since the DJ-MCP fusion not only facilitates RNA packaging but also retains DNA packaging ability, its performance was also evaluated in a construct containing both a DNA packaging signal (ITR) and an RNA packaging signal (3 copies of MS2), which was constructed by inserting 3 copies of MS2 between the WPRE and SV40 poly A of the pssAAV-Cre construct and named pssAAV-Cre-MS2X3. The results showed that in the absence of MCP, most viral particles contained packaged DNA genomes, and only negligible amounts of RNA genomes were packaged in the presence or absence of RNA packaging signals. When DJ-MCP was used instead of DJ as the packaging plasmid in combination with the RNA binding signal, RNA packaging was significantly improved, and surprisingly, the increased RNA packaging did not significantly interfere with DNA packaging of the pssAAV-Cre-MS2X3 construct ( Figure 11BAnother viewpoint also proved that even without removing the DNA packaging signal - ITR, the introduction of MS2 / MCP pair can significantly increase RNA packaging, indicating that the deconstruction of DNA packaging system and the establishment of RNA packaging system in AAV particles are two separate processes, and that the removal of ITR is not a necessary basis for increasing RNA packaging by introducing RPS / RBP pair.

[0696] In summary, the present RAAV-MS2 / MCP system is generally applicable to any transgene, such as the Cre recombinase shown above. Interestingly, the RAAV-Cre construct produced better yields than the RAAV-tdTomato construct. While not wishing to be bound by any particular theory, this may be due to the simpler secondary structure of the Cre mRNA compared to the tdTomato mRNA, based on online RNA secondary structure predictions such as those found at rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi.

[0697] Example 11: Optimization of RAAV Production System and Identification of Optimized RAAV Particle Characteristics

[0698] The endonuclease activity of the Rep68 and Rep78 proteins (Rep68 / 78) is essential for DNA genome replication during the traditional DNA packaging process of AAV particles. Without a functional trs-endonuclease, newly synthesized viral ssDNA cannot be released for packaging. In this example, it was investigated whether the undesirable DNA packaging of AAV particles could be further reduced by disrupting the activity of the trs-endonuclease.

[0699] To investigate this, three trs-endonuclease negative mutants were constructed, namely DJ-MCP(Y156F, wherein the Y156F mutation is located in the consensus sequence of Rep68 and Rep78 proteins, i.e., Rep68-Y156F and Rep78-Y156F), DJ-MCP(KDE-mu) and DJ-MCP(EKE-mu) (see sequence listing below).

[0700] First, the DNA and RNA packaging efficiency of DJ-MCP (Y156F) was assessed using the transgenic plasmid pssAAV-Cre-MS2X3 (described in Example 5) containing both DNA and RNA packaging signals. DJ and DJ-MCP were set as packaging plasmid controls. Viral particles were generated, purified, and titrated as described in Example 3.

[0701] The results demonstrated that the Y156F mutation in DJ-MCP significantly reduced ITR-mediated DNA packaging of pssAAV-Cre-MS2X3 without interfering with RNA packaging.

[0702] Therefore, in addition to removing the DNA packaging signal ITR as shown in the previous examples, functional proteins involved in the DNA packaging process (such as Rep78 / 68 proteins) can also be modified, for example, mutated, to weaken or eliminate their functions related to DNA packaging. This can be used as another strategy to reduce or inhibit the traditional DNA packaging of AAV particles ( Figure 13A ).

[0703] Then, L-CCWM3S from Example 5 was used as the RAAV transgenic plasmid instead of pssAAV-Cre-MS2X3 to provide the viral genome. A trs-endonuclease-positive DJ-MCP was used as a control for DJ-MCP(Y156F). Viral particles were generated, purified, and titrated as described in Example 3. Two pairs of primers were used to titrate the viral genome: one pair targeting the WPRE sequence described above and the other pair (see sequence listing below) targeting the 5' end of the Cre coding sequence.

[0704] The results showed that the Y156F mutation in the Rep78 / 68 protein not only reduced undesirable DNA packaging by about 10-fold, but also increased desirable RNA packaging by about 50%. For the two primer pairs used in Q-PCR (i.e., the WPRE primer pair and the Cre primer pair), the pattern of packaging efficiency differences between packaged DNA and RNA genomes was essentially the same ( Figures 12A-12B ).

