Yeast strain development for ethanol production

Abstract

Disclosed herein are yeast strains and derivatives thereof, as well as compositions for use in ethanol production comprising the yeast strains. The present disclosure also relates to methods of producing ethanol from biomass using the yeast strains and compositions. In particular, the yeast strains produce less glycerol and more ethanol and have higher temperature tolerance and higher fermentation rates compared to strains and products currently used in ethanol production processes.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 421,115, filed on October 31, 2022, the entire contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] In accordance with 37 CFR §1.821, this application submits a sequence listing XML in ST.26 XML format. The sequence listing XML file "211879-0001-WO01.xml" filed at the USPTO Patent Center was created on October 31, 2023, contains 4 sequences, has a file size of 4.51 kilobytes, and is incorporated into this specification by reference in its entirety. Technical Field

[0005] The present disclosure relates to non-naturally occurring yeast strains and derivatives thereof, as well as compositions comprising the yeast strains, for use in ethanol production. The present disclosure also relates to methods for producing ethanol from biomass using the yeast strains and compositions. Specifically, the yeast strains produce more ethanol and less glycerol, exhibit higher fructose utilization, and exhibit higher temperature and organic acid tolerance and higher fermentation rates compared to strains and products currently used in ethanol production processes. Background Art

[0006] Ethanol can be produced from biological organisms using different biochemical pathways inherent to the organism. Ethanol produced by biological organisms is called bioethanol and is therefore distinguished from ethanol produced by purely chemical methods. Bioethanol is commercially produced and can be used as a liquid fuel in internal combustion engines (fuel ethanol), as an ingredient in industrial products (industrial ethanol), or as a component in alcoholic beverages (potable ethanol).

[0007] Biological organisms such as yeast produce bioethanol from various biomasses, including sucrose, also known as granulated sugar. Selected yeast is beneficial for ethanol production from sucrose, making it possible to optimize production processes and profitability. In biomass containing sucrose (a dimer of glucose and fructose), yeast cells utilize enzymes located on the outer cell wall to hydrolyze sucrose into glucose and fructose, and both glucose and fructose can be converted into ethanol by the yeast. For yeasts such as Saccharomyces cerevisiae, glucose is preferred over fructose, and cells preferentially use glucose, leaving high concentrations of fructose outside the cells. Yeast is generally unable to utilize the fructose remaining outside the cells, which represents a loss of potential ethanol produced by the yeast from sucrose. High ethanol concentrations exacerbate the limited utilization of fructose by yeast. It is desirable to have a Saccharomyces cerevisiae yeast that can effectively utilize fructose during fermentation.

[0008] The byproducts (such as glycerol) that yeast forms during fermentation use sugar as substrate, and therefore can reduce the potential ethanol yield of sugar source.Glycerol is a kind of important metabolite, has protective effect to various types of stress, and is important to maintaining intracellular redox balance under anaerobic fermentation conditions.The glycerol production of different strains of Saccharomyces cerevisiae varies greatly.It is particularly useful to use yeast with relatively low glycerol production, which keeps good stress protection at the same time, to ferment.Especially, it is necessary to show high ethanol-glycerol ratio so that yeast with maximized ethanol produced by sugar.

[0009] During fermentation, yeast encounters various environmental and environmental conditions that limit its ability to produce ethanol, such as the presence of inhibitors such as organic acids. The concentration of organic acids during fermentation varies depending on contamination of the fermentation vessel with organic acid-producing microbial contaminants and on contamination of the feedstock. Due to the production of carbon dioxide and carbonic acid, the pH decreases during fermentation, increasing the toxicity of organic acids to yeast. At low pH, organic acids become protonated and enter the yeast cells, acidifying the interior of the cells. Therefore, there is a need for yeast that can tolerate high organic acid conditions and low pH during fermentation.

[0010] The metabolic activity of yeast during fermentation generates heat, which increases the temperature of the fermentation medium. High temperatures during fermentation are detrimental to the production of ethanol. In industrial ethanol fermentation, the fermentation vessel must be cooled to maintain the optimal temperature range for the yeast to ferment the ethanol. Cooling the fermentation vessel adds a lot of cost to the fermentation process, especially in factories located in high-temperature and high-humidity areas such as tropical and subtropical regions. In geographical areas with high humidity and temperature, ethanol factories have difficulty cooling the fermentation vessel using cooling systems based on evaporative cooling, which reduces the efficiency of fermentation to ethanol and reduces ethanol productivity. Therefore, there is a need for yeast that can withstand high fermentation temperatures during fermentation.

[0011] Yeast used in products for the commercial production of ethanol requires several characteristics, including adequate ethanol metabolic yield, adequate ethanol tolerance, acceptable by-product yields, adequate fermentation kinetics, the ability to consume fructose, organic acid tolerance, and temperature tolerance during fermentation. Yeasts of the genus Saccharomyces exhibit some, but not all, of the characteristics required for commercial ethanol production. Commercial yeast products containing Saccharomyces include: Ethanol Angel Super 46EDV CN PE-2(Fermentec), CAT-1(Fermentec) and M(AB Although commercial yeast strains and products have favorable properties for ethanol production, there is a growing need to improve ethanol production efficiency to reduce production costs.

[0012] By selecting between yeasts that exhibit genetic and phenotypic diversity, ethanol production efficiency can be improved. The phenotype or traits of a particular yeast strain can be altered by changes in the yeast strain's genetic material or genome. Changes in the yeast genome can be achieved in several ways known in the art. One way to alter the genome and phenotype of a yeast strain is to subject the yeast to directed evolution to produce a non-naturally occurring yeast strain. Directed evolution utilizes naturally occurring mutations in the yeast's genetic material (DNA) or genome, which occur spontaneously in all organisms (including yeasts such as Saccharomyces cerevisiae). By selecting yeast for desired beneficial phenotypes caused by spontaneous, random mutations in the yeast DNA, evolved yeast strains that would not otherwise be found in nature are produced. The genome of the evolved strain is different from the original strain before undergoing directed evolution. The difference can be discovered by sequencing the yeast genome.

[0013] Naturally occurring mutations in the genome can be increased by treating yeast cells with a mutagen, a chemical or physical agent that induces DNA mutations. Such mutagens include, but are not limited to, ultraviolet light, X-rays, and ethyl methanesulfonate. After treating yeast with a mutagen, beneficial traits resulting from mutations in the yeast genome can be selected for directed evolution. Mutagenizing yeast and then selecting for beneficial traits can generate additional diversity in the yeast, from which traits beneficial for ethanol production can be obtained. The resulting yeast strains are genetically distinct from the original strains before mutagenesis and are non-naturally occurring yeast strains not found in nature.

[0014] The sexual reproduction of yeast (including Saccharomyces cerevisiae) can further increase the genome and phenotypic diversity of yeast. In the sexual reproduction of yeast, a single diploid yeast cell undergoes meiosis and produces genetically different haploid spores. The haploid spores produced by a single parent diploid yeast cell mate or self-hybridize, and the diploid offspring produced are genetically different from the parent cell (original diploid cell) and are not originally found in nature. More advantageously, haploid spores from different parent cells that show different characteristics can mate to form genetically different offspring. Spore mating (called directed mating) from two parents can result in offspring with increased genome diversity. More advantageously, spores from 3 or more parent cells can mate randomly in a process called group mating. Group mating produces many offspring, and these offspring are all genetically different from the parent strain. Therefore, the sexual proliferation carried out by self-hybridization, directed mating or group mating in yeast increases the available genome and phenotypic diversity, and can obtain the favorable characteristics for ethanol production therefrom. Yeast strains derived from sexual reproduction are not originally found in nature.

[0015] The genetic diversity of yeast strains produced by spontaneous mutation, artificial mutagenesis and sexual propagation can be assessed in a variety of ways. These include but are not limited to genetic marker analysis, polymerase chain reaction (PCR) amplification of microsatellite DNA, next generation sequencing technology or its combination. Microsatellite DNA is a genetic locus composed of tandem repeats of 1 to 6 bases. Some microsatellite DNA sites have a high degree of allelic polymorphism, and therefore can be used as a genetic marker for strain diversity in the assessment yeast. The PCR detection designed to detect this type of polymorphism can provide a way to quickly distinguish bacterial strains and assess their genotype. Another more advantageous method for investigating the genetic diversity of yeast strains is through full genome sequencing, which can provide information about single nucleotide polymorphisms and structural variations (such as genome insertions or deletions). In a word, these methods can be used to assess the genetic diversity of yeast strains obtained by directed evolution, mutagenesis and sexual propagation.

[0016] Therefore, there is a need for new and improved yeast strains from which new and improved yeast products are produced. Improved yeast strains and products need to be able to increase the efficiency of commercial ethanol production by providing higher sugar-to-ethanol conversion, higher temperature tolerance, higher tolerance to fermentation inhibitors, and faster fermentation kinetics compared to currently commercially used yeast strains and products. There is also a need to increase the genomic and phenotypic diversity of yeast strains through mutation or sexual propagation to increase the number of yeasts that exhibit improved traits. Summary of the Invention

[0017] In one aspect, the present disclosure relates to a non-naturally occurring Saccharomyces yeast strain selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184; and (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185.

[0018] In another aspect, the present disclosure relates to a derivative of a non-naturally occurring Saccharomyces yeast strain selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184; and (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185.

[0019] In one embodiment, the yeast strain or the derivative comprises one or more defining characteristics selected from the group consisting of: (a) a higher ethanol yield compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization efficiency compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions. In another embodiment, after 48 hours of fermentation, the yeast strain or the derivative has an ethanol yield that is at least about 3.3% higher than that of Saccharomyces cerevisiae strain Y1027. In another embodiment, after 48 hours of fermentation, the yeast strain or the derivative has a fructose utilization efficiency that is at least about 5% higher than that of Saccharomyces cerevisiae strain Y1027. In another embodiment, after 48 hours of fermentation, the yeast strain or derivative has an ethanol to glycerol ratio that is at least about 11% higher than that of Saccharomyces cerevisiae strain Y1027. In another embodiment, after 24 hours of fermentation, the yeast strain or derivative has a fermentation rate that is at least about 1.5% higher than that of Saccharomyces cerevisiae strain Y1027. In another embodiment, the yeast strain or derivative has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature in the range of 33°C to 38°C. In another embodiment, the fermentation temperature is 33°C. In another embodiment, the fermentation temperature is 38°C. In another embodiment, the yeast strain or derivative has a higher organic acid tolerance than Saccharomyces cerevisiae strain Y1027 when the fermentation pH is reduced from about 4.9 to about 4.0 in the presence of increasing amounts of organic acids in the fermentation medium. In another embodiment, the organic acids in the fermentation medium include 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. In another embodiment, the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

[0020] Another aspect of the present disclosure provides a method for producing a derivative of a Saccharomyces yeast strain as described herein, the method comprising: (1) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain belongs to the genus Saccharomyces sensu stricto. stricto) evolutionary branch; (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain; and (e) screening or selecting derivative strains; or (2) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087 and derivatives thereof; and (ii) one or more additional yeast strains belonging to the Saccharomyces stricto) evolutionary branch; (b) inducing sporulation of the first yeast strain and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow the spores to hybridize; and (d) screening or selecting derivative strains. In one embodiment, step (1)(c) comprises screening or selecting spores for spores that exhibit one or more defined characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or derivatives thereof; and step (1)(e) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or derivatives thereof. In another embodiment, step (2)(d) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strains Y2083, Y2084, Y2086, or Y2087.