[0705] Two other trs-endonuclease mutants, DJ-MCP(KDE-mu) and DJ-MCP(EKE-mu), were also tested and demonstrated to have the same ability as DJ-MCP(Y156F) to reduce undesirable DNA packaging, but only DJ-MCP(Y156F) showed improved RNA packaging ( Figure 13B ).

[0706] We further demonstrated that fusing two copies of MCP to the N-terminus of the Rep 78 / 68 proteins (MCPx2-Rep78 and MCPx2-Rep68) also resulted in a reduction in undesirable DNA packaging. Figure 13B ).

[0707] The composition of AAV and RAAV particles was analyzed by silver-stained SDS-PAGE. The RAAV capsid is also composed of three VP proteins (VP1, VP2, and VP3), with the VP1 / 2 / 3 ratio similar to that of traditional AAV particles ( Figure 12C ).

[0708] To analyze the morphology of RAAV particles, 10 μL of purified AAV and RAAV particles were placed on a 300 μm carbon-coated polyvinyl acetal (Pioloform)-coated copper grid and incubated for 2 min at room temperature. The excess sample was blotted off with filter paper and immediately replaced with 10 μL of stain (3% phosphotungstic acid), allowed to stand for 2 min, and then blotted off again. The samples were visualized using a Talos L120C transmission electron microscope. RAAV particles are morphologically similar to conventional AAV vectors, where intact viral particles encapsulating the genome are seen as 25-nm solid spheres, while empty viral particles without the encapsulated genome are 25-nm donut-shaped structures ( Figure 12D ).

[0709] In summary, mutation of functional proteins involved in the DNA packaging process in AAV production, including Rep proteins, to weaken or eliminate their DNA packaging-related functions and to remove the DNA packaging signal ITR is the best strategy to reduce or inhibit undesirable DNA packaging in RAAV particles. The resulting RAAV particles have a composition and morphology similar to conventional AAV particles.

[0710] Example 12: RAAV vector expressing functional protein

[0711] This example demonstrates that the RAAV vector of the present invention is infectious and can be used as a gene delivery vector.

[0712] The Cre-loxP system is a highly sensitive system used to study the infectivity of the RAAV vectors of the present invention. Mouse embryonic fibroblasts (MEFs) isolated from homo-Ai9 mice (carrying the loxP-tdTomato reporter gene system) were incubated overnight with the AAV (pssAAV-Cre / DJ) or RAAV (L-CCWM3S / DJ-MCP(Y156F)) vectors purified in Example 5, and the multiplicity of infection (MOI) (the number of viral particles added per cell during infection) was set, including an MOI of 7 for traditional AAV vectors and an MOI of 3 for RAAV vectors. The dominant genome titer, quantified by detecting the Cre coding sequence with the above-mentioned 5' end Cre primer, was used as the infectious titer. In other words, the DNA genome titer was used for traditional AAV vectors, while the RNA genome titer was used for RAAV vectors.

[0713] Specifically, Ai9-MEF cells were plated at approximately 5 × 10 4Cells / well were seeded in a 48-well plate. The AAV vector or RAAV vector was then thoroughly mixed with 0.5 mL of DMEM containing 2% FBS. The culture medium of the seeded cells was removed, and the cells were then incubated overnight at 37°C with the mixed AAV or RAAV vector. Infected cells were collected at different time points and subjected to RNA and DNA analysis. As previously described, a pair of primers targeting the 5' end of the Cre coding sequence was used to detect specific Cre-coding DNA and mRNA derived from the vector. Fluorescent photographs were taken every day after infection (pi), and fluorescent-positive cells were quantified by flow cytometry 5 days after infection.

[0714] The results of mRNA analysis showed that specific mRNA was detected in cells infected with RAAV as early as 2 hours after infection, peaked at 6 hours after infection, and then declined. In cells infected with traditional AAV vectors, no apparent transcription was detected 2 hours after infection, but a rapid increase in transcribed mRNA was observed from 6 hours to 20 hours after infection, reaching a plateau at 30 hours. In contrast to the results of RAAV vectors, mRNA levels in cells infected with traditional AAV vectors did not decrease after reaching a plateau. The copy number of Cre mRNA in all samples was positively correlated with MOI ( Figures 14A-14B and Figure 15A ). Meanwhile, mGAPDH mRNA was tested as a reference transcript (housekeeping gene), and as expected, there was no difference in mGAPDH mRNA levels among all samples ( Figure 15C ).