[0021] Another aspect of the present disclosure provides a yeast strain as described herein or a mutant yeast of a derivative as described herein.

[0022] Another aspect of the present disclosure provides a method for producing a mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen. In one embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

[0023] Another aspect of the present disclosure provides a method for producing a mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the derivative with a mutagen. In one embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170) or nitrogen mustard.

[0024] Another aspect of the present disclosure provides an evolved yeast of a yeast strain as described herein or a derivative as described herein.

[0025] Another aspect of the present disclosure provides a method of producing an evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the yeast strain.

[0026] Another aspect of the present disclosure provides a method of producing an evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the derivatives.

[0027] Another aspect of the present disclosure provides a genetically modified yeast of a yeast strain as described herein or a derivative as described herein. In one embodiment, gene editing is used to alter the nucleic acid sequence of the genetically modified yeast.

[0028] Another aspect of the present disclosure provides a recombinant yeast of a yeast strain as described herein or a derivative as described herein. In one embodiment, the recombinant yeast comprises a modification that inhibits gene expression, enhances gene expression, introduces a gene, or deletes a gene.

[0029] Another aspect of the present disclosure provides a method for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185, or a derivative thereof. In one embodiment, the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the yeast comprises one or more defining characteristics selected from the group consisting of: (a) a higher ethanol yield compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization efficiency compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) an increased tolerance to organic acids compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature in the range of 33°C to 38°C. In another embodiment, the fermentation temperature is 33°C. In another embodiment, the fermentation temperature is 38°C. In another embodiment, the yeast has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 when the pH is reduced from about 4.9 to about 4.0 in the presence of increased organic acids in the fermentation medium. In another embodiment, the organic acids in the fermentation medium include 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. In another embodiment, the organic acids in the fermentation medium include 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, ethanol is produced using starch. In another embodiment, ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation. In another embodiment, ethanol is produced using sugar. In another embodiment, ethanol is produced using batch fermentation or continuous fermentation. In another embodiment, ethanol is produced using lignocellulosic sugars.In another embodiment, simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0030] Another aspect of the present disclosure provides a composition comprising a yeast strain as described herein or a derivative as described herein, and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protective agents, and antioxidants. In one embodiment, the composition includes one or more defining characteristics selected from the following: (a) a higher ethanol yield compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) an improved temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) a higher fructose utilization rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) an improved organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) an improved fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 at 33°C to 38°C. In another embodiment, the temperature is 33°C. In another embodiment, the temperature is 38°C. In another embodiment, the yeast has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 when the pH is reduced from about 4.9 to about 4.0 in the presence of increased organic acids. In another embodiment, the organic acids include 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. In another embodiment, the organic acids include 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2. Another aspect of the present disclosure provides a method for producing ethanol from biomass by contacting biomass with a composition as described herein. In one embodiment, ethanol is used for fuel ethanol, industrial ethanol, drinking ethanol, or a combination thereof. In another embodiment, ethanol is produced using starch. In another embodiment, ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation. In another embodiment, ethanol is produced using sugar. In another embodiment, ethanol is produced using batch fermentation or continuous fermentation. In another embodiment, ethanol is produced using lignocellulosic sugars. In another embodiment, simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0031] Another aspect of the present disclosure provides a method for producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185, or a derivative thereof. In one embodiment, the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the fermentation product is ethanol. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.In another embodiment, the fermentation product is produced using batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF).

[0032] The present disclosure provides other aspects and embodiments that will become apparent from the following detailed description and accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figures 1A to 1D is a schematic diagram illustrating a method for preparing a new yeast strain. Figure 1A is a schematic diagram illustrating directed mating. Figure 1B is a schematic diagram illustrating group mating. Figure 1C is a schematic diagram showing the directed evolution of yeast strains. Figure 1D is a schematic diagram showing mutagenesis of yeast strains.

[0034] Figures 2A to 2E is a graph showing the fermentation results of yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086 and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing the ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate defined as mass loss at 24 hours of fermentation.

[0035] Figures 3A to 3E is a graph showing the fermentation results of yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086 and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing the ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate defined as mass loss at 24 hours of fermentation.

[0036] Figures 4A to 4E is a graph showing the fermentation results of yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086 and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing the ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate defined as mass loss at 24 hours of fermentation.

[0037] Figures 5A to 5E is a graph showing the fermentation results of yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086 and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing the ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate defined as mass loss at 24 hours of fermentation.

[0038] Figure 6This is a gel image generated by QIAxcel ScreenGel 1.6.0 software, which captures the capillary electrophoresis results of PCR amplification products of microsatellite DNA at the YPL009C and YOR267C loci. The order of loading is as follows: 1) Y2083; 2) Y2084; 3) Y2086; 4) Y2087; 5) Y1027; 6) Indian Yeast Company HRC3; 7) Zillo Lorenzetti Group BG1; 8) Mauri Brasil Industria Ltd C7; 9) Fleischmann's LTU-26; 10) Fermentec Brasil PE-2; 11) Fermentec Brasil CAT-1; 12) Lallemand EDV46; 13) Fermentis Ethanol Red; 14) Radico Indian Molasses strain; 15) Nature Biochem Y-Max isolate C1; 16) Angel Super Alcohol; 17) Novozymes Innova Fit; 18) Rymco Pty Ltd (anchor yeast) Thermosacc XL; 19) No Template Control; 20) Salmon DNA (20 ng). Fragment size determination was performed using QX DNA Size Marker 100 bp–2.5 kb (Qiagen Catalog No. 929559) and QX Alignment Marker 15 bp / 5 kb (Qiagen Catalog No. 929524).

[0039] 7A to 7B is a heat map comparing nucleotide matches between strains; Figure 7A is a heat map of the percentage of identical nucleotide matches for each strain relative to Y1027 for 56 open reading frame (ORF) sequences; Figure 7B is a heat map of the percentage of identical nucleotide matches for Y2083 relative to Y2084 for 16 additional ORF sequences. DETAILED DESCRIPTION

[0040] Described herein are fermenting organisms comprising defining characteristics including the ability to ferment under identical fermentation conditions relative to, for example, The current industry standard yeast used in yeast products such as M has higher ethanol yields, higher fructose utilization, higher temperature and inhibitor tolerance, and higher fermentation rates. The present disclosure relates to methods for producing yeast products from yeast strains. The present disclosure also relates to improved methods for producing ethanol from different fermentable biomass materials using the fermenting organisms described herein.

[0041] 1. Definition

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. In the event of a conflict, this document (including definitions) shall prevail. Preferred methods and materials are described below, but methods and materials similar or equivalent to the methods and materials described herein can be used for the practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods and embodiments disclosed herein are illustrative only and are not intended to be restrictive.

[0043] As used herein, the terms "comprises," "comprising," "having," "having," "can of," "containing," and variations thereof are intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. Unless the context clearly dictates otherwise, the singular forms "a," "an," and "the" include the plural forms. The present disclosure also contemplates additional embodiments that "comprise," "consist of," and "consist essentially of" the embodiments or other embodiments presented herein, whether explicitly stated or not.

[0044] For the recitation of numerical ranges herein, each intervening number therebetween is expressly contemplated with equal precision. For example, for the range of 6-9, in addition to 6 and 9, the numbers 7 and 8 are also contemplated; for the range of 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated; and for the range of 1 to 5, in addition to 1 and 5, the numbers 2, 3, and 4 are also contemplated. As used herein, the terms "about" or "approximately" when applied to one or more values ​​of interest refer to values ​​that are similar to a stated reference value or that are within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as limitations of the measurement system. In some aspects, the term "about" refers to a numerical range that falls within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of a specified reference value in either direction (greater than or less than), unless otherwise stated or otherwise apparent from the context (unless such number would exceed 100% of the possible value). Alternatively, "about" can mean within 3 or more than 3 standard deviations according to the practice in the art. Alternatively, such as with respect to a biological system or process, the term "about" can mean within the order of magnitude of a value, preferably within 5 times, more preferably within 2 times.

[0045] As used herein, the term "biomass" refers to any plant-derived organic matter that can become a carbohydrate source after conversion. Preferably, biomass can be derived from agricultural or food processing products and / or by-products. In particular, biomass can be rich in sucrose or starch and is selected from or derived from, for example, sorghum, sugarcane, beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a mixture thereof.

[0046] As used herein, "DNA combination" between yeast strains refers to the combination of all or part of the genome of a yeast strain. DNA combination between yeast strains can be performed by any method suitable for combining the DNA of at least two yeast cells, and can include, for example, mating methods that include sporulation of yeast strains to produce haploid cells, and subsequent hybridization or mating of compatible haploid cells; cell induction; or cell fusion, such as protoplast fusion.

[0047] As used herein, a "derivative" is a yeast strain derived from a yeast strain disclosed herein (e.g., Saccharomyces or Saccharomyces sensu stricto clade), including by sporulation, hybridization, mutagenesis, recombinant DNA technology, genome editing technology, mating, cell fusion, or cell induction between yeast strains. A derivative strain can be a direct descendant (i.e., the product of mating a strain of the present invention with another strain or itself).

[0048] As used herein, "ethanol yield from glucose" is the ethanol yield that would be obtained from glucose alone or in combination with other fermentable sugars present in the biomass (expressed as "glucose equivalents"). In one embodiment, the ethanol yield from glucose is represented by the statement: one molecule of glucose produces two molecules of ethanol and two molecules of carbon dioxide. In another embodiment, the ethanol yield from glucose is represented by the chemical formula: CH 12 O6→2C2H5OH+2CO2, where C6H 12 O6 is the chemical formula for glucose and fructose, C2H5OH is the chemical formula for ethanol, and CO2 is the chemical formula for carbon dioxide. In another embodiment, the ethanol yield of glucose is expressed on a mass basis, where 1.0 gram of glucose or fructose produces 0.511 grams of ethanol and 0.489 grams of carbon dioxide. The maximum ethanol yield of glucose or fructose is two molecules of ethanol from one molecule of glucose or fructose. The maximum ethanol yield on a mass basis is 0.511 grams of ethanol from 1 gram of glucose or fructose.

[0049] As used herein, the term "glucose equivalent" refers to the mass of a fermentable molecule other than glucose expressed as the equivalent mass of glucose. For example, 1.0 gram of sucrose is equivalent to 1.053 grams of glucose, and 1 gram of ethanol is equivalent to 1.955 grams of glucose.

[0050] When discussing yeast strains, the term "control" can be used in conjunction with "Y1027" or " M strain" are used interchangeably, and when discussing yeast products, the term "control" can be used interchangeably with "Y1027" or " M" are used interchangeably. Strain Y1027 is used to manufacture yeast products M. M can be manufactured as active dry yeast products, crushed yeast products, and liquid yeast products for fermenting substrates into fuel ethanol, industrial ethanol, and potable ethanol. M is particularly suitable for the fermentation of sucrose, glucose and fructose sugars released from biomass containing these sugars and for the fermentation of sugars released from starch-containing biomass after the sugars have been released by the action of enzymes or chemical processes. M can be used for batch, continuous, and simultaneous saccharification and fermentation (SSF) fermentations of starch substrates. It has high tolerance to released glucose, moderate tolerance to ethanol and temperature, and moderate tolerance to organic acids. It rehydrates well in direct-dose applications and can be used in combination with glucoamylase and alpha-amylase enzyme systems. M has optimal performance in the pH range of 4.0 to 5.0, but ferments well in the pH range of 3.5 to 6.0. The optimal fermentation temperature for M depends on the stresses present (eg, organic acids, ethanol, and pH), but generally ferments well within a temperature range of about 32°C to 34°C. M can be obtained from AB Purchased.