[0715] The DNA results were completely different from the mRNA results. Conventional AAV and RAAV vectors had essentially the same DNA copy number pattern, with the majority of the DNA genome detected in infected cells as early as 2 hours post-infection, followed by a slight increase from 2 to 20 hours post-infection, which was very similar to the trend of mRNA levels in cells infected with RAAV. Afterwards, DNA levels plateaued or slowly declined. The copy number of Cre DNA was also positively correlated with the MOI in all samples, but the amount of Cre DNA detected in cells infected with RAAV was much lower (the DNA copy number in the RAAV-CCWM3S MOI=100 or 300 groups was less than that in the AAV-Cre MOI=1 group, and the DNA copy number in the RAAV-CCWM3S MOI=1000 group was less than that in the AAV-Cre MOI=3 group) ( Figure 14C and Figure 15B Similarly, the DNA level of another housekeeping gene, 36B4, was quantified as a reference gene, and as expected, no obvious differences in DNA levels were observed among all samples ( Figure 15D ).

[0716] Successful infection with AAV-Cre or RAAV-CCWM3S vectors will result in the expression of functional Cre recombinase and rescue of tdTomato expression in Ai9-MEF cells, so fluorescent photographs of infected cells were taken and analyzed to assess the infectivity of the viral vector by counting cells emitting tdTomato red fluorescence. The results showed that the number of fluorescent-positive cells generated by RAAV-CCWM3S was comparable to that generated by AAV-Cre with a 10-fold lower MOI ( Figure 14D The lower fluorescence intensity of tdTomato in cells infected with RAAV may be due to the short lifespan of the Cre mRNA delivered therein and the inability of the limited amount of translated Cre recombinase to rescue the two copies of the tdTomato expression cassette in homo-Ai9-MEF cells ( Figure 16 ).

[0717] Comparison of DNA titer and cell counting data indicated that most of the tdTomato red fluorescence signal in RAAV-CCWM3S-infected cells was generated by RAAV particles carrying Cre mRNA.

[0718] In summary, the RAAV vector of the present invention can deliver functional Cre mRNA into cells and express functional Cre recombinase.

[0719] Example 13: RAAV particles transiently transfer functional genes into cells in vitro

[0720] To determine the exact lifespan of Cre protein produced by AAV-Cre or RAAV-CCWM3S delivery as in Example 7, 5×10 4 Ai9-MEF cells were seeded at a confluency of 10 cells / well and then incubated overnight with AAV-Cre (MOI=300) or RAAV-CCWM3S (MOI=10,000) vectors as described above. After infection, cells were harvested at several time points and fluorescent images were taken before cell harvesting.

[0721] For AAV-Cre, Cre expression increased during the first 4 days but then declined. In contrast, a small amount of Cre was detected as early as approximately 24 hours after RAAV-CCWM3S transfer and disappeared after 2 days. This rapid expression and degradation phenomenon may be due to the immediate appearance and short lifespan of the delivered functional Cre mRNA ( Figure 17A and 17B ).

[0722] Example 14: RAAV particles transiently transfer functional genes into Ai9 mice in vivo

[0723] This example demonstrates that RAAV particles can be used as a tool for in vivo gene delivery and transiently express functional Cre recombinase.

[0724] To investigate the infectivity of RAAV...

Claims

1. A Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

2. A polynucleotide encoding a Rep (e.g., Rep78, Rep68, Rep52, Rep40) protein comprising a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

3. A polynucleotide encoding a Rep78 protein, a Rep68 protein, a Rep52 protein, and a Rep40 protein, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein, and the Rep40 protein share a helicase domain comprising amino acid mutations relative to a reference helicase domain (e.g., SEQ ID NO: 186).