[0051] The term "fermentation medium" refers to the environment in which fermentation is carried out using a fermenting organism, and includes a fermentable substrate, i.e., a carbohydrate source (e.g., sucrose, glucose, or fructose) that can be metabolized by the fermenting organism into a desired fermentation product (e.g., ethanol). The fermentation medium may include fermentation nutrients for the fermenting organism. Fermentation nutrients are widely used in the field of fermentation and include nitrogen sources (e.g., ammonia, urea), vitamins, minerals, or combinations thereof. A "feed supplement" is a fermentation medium; however, a feed supplement may have a different composition than the fermentation medium.

[0052] As used herein, "high-yield ethanol production" refers to ethanol production by fermentation in which the ethanol yield approaches the theoretical ethanol yield from glucose or other fermentable sugars. Where the sugar substrate comprises or consists of sucrose, fructose, and glucose, high-yield ethanol production requires the ability to utilize fructose. High-yield ethanol production requires limited formation of by-products such as glycerol, as well as yeast growth during fermentation.

[0053] As used herein, the terms "increase," "enhance," "enhance," or "greater" refer to an enhancement or improvement of a particular characteristic or trait compared to other similar organisms, a control, or a wild-type organism. Typically, this is a fermentation-related advantageous trait.

[0054] The term "inoculum" refers to an amount of microorganisms added to the main fermenter in order to start the fermentation process. In the case of a fermentation process using a seed fermenter, the inoculum is usually a preculture in an amount corresponding to 5% to 20% of the volume of the main fermenter.

[0055] The term "isolated" refers to a substance that is in a form or environment that is not found in nature. Non-limiting examples of isolated substances include: (1) any non-naturally occurring substance; (2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor, that is at least partially removed from one or more or all of the naturally occurring components with which it is associated in nature; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in yeast; multiple copies of the gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). In particular, the isolated substance can be an isolated yeast cell, a yeast culture, or a yeast product containing live yeast (e.g., active dry yeast). The isolated substance can be present in a fermentation broth sample; for example, the yeast can be genetically modified to express a specific polypeptide. The fermentation broth from the yeast will contain the isolated polypeptide.

[0056] As used herein, the term "low pH" refers to a pH of about 2.5 to about 4.5. Low pH is preferably less than about 4.5. As used herein, the term "normal pH" refers to a pH of about 4.0 to about 6.0. Normal pH is preferably about 5.0.

[0057] As used herein, the term "main fermentor" is used for the final fermentor used in a fermentation process to produce a fermentation product, wherein the desired fermentation product is produced.

[0058] The term "parental" or "parent" strain refers to the yeast strain from which the derivative strain is derived. In some embodiments, a derivative can also be a parent.

[0059] The term "pre-culture" is understood to be a liquid actively growing culture of a microorganism (i.e., yeast) for inoculating a main fermenter. Active growth refers to a stage in which the culture is in which the microorganism increases its cell number. Pre-culture is typically used as inoculation material to avoid or reduce the lag phase in the main fermenter. During fermentation to produce ethanol, the cells in the pre-fermenter are typically regulated. This concept is not intended to produce yeast biomass, as the carbon in the biomass reduces the carbon that is converted into ethanol. Fermentative growth occurs, but it is not desirable to promote aerobic growth (e.g., using a seed fermenter). Alternatively, yeast can be added directly to the main fermenter by "direct dosing."

[0060] As used herein, the terms "properties" and "defined characteristics" of the S. cerevisiae strains detailed herein include at least the differences in properties of the strains compared to a control (i.e., M or Y1027). Other "properties" and "defining characteristics" include, among others, increased temperature tolerance, increased fermentation rate, increased organic acid tolerance, increased ethanol yield, and decreased glycerol yield. The fermenting organisms described herein, for example, the fermenting organisms used in the methods described herein, can have one or more of the above-mentioned "properties" and "defining characteristics."

[0061] The term "prefermenter" refers to a fermenter in which a preculture is formed by fermenting microorganisms until the yeast is activated and conditioned for inoculation into the main fermenter. When a prefermenter is not used, "direct addition" is used.

[0062] As used herein, a "substrate" is a molecule that can be metabolized directly or indirectly to ethanol by fermentation by yeast, or any yeast or yeast product as described herein.

[0063] As used herein, the term "wild type" refers to an organism or a typical form of its genetic material as it normally exists, as distinguished from a selected organism.

[0064] The terms "yeast product" and "composition" are used interchangeably herein and, as used herein, refer to a composition comprising, inter alia, dry yeast, starch, and an emulsifier. A yeast product may also be a liquid composition comprising, inter alia, milk yeast, glycerol, and xanthan gum.

[0065] Unless otherwise defined herein, the scientific and technical terms used in conjunction with the present disclosure should have the meanings commonly understood by those of ordinary skill in the art. For example, any term used in conjunction with cell biology, molecular biology, microbiology, genetics, and protein and nucleic acid chemistry described herein and the techniques of cell biology, molecular biology, microbiology, genetics, and protein and nucleic acid chemistry described herein are terms and techniques well known in the art and commonly used. The meaning and scope of the terms should be clear; however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definition. In addition, unless the context requires otherwise, singular terms should include plural terms, and plural terms should include singular terms.

[0066] 2. Yeast strains and yeast strain derivatives

[0067] As used herein, yeast strains and yeast strain derivatives can be any yeast used for ethanol production, including but not limited to Saccharomyces, ZygoSaccharomyces, Brettanomyces, and Kluyveromyces. Preferably, the yeast can be a Saccharomyces sp., even more preferably it can be Saccharomyces cerevisiae.

[0068] Furthermore, the Saccharomyces yeast strains and derivatives thereof described herein can be readily distinguished from: (a) naturally occurring strains of Saccharomyces; (b) contaminating strains of Saccharomyces; and (c) other strains used in the ethanol industry that do not possess the ethanol production capabilities and defining characteristics of the strains described herein.

[0069] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, within a temperature range of 20°C to 40°C, preferably within a range of 33°C to 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In a specific embodiment, at a temperature of 33°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, at a temperature of 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain for fermentation. The inventors surprisingly found that under the same fermentation conditions, the yeast strains described herein resulted in a statistically significantly higher ethanol yield than Y1027. The inventors have also surprisingly found that, under identical conditions, the derivatives described herein generally result in statistically significantly higher ethanol yields than Y1027.

[0070] In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol productivity. In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a %>, ... 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol productivity. In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a nutrient content that is about 0.1%-75% (i.e., about 0.1% to about 75%) higher, 0.2%-75%, 0.3%-75%, 0.4%-75%, 0.6%-10% higher, 0.7%-10% higher, 0.8%-10% higher, 0.9%-10% higher, 0.9%-10% higher, 0.1%-10% higher, 0.1%-10% higher, 0.8%-10% higher, 0.9 ...5％-75％、0.6％-75％、0.7％-75％、0.8％-75％、0.9％-75％、1％-75％、2％-75％、3％-75％、4％-75％％、5％-75％、6％-75％、7％-75％、8％-75％、9％-75％、10％-75％、15％-75％、20％-75％、25％-75％、30％-75％、35％-75％、40％-75％、45％-75％、50％-75％、55％-75％、60％-75％、0.1％-70％、0.2％-70％、0.3％-70％、0.4％-70％、0.5％-70％、0.6％-70％、0.7％-70％、0.8％-70％、0.9％-70％、1％-70％、2％-70％、3％-70％、4％-70％％、5％-70％、6％-70％、7％-70％、8％-70％、9％-70％、10％-70％、15％-70％、20％-70％、25％-70％、30％-70％、35％-70％、40％-70％、45％-70％、50％-70％、55％-70％、60％-70％、0.1％-60％、0.2％-60％、0.3％-60％、0.4％-60％、0.5％-60％、0.6％-60％、0.7％-60％、0.8％-60％、0.9％-60％、1％-60％、2％-60％、3％-60％、4％-60％％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、15％-60％、20％-60％、25％-60％、30％-60％、35％-60％、40％-60％、45％-60％、50％-60％、0.1％-50％、0.2％-50％、0.3％-50％、0.4％-50％、0.5％-50％、0.6％-50％、0.7％-50％、0.8％-50％、0.9％-50％、1％-50％、2％-50％、3％-50％、4％-50％％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、15％-50％、20％-50％、25％-50％、30％-50％、35％-50％、40％-50％、0.1％-40％、0.2％-40％、0.3％-40％、0.4％-40％、0.5％-40％、0.6％-40％、0.7％-40％、0.8％-40％、0.9％-40％、1％-40％、2％-40％、3％-40％、4％-40％％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、15％-40％、20％-40％、25％-40％、30％-40％、0.1％-30％、0.2％-30％、0.3％-30％、0.4％-30％、0.5％-30％、0.6％-30％、0.7％-30％、0.8％-30％、0.9％-30％、1％-30％、2％-30％、3％-30％、4％-30％％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、15％-30％、20％-30％、0.1％-20％、0.2％-20％、0.3％-20％、0.4％-20％、0.5％-20％、0.6％-20％、0.7％-20％、0.8％-20％、0.9％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、0.2％-19％、0.3％-19％、0.4％-19％、0.5％-19％、0.6％-19％、0.7％-19％、0.8％-19％、0.9％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、0.2％-18％、0.3％-18％、0.4％-18％、0.5％-18％、0.6％-18％、0.7％-18％、0.8％-18％、0.9％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、0.2％-17％、0.3％-17％、0.4％-17％、0.5％-17％、0.6％-17％、0.7％-17％、0.8％-17％、0.9％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、0.2％-16％、0.3％-16％、0.4％-16％、0.5％-16％、0.6％-16％、0.7％-16％、0.8％-16％、0.9%-16%, 1%-16%, 2%-16%, 3%-16%, 4%-16%, 5%-16%, 6%-16%, 7%-16%, 8%-16%, 9%-16%, 10%-16%, 0.2%-15%, 0.3%-15%, 0.4%-15%, 0.5%-15%, 0.6%-15%, 0.7%-15%, 0.8%-15%, 0.9%-15%, 1%-15%, 2%-15%, 3%-15%, 4%-15%, 5%-15%, 6%-15%, 7%-15%, 8%-15%, 9%-15%, 10%-15%, 0.1%-14%, 0.2%-14%, 0.3%-14 %, 0.4%-14%, 0.5%-14%, 0.6%-14%, 0.7%-14%, 0.8%-14%, 0.9%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%- 14%, 0.1%-13%, 0.2%-13%, 0.3%-13%, 0.4%-13%, 0.5%-13%, 0.6%-13%, 0.7%-13%, 0.8%-13%, 0.9%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-1 3%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 0.1%-12%, 0.2%-12%, 0.3%-12%, 0.4%-12%, 0.5%-12%, 0.6%-12%, 0.7%-12%, 0.8%-12%, 0.9%-12%, 1%-12%, 2%- 12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 0.1%-11%, 0.2%-11%, 0.3%-11%, 0.4%-11%, 0.5%-11%, 0.6%-11%, 0.7%-11% , 0.8%-11%, 0.9%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1 %-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% ethanol yield.

[0071] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fructose utilization rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, within a temperature range of 20°C to 40°C, preferably within a range of 33°C to 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher relative fructose utilization rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In a specific embodiment, at a temperature of 33°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fructose utilization rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, at a temperature of 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fructose utilization rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The present inventors surprisingly found that under the same fermentation conditions, one or more yeast strains described herein resulted in statistically significantly higher fructose utilization than Y1027. The present inventors also surprisingly found that under the same conditions, the derivatives described herein resulted in statistically significantly higher fructose utilization than Y1027.

[0072] In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%. 0%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54% or 55% fructose utilization. In some embodiments, one or more yeast strains and derivatives thereof as described herein have up to about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% greater fructose utilization relative to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) after 48 hours of fermentation. In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a yield of about 0.5%-55% (i.e., about 0.5%-10% higher) relative to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027).5% to about 55%), 1%-55%, 2%-55%, 3%-55%, 4%-55%, 5%-55%, 6%-55%, 7%-55%, 8%-55%, 9%-55%, 10%-55%, 11%-55%, 12%-55%, 13%-55%, 14%-55%, 15%-55%, 16%-55%, 17%-55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55 %, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55 5%, 53%-55%, 54%-55%, 0.5%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50%, 11%-50%, 12%-50%, 13%-50%, 14%-50%, 15%-50%, 16%-50%, 17%-50%, 18%-50%, 19%-50%, 20%-50%, 21%-50%, 22%-50%, 23%-50%, 24% -50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31%-50%, 32%-50%, 33%-50%, 34%-50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41%-50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 0.5％-45％、1％-45％、2％-45％、3％-45％、4％-45％、5％-45％、6％-45％、7％-45％、8％-45％、9％-45％、10％-45％、11％-45％、12％-45％、13％-45％、14％-45％、15％-45％、16％-45％、17％-45％、18％-45％、19％-45％、20％-45％、21％-45％、22％-45％、23％-45％、24％-45％、25％-45％、26％-45％、27％-45％、28％-45％、29％-45％、30％-45％、31％-45％、32％-45％、33％-45％、34％-45％、35％-45％、36％-45％、37％-45％、38％-45％、39％-45％、40％-45％、41％-45％、42％-45％、43％-45％、44％-45％、0.5％-40％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、40％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、0.5％-35％、1％-35％、2％-35％、3％-35％、4％-35％、5％-35％、6％-35％、7％-35％、8％-35％、9％-35％、10％-35％、11％-35％、12％-35％、13％-35％、14％-35％、15％-35％、16％-35％、17％-35％、18％-35％、19％-35％、20％-35％、21％-35％、22％-35％、23％-35％、24％-35％、25％-35％、26％-35％、27％-35％、28％-35％、29％-35％、30％-35％、31％-35％、32％-35％、33％-35％、34％-35％、0.5％-30％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、0.5％-29％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、0.5％-28％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、0.5％-27％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、0.5％-26％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、0.5％-25％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、0.5％-24％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、0.5％-23％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、0.5％-22％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、0.5％-21％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、0.5％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、0.5％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、0.5％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、0.5％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、0.5％-16％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、0.5％-15％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、0.5%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%-14%, 11%-14%, 12%-14%, 13%-14%, 0.5%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-13%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 1 1%-13%, 12%-13%, 0.5%-12%, 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 11%-12%, 0.5%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.5%-10%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 0.5%-9%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 0.5%-8%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 0.5%- 7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% fructose utilization.

[0073] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, within a temperature range of 20°C to 40°C, preferably within a range of 33°C to 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In a specific embodiment, at a temperature of 33°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, at a temperature of 38°C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, the yeast strains described herein resulted in statistically significantly higher ethanol to glycerol ratios than Y1027. The inventors also surprisingly found that under the same conditions, the derivatives described herein resulted in statistically significantly higher ethanol to glycerol ratios than Y1027.

[0074] In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, %, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% ethanol to glycerol ratio. In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have up to about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, %, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% ethanol to glycerol ratio. In some embodiments, after 48 hours of fermentation, the yeast strains and derivatives thereof as described herein have about 1%-90% (i.e., about 1% to about 90%) higher, 2%-90%, 3%-90%, 4%-90%, 5%-90%, 6%-90%, 7%-90%, 8%-90%, 9%-90%, 10%-90%, 15%-90%, 20%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%11％-90％、12％-90％、13％-90％、14％-90％、15％-90％、16％-90％、17％-90％、18％-90％、19％-90％、20％-90％、21％-90％、22％-90％、23％-90％、24％-90％、25％-90％、26％-90％、27％-90％、28％-90％、29％-90％、30％-90％、31％-90％、32％-90％、33％-90％、34％-90％、35％-90％、36％-90％、37％-90％、38％-90％、39％-90％、40％-90％、41％-90％、42％-90％、43％-90％、44％-90％、45％-90％、46％-90％、47％-90％、48％-90％、49％-90％、50％-90％、51％-90％、52％-90％、53％-90％、54％-90％、55％-90％、56％-90％、57％-90％、58％-90％、59％-90％、60％-90％、61％-90％、62％-90％、63％-90％、64％-90％、65％-90％、66％-90％、67％-90％、68％-90％、69％-90％、70％-90％、71％-90％、72％-90％、73％-90％、74％-90％、75％-90％、76％-90％、77％-90％、78％-90％、79％-90％、80％-90％、81％-90％、82％-90％、83％-90％、84％-90％、85％-90％、86％-90％、87％-90％、88％-90％、89％-90％、1％-80％、2％-80％、3％-80％、4％-80％、5％-80％、6％-80％、7％-80％、8％-80％、9％-80％、10％-80％、11％-80％、12％-80％、13％-80％、14％-80％、15％-80％、16％-80％、17％-80％、18％-80％、19％-80％、20％-80％、21％-80％、22％-80％、23％-80％、24％-80％、25％-80％、26％-80％、27％-80％、28％-80％、29％-80％、30％-80％、31％-80％、32％-80％、33％-80％、34％-80％、35％-80％、36％-80％、37％-80％、38％-80％、39％-80％、40％-80％、41％-80％、42％-80％、43％-80％、44％-80％、45％-80％、46％-80％、47％-80％、48％-80％、49％-80％、50％-80％、51％-80％、52％-80％、53％-80％、54％-80％、55％-80％、56％-80％、57％-80％、58％-80％、59％-80％、60％-80％、61％-80％、62％-80％、63％-80％、64％-80％、65％-80％、66％-80％、67％-80％、68％-80％、69％-80％、70％-80％、71％-80％、72％-80％、73％-80％、74％-80％、75％-80％、76％-80％、77％-80％、78％-80％、79％-80％、1％-70％、2％-70％、3％-70％、4％-70％、5％-70％、6％-70％、7％-70％、8％-70％、9％-70％、10％-70％、11％-70％、12％-70％、13％-70％、14％-70％、15％-70％、16％-70％、17％-70％、18％-70％、19％-70％、20％-70％、21％-70％、22％-70％、23％-70％、24％-70％、25％-70％、26％-70％、27％-70％、28％-70％、29％-70％、30％-70％、31％-70％、32％-70％、33％-70％、34％-70％、35％-70％、36％-70％、37％-70％、38％-70％、39％-70％、40％-70％、41％-70％、42％-70％、43％-70％、44％-70％、45％-70％、46％-70％、47％-70％、48％-70％、49％-70％、50％-70％、51％-70％、52％-70％、53％-70％、54％-70％、55％-70％、56％-70％、57％-70％、58％-70％、59％-70％、60％-70％、61％-70％、62％-70％、63％-70％、64％-70％、65％-70％、66％-70％、67％-70％、68％-70％、69％-70％、1％-60％、2％-60％、3％-60％、4％-60％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、11％-60％、12％-60％、13％-60％、14％-60％、15％-60％、16％-60％、17％-60％、18％-60％、19％-60％、20％-60％、21％-60％、22％-60％、23％-60％、24％-60％、25％-60％、26％-60％、27％-60％、28％-60％、29％-60％、30％-60％、31％-60％、32％-60％、33％-60％、34％-60％、35％-60％、36％-60％、37％-60％、38％-60％、39％-60％、40％-60％、41％-60％、42％-60％、43％-60％、44％-60％、45％-60％、46％-60％、47％-60％、48％-60％、49％-60％、50％-60％、51％-60％、52％-60％、53％-60％、54％-60％、55％-60％、56％-60％、57％-60％、58％-60％、59％-60％、1％-50％、2％-50％、3％-50％、4％-50％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、11％-50％、12％-50％、13％-50％、14％-50％、15％-50％、16％-50％、17％-50％、18％-50％、19％-50％、20％-50％、21％-50％、22％-50％、23％-50％、24％-50％、25％-50％、26％-50％、27％-50％、28％-50％、29％-50％、30％-50％、31％-50％、32％-50％、33％-50％、34％-50％、35％-50％、36％-50％、37％-50％、38％-50％、39％-50％、40％-50％、41％-50％、42％-50％、43％-50％、44％-50％、45％-50％、46％-50％、47％-50％、48％-50％、49％-50％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、30％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、1％-14％、2％-14％、3％-14％、4％-14％、5％-14％、6％-14％、7％-14％、8％-14％、9％-14％、10％-14％、11％-14％、12％-14％、13％-14％、1％-13％、2％-13％、3％-13％、4％-13％、5％-13％、6％-13％、7％-13％、8％-13％、9％-13％、10％-13％、11％-13％、12％-13％、1％-12％、2％-12％、3％-12％、4％-12％、5％-12％、6％-12％、7％-12％、8％-12％、9％-12％、10％-12％、11％-12％、1％-11％、2％-11％、3％-11％、4％-11％、5％-11％、6％-11％、7％-11％、8％-11％、9％-11％、10％-11％、1％-10％、2％-10％、3％-10％、4％-10％、5％-10％、6％-10％、7％-10％、8％-10％、9％-10％、1％-9％、2％-9％、3％-9％、4％-9％、5％-9％、6％-9％、7％-9％、8%-9%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3% or 1%-2% ethanol to glycerol ratio.

[0075] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a fermentation rate higher than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, one or more yeast strains and derivatives thereof as described herein have a fermentation rate statistically significantly higher than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In a specific embodiment, at a temperature of 33°C, one or more yeast strains and derivatives thereof as described herein have a fermentation rate statistically significantly higher than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, at a temperature of 38°C, one or more yeast strains and derivatives thereof as described herein have a fermentation rate statistically significantly higher than a typical yeast strain for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, the yeast strains described herein resulted in a fermentation rate statistically significantly higher than Y1027. The inventors surprisingly found that the derivatives described herein resulted in statistically significantly higher fermentation rates compared to Y1027 under the same conditions.