4. A helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186).

5. A polynucleotide encoding a helicase comprising a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186).

6. A system for packaging RNA into AAV capsids to produce recombinant RNA-packaged AAV particles (rRAAV particles), wherein the RNA comprises: (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), which is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule that promotes packaging of the RNA into the AAV capsid; The system comprises: (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence; (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186); (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence; (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

7. A method for producing recombinant RNA-packaged AAV particles (rRAAV particles), the method comprising: a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and b) harvesting the rRAAV particles or populations thereof; wherein the RNA comprises: (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), which is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule that promotes packaging of the RNA into the AAV capsid; The system comprises: (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence; (2) one or more Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or polynucleotides comprising such coding sequences, wherein the one or more Rep proteins comprise a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186); (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence; (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

8. Use of a Rep protein (e.g., Rep78, Rep68, Rep52, Rep40) or a polynucleotide encoding the Rep protein in producing recombinant RNA-packaged AAV particles (rRAAV particles), wherein the Rep protein comprises a helicase domain comprising an amino acid mutation relative to a reference helicase domain (e.g., SEQ ID NO: 186), the production comprising: a) culturing cells comprising a system for packaging RNA into AAV capsids for a sufficient period of time to produce said recombinant RNA-packaged AAV particles (rRAAV particles), and b) harvesting the rRAAV particles or populations thereof; wherein the RNA comprises: (a) an RNA sequence of interest (RSI), e.g., an RNA sequence encoding a protein of interest, and (b) an RNA packaging signal (RPS), which is capable of interacting, e.g., directly or indirectly binding, with an RPS interacting molecule that promotes packaging of the RNA into the AAV capsid; The system comprises: (1) one or more capsid proteins (e.g., VP1, VP2, and / or VP3) for assembling the AAV capsid, or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence; (2) one or more of the Rep proteins (e.g., Rep78, Rep68, Rep52, Rep40), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence; (3) the RPS interacting molecule, or its coding sequence, or a polynucleotide comprising the coding sequence; (4) the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA; and (5) Optionally, one or more auxiliary proteins required for AAV packaging (e.g., auxiliary proteins from adenovirus E2a, E4 and / or VA genes), or one or more coding sequences thereof, or a polynucleotide comprising the coding sequence.

9. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation results in an increase in the RNA unwinding properties and / or a decrease in the DNA unwinding properties of the helicase or the Rep protein comprising the amino acid mutation.

10. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation results in increased RNA packaging efficiency and / or decreased DNA packaging efficiency.

11. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase domain is a helicase domain of a reference helicase, eg, a wild-type helicase.

12. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase is a superfamily 3 (SF3) helicase.

13. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase is a helicase capable of unwinding DNA.

14. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase is a superfamily 3 (SF3) helicase capable of unwinding DNA.

15. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase domain is the helicase domain of a reference Rep protein, eg, a wild-type Rep protein.

16. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference Rep protein is a reference Rep78 protein, a reference Rep68 protein, a reference Rep52 protein, or a reference Rep40 protein.

17. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase domain is a reference helicase domain shared by a reference Rep78 protein, a reference Rep68 protein, a reference Rep52 protein, and a reference Rep40 protein of the same AAV virus.

18. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference Rep protein, the reference Rep78 protein, the reference Rep68 protein, the reference Rep52 protein, and the reference Rep40 protein are from a wild-type AAV virus.

19. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the wild-type AAV virus has a serotype selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, AAV-DJ, AAV.PHP.eB, Anc80L65, Anc80L65AAP, and 7m8.

20. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase domain (e.g., SEQ ID NO: 186) comprises, from N-terminus to C-terminus, motif A, motif B, motif B', motif C, and an arginine finger (R finger).

21. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference Rep78 protein comprises, consists essentially of, or consists of: an amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of any one of SEQ ID NOs: 88-109; wherein the reference Rep68 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 284, or the amino acid sequence of SEQ ID NO:

285. NO:89-109; wherein the reference Rep52 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:285, or the corresponding amino acid sequence contained in any one of SEQ ID NO:89-109; or wherein the reference Rep40 protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:286, or the corresponding amino acid sequence contained in any one of SEQ ID NO:89-109.

22. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the reference helicase domain comprises, consists essentially of, or consists of: An amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of any one of SEQ ID NOs: 186-207.

23. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation is at a position corresponding to one or more of position 308 to position 463, optionally position 325 to position 461, of the amino acid sequence of any one of SEQ ID NOs: 186-207, wherein the positions are numbered according to SEQ ID NO:

88.

24. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation is at a position corresponding to a conserved amino acid position in at least 80%, at least 90%, or 100% of Rep proteins of ssDNA viruses (e.g., a position corresponding to A344 of SEQ ID NO: 88).

25. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation is located at a position corresponding to a position in one or more of motif A, motif B, motif B', motif C of the reference helicase domain; an upstream region that is no more than about 30, 25, 20, 15, 10, or 5 amino acids from the N-terminus of any of motif A, motif B, motif B', motif C, and the arginine finger (R finger) of the reference helicase domain; and a downstream region that is no more than about 30, 25, 20, 15, 10, or 5 amino acids from the C-terminus of any of motif A, motif B, motif B', motif C, and the arginine finger (R finger) of the reference helicase domain.

26. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep78 protein comprising the amino acid mutation comprises, consists essentially of, or consists of: An amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9%) and less than 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 88-109.

27. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the helicase domain comprising the amino acid mutation comprises, consists essentially of, or consists of: An amino acid sequence having at least about 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9%) and less than 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 186-207.

28. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation comprises a mutation at a position corresponding to G325, R327, W331, A336, T337, 1343, A344, D371, K372, M373, 1375, E378, C405, T419, S420, T422, C425, Q442, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458, and / or V461 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO:

88.

29. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation comprises a mutation at a position corresponding to A336, T337, I343, A344, K372, E378, D443, M445, K447, E449, L450, T451, L454, D455, H456, D457, F458, and / or V461 of the amino acid sequence of SEQ ID NO: 186, wherein the positions are numbered according to SEQ ID NO:

88.

30. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of G325P, G325I, K326E, K326R, R327P, N328V, W331I, F333H, F333Y, F333K, P335S, A336P, A336S, A336R, T337G, T338G, T341S, N342I, I343T, I343A, I343L , A344T, A344V, A344S, E345N, A346F, H349K, P352T, P365Y, N367D, D368G, C369Y, V370K, D371Q, D371G, D371N, K372 Q. K372E, K372N, M373S, M373E, M373A, I375V, W376I, W377M, E378D, E379D, G380L, G380F, C405H, K406R, T419S, T419 F. T419I, T419L, S420A, S420M, S420C, N421T, N421S, T422H, T422S, M424N, C425I, Q442K, Q442F, Q442H, Q442R, Q44 2L, Q442V, D443S, D443R, D443Y, D443N, D443A, M445I, M445R, M445F, F446R, F446I, K447F, K447N, K447H, K447P, K44 7T, K447A, E449D, E449I, E449R, L450M, L450I, L450V, T451D, T451I, T451E, T451K, T451N, L454F, L454V, D455F, D455K, D455H, D455Y, D455T, D455M, H456F, H456D, H456S, D457E, D457S, D457F, F458Y, F458K, V461L, and combinations thereof, wherein the positions are numbered according to SEQ ID NO:

88.

31. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of G325P, R327P, W331I, A336P, A336S, A336R, T337G, I343T, I343A, I343L, A344T, A344V, D371Q, K372Q, K372E, K372N, M373S, I375V, E378D, C405H, T419S, S420A, T 747F, K447N, K447T, E449D, L450M, L450I, L450V, T451D, T451E, L454F, D455F, D455Y, D455T, D455M, H456D, H456S, D457E, D457S, D457F, F458Y, V461L, and combinations thereof, wherein the positions are numbered according to SEQ ID NO:

88.

32. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutation comprises a substitution corresponding to a substitution selected from the group consisting of A336P, T337G, I343T, A344T, A344V, K372Q, E378D, D443S, M445I, K447F, E449D, L450M, T451D, L454F, D455F, D455T, H456D, D457E, F458Y, V461L, and combinations thereof, wherein the positions are numbered according to SEQ ID NO:

88.

33. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutations comprise or consist of a combinatorial substitution corresponding to a combinatorial substitution selected from: A336P+T337G, K372Q+E378D, D443S+M445I, D443S+L454F+D455F, K447F+E449D+T451D, K447F+L45 0M, K447F+F458Y, K447F+H456D+F458Y, K447F+V461L, E449D+L450M, L450M+T451D, L454F+D455F, D455T+H456D+D457E+F458Y, H456D+D457E+F458Y, F458Y+V461L, A344T+K372Q, A336P+A344T+K447F, A336P+A344V+K447F, I343T+K44 7F, I343T+L450M, A344T+K447F, A344V+K447F, A344T+L450M, A344V+L450M, A344T+K447F+E449D+T451D, K372Q+K447F, K372Q+L450M, K372Q+K447F+E449D+T451D, K372Q+V461L, E378D+K447F, E378D+L450M, E378D+K447F+E449D+T451D, A344T+K372Q+K447F, A344V+K372Q+K447F, and combinations thereof, wherein the positions are numbered according to SEQ ID NO:

88.

34. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the amino acid mutations comprise or consist of a combined substitution corresponding to a combined substitution of A344V and K447F, wherein the positions are numbered according to SEQ ID NO:

88.

35. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the helicase domain comprising the amino acid mutation comprises, consists essentially of, or consists of: The amino acid sequence of SEQ ID NO:

287.

36. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep protein comprising the amino acid mutation comprises, consists essentially of, or consists of: The amino acid sequence of SEQ ID NO:

288.

37. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep protein comprises a mutation, e.g., in the native binding domain (OBD) of the Rep protein, that partially or substantially abolishes the endonuclease activity of the Rep protein, optionally comprising or consisting of a mutation corresponding to: Y1 56F mutation, K146A+D149A+E150A mutations (KDE-mu) or E83A+K84A+E86A mutations (EKE-mu), wherein the positions are numbered according to SEQ ID NO:

88.

38. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep protein comprises a combinatorial substitution comprising or consisting of: Y156F, A344V and K447F, wherein the positions are numbered according to SEQ ID NO:

88.

39. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep protein comprises the amino acid sequence of SEQ ID NO:

289.

40. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RPS interacting molecule is the Rep protein.

41. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RPS interacting molecule comprises an RPS binding protein (RPSBP) capable of binding directly or indirectly to the RNA packaging signal (RPS).

42. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the Rep protein is fused to the RPSBP (eg, N-terminally, C-terminally, internally), optionally via a peptide linker.

43. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RPS is located at or near the 5' end of the RSI, at or near the 3' end of the RSI, or internally of the RSI.

44. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RNA comprises one, two, or three copies of the RPS.

45. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RPS comprises an MS2 sequence (e.g., SEQ ID NO: 54), a PP7 binding site (e.g., SEQ ID NO: 56), and / or a Com binding site (e.g., SEQ ID NO: 58).

46. ​​The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein (a) the RPS comprises an MS2 sequence (e.g., SEQ ID NO: 54) and the RPSBP comprises a bacteriophage-derived MS2 coat protein (MCP) (e.g., SEQ ID NO: 49); (b) the RPS comprises a PP7 binding site (e.g., SEQ ID NO: 56) and the RPSBP comprises a PP7 bacteriophage coat protein (PCP) (e.g., SEQ ID NO: 51), or (c) the RPS comprises a Com binding site (e.g., SEQ ID NO: 58) and the RPSBP comprises a bacteriophage COM protein (COM) (e.g., SEQ ID NO: 53).

47. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RNA, or its coding sequence, or a polynucleotide comprising the coding sequence, such as a transgenic vector comprising or encoding the RNA, lacks a functional DNA packaging signal, such as an AAV ITR (e.g., a 5' AAV2 ITR and / or a 3' AAV2 ITR) or its coding sequence.

48. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RNA is transcribed from a polynucleotide (e.g., a transgenic plasmid) that lacks a functional DNA packaging signal or its coding sequence, such as an AAV ITR (e.g., a 5' AAV2 ITR and / or a 3' AAV2 ITR).

49. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the AAV capsid comprises a capsid from an AAV having a serotype selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, AAV-DJ, AAV.PHP.eB, Anc80L65, Anc80L65AAP, and 7m8.

50. The Rep protein, helicase, polynucleotide, system, method, or use of any preceding claim, wherein the RNA is not associated with the AAV capsid.

51. A vector comprising the polynucleotide of any preceding claim; optionally, wherein the vector is a plasmid.

52. An (isolated) (host) cell comprising the Rep protein, helicase, polynucleotide, system or vector of any preceding claim.

53. A recombinant RNA-packaged AAV particle (rRAAV particle) or a population thereof produced by the method of any preceding claim.

Images