[0076] In some embodiments, after 24 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 690%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, 800%, %, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, after 24 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have up to about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 690%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, 70%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, after 24 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have about 0%-450% (i.e., from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450%, 350%-450%, 360%-450%, 370%-450%, 380%-450%, 390%-450%, 400%-450%, 410%-450%, 420%-450%, 430%-450%, 440%-450%, 450%-450%, 460%-4 %-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%,310％-450％、320％-450％、330％-450％、340％-450％、350％-450％、360％-450％、370％-450％、380％-450％、390％-450％、400％-450％、410％-450％、420％-450％、430％-450％、440％-450％、0％-400％、1％-400％、10％-400％、20％-400％、30％-400％、40％-400％、50％-400％、60％-400％、70％-400％、80％-400％、90％-400％、100％-400％、110％-400％、120％-400％、130％-400％、140％-400％、150％-400％、160％-400％、170％-400％、180％-400％、190％-400％、200％-400％、210％-400％、220％-400％、230％-400％、240％-400％、250％-400％、260％-400％、270％-400％、280％-400％、290％-400％、300％-400％、310％-400％、320％-400％、330％-400％、340％-400％、350％-400％、360％-400％、370％-400％、380％-400％、390％-400％、0％-300％、1％-300％、10％-300％、20％-300％、30％-300％、40％-300％、50％-300％、60％-300％、70％-300％、80％-300％、90％-300％、100％-300％、110％-300％、120％-300％、130％-300％、140％-300％、150％-300％、160％-300％、170％-300％、180％-300％、190％-300％、200％-300％、210％-300％、220％-300％、230％-300％、240％-300％、250％-300％、260％-300％、270％-300％、280％-300％、290％-300％、0％-200％、1％-200％、10％-200％、20％-200％、30％-200％、40％-200％、50％-200％、60％-200％、70％-200％、80％-200％、90％-200％、100％-200％、110％-200％、120％-200％、130％-200％、140％-200％、150％-200％、160％-200％、170%-200%, 180%-200%, 190%-200%, 0%-100%, 1%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80%-100%, 90%-100%, 0%-50%, 1%-50%, 10%-50%, 20%-50%, 30%-50%, 40%-50%, 0%-10%, or 1%-10% fermentation rate.

[0077] In some embodiments, one or more yeast strains and derivatives thereof as described herein have statistically significantly higher temperature tolerance than typical yeast strains (for example, Saccharomyces strain Y1027) for fermentation.Temperature tolerance can be shown by one or more of the following: the ethanol yield that improves, the fructose utilization efficiency that improves, higher ethanol and glycerol ratio and the fermentation rate that improves.In a specific embodiment, one or more yeast strains and derivatives thereof as described herein can tolerate about 20 ℃, about 21 ℃, about 22 ℃, about 23 ℃, about 24 ℃, about 25 ℃, about 26 ℃, about 27 ℃, about 28 ℃, about 29 ℃, about 30 ℃, about 31 ℃, about 32 ℃, about 33 ℃, about 34 ℃, about 35 ℃, about 36 ℃, about 37 ℃, about 38 ℃, about 39 ℃ and / or about 40 ℃ temperature. The present inventors surprisingly found that the yeast strains described herein and their derivatives have a statistically significantly higher temperature tolerance than Y1027 under the same fermentation conditions.

[0078] In some embodiments, one or more yeast strains and derivatives thereof as described herein have statistically significantly higher organic acid tolerance at low pH than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). Organic acid tolerance at low pH can be manifested by one or more of the following: increased ethanol yield, increased fructose utilization, a higher ethanol to glycerol ratio, and increased fermentation rate. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher low pH organic acid tolerance than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In a specific embodiment, at a temperature of 33° C., one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher low pH lactic acid and acetic acid tolerance than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, at a temperature of 38° C., one or more yeast strains and derivatives thereof as described herein have statistically significantly higher tolerance to lactic acid and acetic acid at low pH than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, the yeast strains and derivatives thereof described herein have statistically significantly higher tolerance to organic acids at low pH than Y1027. Examples of organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.

[0079] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9. In a particular embodiment, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C. In another embodiment, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 38 ° C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, at low pH in the presence of organic acids, the yeast strains described herein resulted in statistically significantly higher ethanol yields than Y1027. The present inventors have also surprisingly found that, under the same conditions, at low pH in the presence of organic acids, the derivatives described herein generally result in statistically significantly higher ethanol yields compared to Y1027.

[0080] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 5.0. 9, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a %>, ... , 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol productivity. In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 5.0. 9, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a % or higher % yield relative to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) of up to about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 75.0%, 7664%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% ethanol productivity. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a 0.1%-75% (i.e., from about 0.1% to about 75%), 0.2%-75%, 0.3%-75%, 0.4%-75%, 0.5%-75%, 0.6%-75%, 0.7%-75%, 0.8%-75%, 0.9%-75%, 10%-10% higher kinetic acid than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). 0.9%-75%, 1%-75%, 2%-75%, 3%-75%, 4%-75%, 5%-75%, 6%-75%, 7%-75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 55%-75%, 60% -75%, 0.1%-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%-70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70%, 5%-70%, 6%-70%, 7%-70%, 8%-70%, 9%-70%, 10%-70 %, 15%-70%, 20%-70%, 25%-70%, 30%-70%, 35%-70%, 40%-70%, 45%-70%, 50%-70%, 55%-70%, 60%-70%, 0.1%-60%, 0.2%-60%, 0.3%-60%, 0.4%-60%, 0.5%-60%, 0.6%-60%, 0.7%-60%, 0.8%-60%, 0.9％-60％、1％-60％、2％-60％、3％-60％、4％-60％％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、15％-60％、20％-60％、25％-60％、30％-60％、35％-60％、40％-60％、45％-60％、50％-60％、0.1％-50％、0.2％-50％、0.3％-50％、0.4％-50％、0.5％-50％、0.6％-50％、0.7％-50％、0.8％-50％、0.9％-50％、1％-50％、2％-50％、3％-50％、4％-50％％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、15％-50％、20％-50％、25％-50％、30％-50％、35％-50％、40％-50％、0.1％-40％、0.2％-40％、0.3％-40％、0.4％-40％、0.5％-40％、0.6％-40％、0.7％-40％、0.8％-40％、0.9％-40％、1％-40％、2％-40％、3％-40％、4％-40％％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、15％-40％、20％-40％、25％-40％、30％-40％、0.1％-30％、0.2％-30％、0.3％-30％、0.4％-30％、0.5％-30％、0.6％-30％、0.7％-30％、0.8％-30％、0.9％-30％、1％-30％、2％-30％、3％-30％、4％-30％％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、15％-30％、20％-30％、0.1％-20％、0.2％-20％、0.3％-20％、0.4％-20％、0.5％-20％、0.6％-20％、0.7％-20％、0.8％-20％、0.9％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、0.2％-19％、0.3％-19％、0.4％-19％、0.5％-19％、0.6％-19％、0.7％-19％、0.8％-19％、0.9％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、0.2％-18％、0.3％-18％、0.4％-18％、0.5％-18％、0.6％-18％、0.7％-18％、0.8％-18％、0.9％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、0.2％-17％、0.3％-17％、0.4％-17％、0.5％-17％、0.6％-17％、0.7％-17％、0.8％-17％、0.9％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、0.2％-16％、0.3％-16％、0.4％-16％、0.5％-16％、0.6％-16％、0.7％-16％、0.8％-16％、0.9％-16％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、0.2％-15％、0.3％-15％、0.4％-15％、0.5％-15％、0.6％-15％、0.7％-15％、0.8％-15％、0.9％-15％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、0.1％-14％、0.2％-14％、0.3％-14％、0.4％-14％、0.5％-14％、0.6％-14％、0.7％-14％、0.8％-14％、0.9％-14％、1％-14％、2％-14％、3％-14％、4％-14％、5％-14％、6％-14％、7％-14％、8％-14％、9％-14％、10％-14％、0.1％-13％、0.2％-13％、0.3％-13％、0.4％-13％、0.5％-13％、0.6％-13％、0.7％-13％、0.8％-13％、0.9％-13％、1％-13％、2％-13％、3％-13％、4％-13％、5％-13％、6％-13％、7％-13％、8％-13％、9％-13％、10％-13％、0.1％-12％、0.2％-12％、0.3％-12％、0.4％-12％、0.5％-12％、0.6％-12％、0.7％-12％、0.8％-12％、0.9%-12%, 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 0.1%-11%, 0.2%-11%, 0.3%-11%, 0.4%-11%, 0.5%-11%, 0.6%-11%, 0.7%-11%, 0.8%-11%, 0.9%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11% , 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1%-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% ethanol yield.

[0081] In some embodiments, one or more yeast strains and derivatives thereof as described herein have statistically significantly higher fructose utilization than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9. In a particular embodiment, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fructose utilization efficiency than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C. In another embodiment, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 38° C., one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fructose utilization than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, at low pH and high organic acid concentration, the yeast strains described herein resulted in a statistically significantly higher fructose utilization than Y1027. The inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher fructose utilization compared to Y1027 under the same conditions, at low pH and high organic acid concentration.

[0082] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a higher % yield relative to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) of at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, , 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54% or 55% fructose utilization rate. In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 5.0. 4.9, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a fructose utilization efficiency that is up to about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher relative to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 55%-55%, 56%-55%, 57%-55%, 58%-55%, 59%-55%, 60%-55%, 61%-55%, 62%-55%, 63%-55%, 64%-55%, 65%-55%, 66%-55%, 67%-55%, 68%-55%, 69%-55%, 70%-55%, 71%-55%, 72%-55%, 73%-55%, 74%-55%, 75%-55%, 9%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%- 55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 0.5%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50%, 11%-50%, 12%-50%, 13%-50%, 14%-50%, 15%-50%, 16%-50%, 17%-50%, 18%-50%, 19%-50%, 20%-50%, 21%-50% , 22%-50%, 23%-50%, 24%-50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31%-50%, 32%-50%, 33%-50%, 34%-50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41%-50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 0.5％-45％、1％-45％、2％-45％、3％-45％、4％-45％、5％-45％、6％-45％、7％-45％、8％-45％、9％-45％、10％-45％、11％-45％、12％-45％、13％-45％、14％-45％、15％-45％、16％-45％、17％-45％、18％-45％、19％-45％、20％-45％、21％-45％、22％-45％、23％-45％、24％-45％、25％-45％、26％-45％、27％-45％、28％-45％、29％-45％、30％-45％、31％-45％、32％-45％、33％-45％、34％-45％、35％-45％、36％-45％、37％-45％、38％-45％、39％-45％、40％-45％、41％-45％、42％-45％、43％-45％、44％-45％、0.5％-40％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、40％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、0.5％-35％、1％-35％、2％-35％、3％-35％、4％-35％、5％-35％、6％-35％、7％-35％、8％-35％、9％-35％、10％-35％、11％-35％、12％-35％、13％-35％、14％-35％、15％-35％、16％-35％、17％-35％、18％-35％、19％-35％、20％-35％、21％-35％、22％-35％、23％-35％、24％-35％、25％-35％、26％-35％、27％-35％、28％-35％、29％-35％、30％-35％、31％-35％、32％-35％、33％-35％、34％-35％、0.5％-30％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、0.5％-29％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、0.5％-28％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、0.5％-27％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、0.5％-26％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、0.5％-25％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、0.5％-24％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、0.5％-23％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、0.5％-22％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、0.5％-21％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、0.5％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、0.5％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、0.5％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、0.5％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、0.5％-16％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、0.5％-15％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、0.5%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%-14%, 11%-14%, 12%-14%, 13%-14%, 0.5%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-13%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 1 1%-13%, 12%-13%, 0.5%-12%, 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 11%-12%, 0.5%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.5%-10%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 0.5%-9%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 0.5%-8%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 0.5%- 7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% fructose utilization.

[0083] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9. In a particular embodiment, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C. In another embodiment, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 38° C., one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, at low pH and high organic acid concentration, the yeast strains described herein resulted in a statistically significantly higher ethanol to glycerol ratio than Y1027. The inventors have also surprisingly found that under the same conditions, at low pH and high organic acid concentration, the derivatives described herein result in a statistically significantly higher ethanol to glycerol ratio than Y1027.

[0084] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 5.0. 4.9, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 112%, %, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% ethanol to glycerol ratio. In some embodiments, one or more yeast strains and derivatives thereof as described herein have a 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28% higher than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation. , 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,In some embodiments, the ethanol to glycerol ratio is 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%. In some embodiments, the ethanol to glycerol ratio is 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%. In some embodiments, the ethanol to glycerol ratio is 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%. In some embodiments, the ethanol to glycerol ratio is 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 90%, 10%-90%, 11%-90%, 12%-90%, 13%-90%, 14%-90%, 15%-90%, 16%-90%, 17%-90%, 18%-90%, 19%-90%, 20%-90%, 21%-90%, 22%-90%, 23%-90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73 15%-90%, 16%-90%, 17%-90%, 18%-90%, 19%-90%, 20%-90%, 21%-90%, 22%-90%, 23%-90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73%-90%, 74%-90%, 75%-90%, 76%-90%, 77%-90%, 78%-90%, 79%-90%, 80%-90%, 81%-90%, 82%-90%, 83%-90%, 84%-90%, 85%-90%, 86%-90%,87％-90％、88％-90％、89％-90％、1％-80％、2％-80％、3％-80％、4％-80％、5％-80％、6％-80％、7％-80％、8％-80％、9％-80％、10％-80％、11％-80％、12％-80％、13％-80％、14％-80％、15％-80％、16％-80％、17％-80％、18％-80％、19％-80％、20％-80％、21％-80％、22％-80％、23％-80％、24％-80％、25％-80％、26％-80％、27％-80％、28％-80％、29％-80％、30％-80％、31％-80％、32％-80％、33％-80％、34％-80％、35％-80％、36％-80％、37％-80％、38％-80％、39％-80％、40％-80％、41％-80％、42％-80％、43％-80％、44％-80％、45％-80％、46％-80％、47％-80％、48％-80％、49％-80％、50％-80％、51％-80％、52％-80％、53％-80％、54％-80％、55％-80％、56％-80％、57％-80％、58％-80％、59％-80％、60％-80％、61％-80％、62％-80％、63％-80％、64％-80％、65％-80％、66％-80％、67％-80％、68％-80％、69％-80％、70％-80％、71％-80％、72％-80％、73％-80％、74％-80％、75％-80％、76％-80％、77％-80％、78％-80％、79％-80％、1％-70％、2％-70％、3％-70％、4％-70％、5％-70％、6％-70％、7％-70％、8％-70％、9％-70％、10％-70％、11％-70％、12％-70％、13％-70％、14％-70％、15％-70％、16％-70％、17％-70％、18％-70％、19％-70％、20％-70％、21％-70％、22％-70％、23％-70％、24％-70％、25％-70％、26％-70％、27％-70％、28％-70％、29％-70％、30％-70％、31％-70％、32％-70％、33％-70％、34％-70％、35％-70％、36％-70％、37％-70％、38％-70％、39％-70％、40％-70％、41％-70％、42％-70％、43％-70％、44％-70％、45％-70％、46％-70％、47％-70％、48％-70％、49％-70％、50％-70％、51％-70％、52％-70％、53％-70％、54％-70％、55％-70％、56％-70％、57％-70％、58％-70％、59％-70％、60％-70％、61％-70％、62％-70％、63％-70％、64％-70％、65％-70％、66％-70％、67％-70％、68％-70％、69％-70％、1％-60％、2％-60％、3％-60％、4％-60％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、11％-60％、12％-60％、13％-60％、14％-60％、15％-60％、16％-60％、17％-60％、18％-60％、19％-60％、20％-60％、21％-60％、22％-60％、23％-60％、24％-60％、25％-60％、26％-60％、27％-60％、28％-60％、29％-60％、30％-60％、31％-60％、32％-60％、33％-60％、34％-60％、35％-60％、36％-60％、37％-60％、38％-60％、39％-60％、40％-60％、41％-60％、42％-60％、43％-60％、44％-60％、45％-60％、46％-60％、47％-60％、48％-60％、49％-60％、50％-60％、51％-60％、52％-60％、53％-60％、54％-60％、55％-60％、56％-60％、57％-60％、58％-60％、59％-60％、1％-50％、2％-50％、3％-50％、4％-50％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、11％-50％、12％-50％、13％-50％、14％-50％、15％-50％、16％-50％、17％-50％、18％-50％、19％-50％、20％-50％、21％-50％、22％-50％、23％-50％、24％-50％、25％-50％、26％-50％、27％-50％、28％-50％、29％-50％、30％-50％、31％-50％、32％-50％、33％-50％、34％-50％、35％-50％、36％-50％、37％-50％、38％-50％、39％-50％、40％-50％、41％-50％、42％-50％、43％-50％、44％-50％、45％-50％、46％-50％、47％-50％、48％-50％、49％-50％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、30％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、1％-14％、2％-14％、3％-14％、4％-14％、5％-14％、6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%-14%, 11%-14%, 12%-14%, 13%-14%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-13%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 11%-13%, 12%-13% , 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 11%-12%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10% -11%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3% or 1%-2% ethanol to glycerol ratio.

[0085] In some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fermentation rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9. In a particular embodiment, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fermentation rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027) at a concentration of acetic acid from 0.1% w / v to 0.5% w / v, preferably at a concentration of acetic acid from 0.25% w / v, at a concentration of lactic acid from 0.50% w / v to 1.0% w / v, preferably at a concentration of lactic acid from 0.36% w / v to 0.90% w / v, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C. In another embodiment, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 38 ° C, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher fermentation rate than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that under the same fermentation conditions, at low pH and high organic acid concentration, the yeast strains described herein resulted in a statistically significantly higher fermentation rate than Y1027. The inventors surprisingly found that, under the same conditions, at low pH and high organic acid concentration, the derivatives described herein resulted in statistically significantly higher fermentation rates compared to Y1027.

[0086] In some embodiments, one or more yeast strains and derivatives thereof as described herein have at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 690%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, 810%, 820%, 830%, 840%, 850%, 860%, 870%, 880%, 890%, 900%, 1000%, 1010%, 1020%, 1030%, 1040%, 1050%, 1060%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, one or more yeast strains and derivatives thereof as described herein have a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 690%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, 810%, 820%, 830%, 840%, 850%, 860%, 870%, 880%, 890%, 900%, 910%, 910%, 920%, 930%, 940%, 950%, 960%, 970%, 980%, 990%, %, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at pH 3.5 to pH 5.0,Preferably, at pH 4.2 to pH 4.9, after 24 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have about 0%-450% (i.e., from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450%, 350%-450%, 360%-450%, 370%-450%, 380%-450%, 390%-450%, 400%-450%, 410%-450%, 420%-450%, 430%-450%, 440%-450%, 450%- -450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450%, 350%-450%, 360%-450%, 370%-450%, 380%-450%, 390%-450%, 400%-450% , 410%-450%, 420%-450%, 430%-450%, 440%-450%, 0%-400%, 1%-400%, 10%-400%, 20%-400%, 30%-400%, 40%-400%, 50%-400%, 60%-400%, 70%-400%, 80 %-400%, 90%-400%, 100%-400%, 110%-400%, 120%-400%, 130%-400%, 140%-400%, 150%-400%, 160%-400%, 170%-400%, 180%-400%, 190%-400%, 200%-40 0%, 210%-400%, 220%-400%, 230%-400%, 240%-400%, 250%-400%, 260%-400%, 270%-400%, 280%-400%, 290%-400%, 300%-400%, 310%-400%, 320%-400% , 330%-400%, 340%-400%, 350%-400%, 360%-400%, 370%-400%, 380%-400%, 390%-400%, 0%-300%, 1%-300%, 10%-300%, 20%-300%, 30%-300%, 40%-300%,50%-300%, 60%-300%, 70%-300%, 80%-300%, 90%-300%, 100%-300%, 110%-300%, 120%-300%, 130%-300%, 140%-300%, 150%-300%, 160%-300%, 170%-300%, 180%-300%, 190%-300%, 200%-3 00%, 210%-300%, 220%-300%, 230%-300%, 240%-300%, 250%-300%, 260%-300%, 270%-300%, 280%-300%, 290%-300%, 0%-200%, 1%-200%, 10%-200%, 20%-200%, 30%-200%, 40%-200%, 50%-2 00%, 60%-200%, 70%-200%, 80%-200%, 90%-200%, 100%-200%, 110%-200%, 120%-200%, 130%-200%, 140%-200%, 150%-200%, 160%-200%, 170%-200%, 180%-200%, 190%-200%, 0%-100%, 1%- A fermentation rate of 100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80%-100%, 90%-100%, 0%-50%, 1%-50%, 10%-50%, 20%-50%, 30%-50%, 40%-50%, 0%-10%, or 1%-10%.

[0087] In some embodiments, one or more yeast strains and derivatives thereof as described herein have statistically significantly higher organic acid tolerance at low pH than a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027). Organic acid tolerance at low pH can be manifested by one or more of the following: increased ethanol yield, increased fructose utilization, a higher ethanol to glycerol ratio, and increased fermentation rate. In a specific embodiment, one or more yeast strains and derivatives thereof as described herein can tolerate about 0.1%-1.5%, 0.2%-1.5%, 0.3%-1.5%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1.5%, 0.9%-1.5%, 1.0%-1.5%, 1.1%-1.5%, 1.2%-1.5%, 1.3%-1.5%, 1.4%-1.5%, 0.1%-1.4%, 0.2%-1.4%, 0.3%-1.4%, 0.4%-1.5%. %-1.4%, 0.5%-1.4%, 0.6%-1.4%, 0.7%-1.4%, 0.8%-1.4%, 0.9%-1.4%, 1.0%-1.4%, 1.1%-1.4%, 1.2%-1.4%, 1.3%-1.4%, 0.1%-1.3%, 0.2%-1.3%, 0.3%-1.3%, 0.4%-1.3%, 0.5%-1.3%, 0.6%-1.3%, 0.7%-1.3%, 0.8%-1.3%, 0.9%-1.3%, 1.0%-1.3%, 1.1%-1.3%, 1.2% -1.3%, 0.1%-1.2%, 0.2%-1.2%, 0.3%-1.2%, 0.4%-1.2%, 0.5%-1.2%, 0.6%-1.2%, 0.7%-1.2%, 0.8%-1.2%, 0.9%-1.2%, 1.0%-1.2%, 1.1%-1.2%, 0.1%-1.1%, 0.2%-1.1%, 0.3%-1.1%, 0.4%-1.1%, 0.5%-1.1%, 0.6%-1.1%, 0.7%-1.1%, 0.8%-1.1%, 0.9%-1.1%, 1.0%- 1.1%, 0.1%-1.0%, 0.2%-1.0%, 0.3%-1.0%, 0.4%-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%-1.0%, 0.9%-1.0%, 0.1%-0.9%, 0.2%-0.9%, 0.3%-0.9%, 0.4%-0.9%, 0.5%-0.9%, 0.6%-0.9%, 0.7%-0.9%, 0.8%-0.9%, 0.1%-0.8%, 0.2%-0.8%, 0.3%-0.8%, 0.4%-0.8%, 0.5%-0.8%, 0.6%-0.8%, 0.7%-0.8%, 0.1%-0.7%, 0.2%-0.7%, 0.3%-0.7%, 0.4%-0.7%, 0.5%-0.7%, 0.6%-0.7%, 0.1%-0.6%, 0.2%-0.6%, 0.3%-0.6%, 0.4%-0.6%, 0.5%-0.6%, 0.1%-0.5%, 0.2%-0.5%, 0.3%-0.5%, 0.4%-0.5%, 0.1%-0.4% , 0.2%-0.4%, 0.3%-0.4%, 0.1%-0.3%, 0.2%-0.3% or 0.1%-0.2% organic acid concentration (e.g., acetic acid and lactic acid) and a pH of about 3.0-5.5, 3.5-5.5, 4.0-5.5, 4.5-5.5, 5.0-5.5, 3.0-5.0, 3.5-5.0, 4.0-5.0, 4.5-5.0, 3.0-4.5, 3.5-4.5, 4.0-4.5, 3.0-4.0, 3.5-4.0 or 3.0-3.5. The inventors surprisingly found that under the same fermentation conditions, the yeast strains described herein and their derivatives have a statistically significantly higher organic acid tolerance at low pH tolerance than Y1027.

[0088] In some embodiments, one or more yeast strains and derivatives thereof as described herein have one or more defined characteristics described herein. In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, and at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, one or more yeast strains and derivatives thereof as described herein have one or more defined characteristics described herein. For example, in some embodiments, one or more yeast strains and derivatives thereof as described herein have a statistically significantly higher ethanol yield, a statistically significantly higher fructose utilization efficiency, a statistically significantly higher ethanol to glycerol ratio, a statistically significantly higher fermentation rate, a statistically significantly higher temperature tolerance, and a statistically significantly higher organic acid tolerance compared to a typical yeast strain used for fermentation (e.g., Saccharomyces strain Y1027).

[0089] Yeast strains and derivatives thereof as described herein can be in any live form, including crushed, dry (including active dry and instant), compressed, creamy forms, yeast cultures, and the like. In a specific embodiment, the Saccharomyces cerevisiae yeast strain or its derivative is a dry yeast, such as active dry yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or its derivative is a compressed yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or its derivative is a creamy yeast.

[0090] a. Yeast strain

[0091] One embodiment described herein is a Saccharomyces yeast strain designated as: Y2083 (deposited as NRRL Patent Accession No. Y-68182); Y2084 (deposited as NRRL Patent Accession No. Y-68183); Y2086 (deposited as NRRL Patent Accession No. Y-68184); Y2087 (deposited as NRRL Patent Accession No. Y-68185). These yeast strains are referred to herein as "yeast strains," "Saccharomyces yeast strains," or by their names (i.e., "Y2083" or "Y-68182"; "Y2084" or "Y-68183"; "Y2086" or "Y-68184"; "Y2087" or "Y-68185"). The yeast strains (i.e., Y2083, Y2084, Y2086, and Y2087) are produced from one or more different Saccharomyces yeast strains by one or more of the methods shown in Figure 1. In one aspect, the yeast strains described herein include one or more defining characteristics, including relative performance compared to other yeast strains and typical yeast strains used for fermentation, particularly compared to yeast strain Y1027 (product The present invention provides a novel method for the production of fermentable ethanol by fermenting a yeast strain comprising the following steps: (a) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (a) producing a yeast strain comprising the following steps: (b) producing a yeast strain comprising the following steps: (c) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (i) producing a yeast strain comprising the following steps: (ii) producing a yeast strain comprising the following steps: (ii) producing a yeast strain comprising the following steps:

[0092] b. Yeast strain derivatives

[0093] Another embodiment described herein is a derivative of a Saccharomyces yeast strain selected from the group consisting of the Saccharomyces yeast strains designated as: Y2083 (deposited as NRRL Patent Accession No. Y-68182); Y2084 (deposited as NRRL Patent Accession No. Y-68183); Y2086 (deposited as NRRL Patent Accession No. Y-68184); and Y2087 (deposited as NRRL Patent Accession No. Y-68185). In one aspect, the derivative comprises one or more defining characteristics including relative performance compared to other yeast strains and typical yeast strains used for fermentation, particularly relative performance compared to yeast strain Y1027 (product M) compared to the yeast strain used in the present invention, higher ethanol productivity, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance and higher fermentation rate. In another aspect, the derivative can be the parent strain and can be used to produce other derivatives.

[0094] c. Mutant yeast and its derivatives

[0095] Another embodiment described herein is a mutant of a Saccharomyces yeast strain selected from the group consisting of the Saccharomyces yeast strains designated as: Y2083 (deposited as NRRL Patent Accession No. Y-68182); Y2084 (deposited as NRRL Patent Accession No. Y-68183); Y2086 (deposited as NRRL Patent Accession No. Y-68184); Y2087 (deposited as NRRL Patent Accession No. Y-68185); or derivatives thereof. In one embodiment, the Saccharomyces yeast strains designated as Y2083, Y2084, Y2086, and Y2087 can be obtained by Figure 1D The methods shown are derived from one or more different Saccharomyces yeast strains, such that one or more of Y2083, Y2084, Y2086, or Y2087 can be mutant yeast strains. In one aspect, the mutant yeast strains and mutant derivatives include one or more defining characteristics, including relative performance compared to other yeast strains and typical yeast strains used for fermentation, particularly relative performance compared to yeast strain Y1027 (product M) compared to the yeast strains used in the present invention, higher ethanol productivity, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance and higher fermentation rate. In another aspect, the mutant yeast strains and mutant derivatives can be parent strains and can be used to produce other derivatives. Figure 1D An example of mutagenesis is provided. In one embodiment, the mutant yeast strains and mutant derivatives as described herein are derived from Figure 1D The method shown.

[0096] Mutant yeast strains and mutant derivatives can be prepared by contacting any yeast strain described herein with a mutagen. The mutagen can be any mutagen known in the art. For example, the mutagen can be ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), nitrogen mustard, etc.

[0097] d. Evolved yeast and its derivatives

[0098] Another embodiment described herein is an evolved yeast strain or derivative of a Saccharomyces yeast strain selected from the group consisting of the Saccharomyces yeast strains designated as: Y2083 (deposited as NRRL Patent Accession No. Y-68182); Y2084 (deposited as NRRL Patent Accession No. Y-68183); Y2086 (deposited as NRRL Patent Accession No. Y-68184); and Y2087 (deposited as NRRL Patent Accession No. Y-68185). In one embodiment, the Saccharomyces yeast strains designated as Y2083, Y2084, Y2086, and Y2087 can be obtained by Figure 1C The methods shown are derived from one or more different Saccharomyces yeast strains, such that one or more of Y2083, Y2084, Y2086, or Y2087 can be an evolved yeast strain. In one aspect, the evolved yeast strains and evolved derivatives comprise one or more defining characteristics, including those compared to other yeast strains and typical yeast strains used for fermentation, particularly compared to yeast strain Y1027 (product M) compared to the yeast strains used in the present invention, higher ethanol productivity, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance and higher fermentation rate. In another aspect, the evolved yeast strains and evolved derivatives can be parent strains and can be used to produce other derivatives. Figure 1C An example of evolution is provided in . In one embodiment, the evolved yeast strains and evolved derivatives as described herein are derived from Figure 1C The method shown.

[0099] The evolved yeast strains and evolved derivatives can be prepared by applying selective pressure to any yeast strain described herein. The selective pressure can be negative (reducing the appearance of traits) or positive (increasing the ratio of traits). The selective pressure can be constant or can be intermittent. The selective pressure can be applied by changing the presence of resources (e.g., starch and sugar) and / or changing environmental conditions (e.g., temperature, the presence of organic acids, pH, and fermentation time).

[0100] e. Recombinant yeast and its derivatives

[0101] Other embodiments described herein are recombinant yeast strains and recombinant derivatives. The recombinant yeast strains and derivatives can be derived from the Saccharomyces cerevisiae yeast strains described herein or derivatives thereof. The recombinant yeast strains can include modifications to inhibit the expression of genes, enhance the expression of genes, introduce genes, delete genes or modify the sequences of genes. One aspect described herein is a method for preparing a recombinant of a yeast strain or derivatives thereof. The method can include using recombinant DNA technology to introduce nucleic acids into the Saccharomyces yeast described herein. Methods for introducing nucleic acids into Saccharomyces yeast cells, particularly Saccharomyces strains, are known in the art and are described in, for example, the following documents: Ausubel et al. (1997), Current Protocols in Molecular Biology, 2: 13.7.1-13.7.7 and Yang and Blenner, (2020), Curr Opin Biotechnol., 66: 255-266, both of which are incorporated herein by reference. The method can include using gene editing or similar techniques to change the nucleic acid sequence of the Saccharomyces yeast or derivatives described herein.

[0102] 3. Composition

[0103] Further provided herein are compositions comprising the above-described yeast strains or derivatives thereof. In one embodiment, the composition may comprise: at least one of the yeast strains described herein, the derivatives described herein, or a combination thereof; and naturally occurring and / or non-naturally occurring components. For example, the composition may comprise one or more components selected from surfactants, emulsifiers, gums, swelling agents, antioxidants, starches, metabolites, and other processing aids. In one embodiment, the composition may comprise dry yeast, starch, and an emulsifier of any yeast strain and / or its derivatives. In another embodiment, the composition may comprise milky yeast, glycerol, and xanthan gum of any yeast strain and / or its derivatives. In one embodiment, an enriched culture of any yeast strain described herein is provided, wherein the enrichment is 90%-99% pure. In another embodiment, a pure culture of any yeast strain described herein is provided, wherein the purity is 100% pure, and therefore no additional yeast is present.

[0104] The composition may comprise a Saccharomyces yeast as described herein and any suitable surfactant. In one embodiment, one or more of the surfactants is an anionic surfactant, a cationic surfactant and / or a nonionic surfactant.

[0105] The composition may comprise a yeast of the genus Saccharomyces as described herein and any suitable emulsifier. In one embodiment, the emulsifier is a fatty acid ester of sorbitan. In one embodiment, the emulsifier is selected from sorbitan monostearate (SMS), citric acid esters of mono- or diglycerides, polyglycerol esters, and fatty acid esters of propylene glycol.

[0106] The composition may comprise a Saccharomyces yeast as described herein, and Olindronal SMS, Olindronal SK or Olindronal SPL including the compositions referred to in European Patent No. 1,724, 336. These products are commercially available from Bussetti, Austria, for active dry yeast.

[0107] The composition may comprise a Saccharomyces yeast as described herein and any suitable gum. In one embodiment, the gum is gum arabic, particularly for creamy yeast, compressed yeast and dry yeast.

[0108] The composition may comprise a Saccharomyces yeast as described herein and any suitable swelling agent. In one embodiment, the swelling agent is methylcellulose or carboxymethylcellulose.

[0109] The composition may comprise a Saccharomyces yeast as described herein and any suitable antioxidant. In one embodiment, the antioxidant is butylated hydroxyanisole (BHA) and / or butylated hydroxytoluene (BHT) or ascorbic acid (vitamin C), particularly for active dry yeast.

[0110] The composition may comprise a Saccharomyces yeast as described herein and any suitable starch. In one embodiment, the starch is potato starch, corn starch or pea starch.

[0111] The composition may comprise a Saccharomyces yeast as described herein and any suitable yeast protectant. In one embodiment, the protectant is glycerol.

[0112] a. Composition characteristics

[0113] In one aspect, the composition comprises one or more defining characteristics, including those compared to other yeast products and typical yeast products used for fermentation, particularly yeast products The compositions described herein provide higher ethanol yields, higher fructose utilization, higher ethanol to glycerol ratios, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates compared to yeast strains described herein. Furthermore, the compositions described herein can be readily distinguished from other yeast products used in the ethanol industry that do not possess the ethanol production capabilities and defining characteristics of the compositions described herein.

[0114] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at a temperature of 33°C, the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 In another embodiment, at a temperature of 38°C, the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1) with higher ethanol yield.

[0115] In some embodiments, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 200%, 201%, 202%, 203%, 204%, 205%, 206%, 207%, 208%, 209%, 210%, 211%, 212%, 213%, 214%, 215%, 216%, 217%, 218%, 219%, M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, , 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol productivity. In some embodiments, after 48 hours of fermentation, the compositions as described herein have an ethanol productivity relative to a typical yeast product used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 60%-75%, 75%-75%, 80%-75%, 90%-75%, 100%-75%, 150%-75%, 200%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 60%-75%, 75%-75%, 80%-75%, 85%-75%, 80%-75%, 85%-75%, 90%-75%, 100%-75%, 150%-75%, 200%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50 ... 55%-75%, 60%-75%, 0.1%-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%-70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70 %, 5%-70%, 6%-70%, 7%-70%, 8%-70%, 9%-70%, 10%-70%, 15%-70%, 20%-70%, 25%-70%, 30%-70%, 35%-70%, 40%-70%, 45%-70%, 50%-70%, 55%-70%, 60%-70 %, 0.1%-60%, 0.2%-60%, 0.3%-60%, 0.4%-60%, 0.5%-60%, 0.6%-60%, 0.7%-60%, 0.8%-60%, 0.9%-60%, 1%-60%, 2%-60%, 3%-60%, 4%-60%, 5%-60%, 6%-60%. 0%, 7%-60%, 8%-60%, 9%-60%, 10%-60%, 15%-60%, 20%-60%, 25%-60%, 30%-60%, 35%-60%, 40%-60%, 45%-60%, 50%-60%, 0.1%-50%, 0.2%-50%, 0.3%-50%, 0 .4%-50%, 0.5%-50%, 0.6%-50%, 0.7%-50%, 0.8%-50%, 0.9%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50 %, 15%-50%, 20%-50%, 25%-50%, 30%-50%, 35%-50%, 40%-50%, 0.1%-40%, 0.2%-40%, 0.3%-40%, 0.4%-40%, 0.5%-40%, 0.6%-40%, 0.7%-40%, 0.8%-40%, 0.9％-40％、1％-40％、2％-40％、3％-40％、4％-40％％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、15％-40％、20％-40％、25％-40％、30％-40％、0.1％-30％、0.2％-30％、0.3％-30％、0.4％-30％、0.5％-30％、0.6％-30％、0.7％-30％、0.8％-30％、0.9％-30％、1％-30％、2％-30％、3％-30％、4％-30％％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、15％-30％、20％-30％、0.1％-20％、0.2％-20％、0.3％-20％、0.4％-20％、0.5％-20％、0.6％-20％、0.7％-20％、0.8％-20％、0.9％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、0.2％-19％、0.3％-19％、0.4％-19％、0.5％-19％、0.6％-19％、0.7％-19％、0.8％-19％、0.9％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、0.2％-18％、0.3％-18％、0.4％-18％、0.5％-18％、0.6％-18％、0.7％-18％、0.8％-18％、0.9％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、0.2％-17％、0.3％-17％、0.4％-17％、0.5％-17％、0.6％-17％、0.7％-17％、0.8％-17％、0.9％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、0.2％-16％、0.3％-16％、0.4％-16％、0.5％-16％、0.6％-16％、0.7％-16％、0.8％-16％、0.9%-16%, 1%-16%, 2%-16%, 3%-16%, 4%-16%, 5%-16%, 6%-16%, 7%-16%, 8%-16%, 9%-16%, 10%-16%, 0.2%-15%, 0.3%-15%, 0.4%-15%, 0.5%-15%, 0.6%-15%, 0.7%-15%, 0.8%-15%, 0.9%-15%, 1%-15%, 2%-15%, 3%-15%, 4%-15%, 5%-15%, 6%-15%, 7%-15%, 8%-15%, 9%-15%, 10%-15%, 0.1%-14%, 0.2%-14%, 0.3%-14 %, 0.4%-14%, 0.5%-14%, 0.6%-14%, 0.7%-14%, 0.8%-14%, 0.9%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%- 14%, 0.1%-13%, 0.2%-13%, 0.3%-13%, 0.4%-13%, 0.5%-13%, 0.6%-13%, 0.7%-13%, 0.8%-13%, 0.9%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-1 3%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 0.1%-12%, 0.2%-12%, 0.3%-12%, 0.4%-12%, 0.5%-12%, 0.6%-12%, 0.7%-12%, 0.8%-12%, 0.9%-12%, 1%-12%, 2%- 12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 0.1%-11%, 0.2%-11%, 0.3%-11%, 0.4%-11%, 0.5%-11%, 0.6%-11%, 0.7%-11% , 0.8%-11%, 0.9%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1 %-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% ethanol yield.

[0116] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, the composition as described herein has a higher fructose utilization rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at a temperature of 33°C, the composition as described herein has a higher fructose utilization rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 In another embodiment, at a temperature of 38°C, the composition as described herein has a higher fructose utilization rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) for higher fructose utilization.

[0117] In some embodiments, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization than those in the embodiments of the present invention (e.g., CN, PE-2, CAT-1). In some embodiments, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 54%, or 55% greater fructose utilization than a typical yeast product (e.g., CN, PE-2, CAT-1). In some embodiments, after 48 hours of fermentation, one or more yeast strains and derivatives thereof as described herein have a fructose utilization efficiency relative to a typical yeast product (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 55%-55%, 56%-55%, 57%-55%, 58%-55%, 59%-55%, 60%-55%, 61%-55%, 62%-55%, 63%-55%, 64%-55%, 65%-55%, 66%-55%, 67%-55%, 68%-55%, 69%-55%, 70%-55%, 71%-55%, 72%-55%, 73%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55 %, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 0.5%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50%, 11%-50%, 12%-50%, 13%-50%, 14%-50%, 15%-50%, 16%-50%, 17%-50%, 18%-50%, 19%-50%, 20%-50%, 21%-50%, 22%-50%, 23%- 50%, 24%-50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31%-50%, 32%-50%, 33%-50%, 34%-50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41%-50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 0.5％-45％、1％-45％、2％-45％、3％-45％、4％-45％、5％-45％、6％-45％、7％-45％、8％-45％、9％-45％、10％-45％、11％-45％、12％-45％、13％-45％、14％-45％、15％-45％、16％-45％、17％-45％、18％-45％、19％-45％、20％-45％、21％-45％、22％-45％、23％-45％、24％-45％、25％-45％、26％-45％、27％-45％、28％-45％、29％-45％、30％-45％、31％-45％、32％-45％、33％-45％、34％-45％、35％-45％、36％-45％、37％-45％、38％-45％、39％-45％、40％-45％、41％-45％、42％-45％、43％-45％、44％-45％、0.5％-40％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、40％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、0.5％-35％、1％-35％、2％-35％、3％-35％、4％-35％、5％-35％、6％-35％、7％-35％、8％-35％、9％-35％、10％-35％、11％-35％、12％-35％、13％-35％、14％-35％、15％-35％、16％-35％、17％-35％、18％-35％、19％-35％、20％-35％、21％-35％、22％-35％、23％-35％、24％-35％、25％-35％、26％-35％、27％-35％、28％-35％、29％-35％、30％-35％、31％-35％、32％-35％、33％-35％、34％-35％、0.5％-30％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、0.5％-29％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、0.5％-28％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、0.5％-27％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、0.5％-26％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、0.5％-25％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、0.5％-24％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、0.5％-23％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、0.5％-22％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、0.5％-21％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、0.5％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、0.5％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、0.5％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、0.5％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、0.5％-16％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、0.5％-15％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、0.5%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%-14%, 11%-14%, 12%-14%, 13%-14%, 0.5%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-13%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 1 1%-13%, 12%-13%, 0.5%-12%, 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 11%-12%, 0.5%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.5%-10%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 0.5%-9%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 0.5%-8%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 0.5%- 7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% fructose utilization.

[0118] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher ethanol to glycerol ratio. In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, the composition as described herein has a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher ethanol to glycerol ratio. In a particular embodiment, at a temperature of 33°C, the composition as described herein has a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher ethanol to glycerol ratio. In another embodiment, at a temperature of 38°C, the composition as described herein has a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) higher ethanol to glycerol ratio.

[0119] In some embodiments, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45% higher than , 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% ethanol to glycerol ratio. In some embodiments, after 48 hours of fermentation, the compositions as described herein have an ethanol to glycerol ratio relative to a typical yeast product used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) up to about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, %, 84%, 85%, 86%, 87%, 88%, 89%, or 90% ethanol to glycerol ratio. In some embodiments, after 48 hours of fermentation, the compositions as described herein have an ethanol to glycerol ratio relative to a typical yeast product used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 18%-90%, 19%-90%, 20%-90%, 21%-90%, 22%-90%, 23%-90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73%-90%, 74%-90%, 75%-90%, 76%-90%, 77%-90%, 78%-90%, 79%-90%, 80%-90%, 81%- 0%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61% 5%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90 %, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73%-90%, 74%-90%, 75%-90%, 76 %-90%, 77%-90%, 78%-90%, 79%-90%, 80%-90%, 81%-90%, 82%-90%, 83%-90%, 84%-90%, 85%-90%, 86%-90%, 87%-90%, 88%-90%, 89%-90%, 1%-80%, 2%-80%, 3%-80%, 4%-80%, 5%-80%, 6%-80%, 7%-80%, 8%-80%, 9%-80%, 10%-80%, 11%-80%, 12%-80%, 13%-80%, 14%-80%, 15%-80%, 16%-80%, 17%-80%, 18%-80%, 19% -80%, 20%-80%, 21%-80%, 22%-80%, 23%-80%, 24%-80%, 25%-80%, 26%-80%, 27%-80%, 28%-80%, 29%-80%, 30%-80%, 31%-80%, 32%-80%, 33%-80%, 34%-80%,35％-80％、36％-80％、37％-80％、38％-80％、39％-80％、40％-80％、41％-80％、42％-80％、43％-80％、44％-80％、45％-80％、46％-80％、47％-80％、48％-80％、49％-80％、50％-80％、51％-80％、52％-80％、53％-80％、54％-80％、55％-80％、56％-80％、57％-80％、58％-80％、59％-80％、60％-80％、61％-80％、62％-80％、63％-80％、64％-80％、65％-80％、66％-80％、67％-80％、68％-80％、69％-80％、70％-80％、71％-80％、72％-80％、73％-80％、74％-80％、75％-80％、76％-80％、77％-80％、78％-80％、79％-80％、1％-70％、2％-70％、3％-70％、4％-70％、5％-70％、6％-70％、7％-70％、8％-70％、9％-70％、10％-70％、11％-70％、12％-70％、13％-70％、14％-70％、15％-70％、16％-70％、17％-70％、18％-70％、19％-70％、20％-70％、21％-70％、22％-70％、23％-70％、24％-70％、25％-70％、26％-70％、27％-70％、28％-70％、29％-70％、30％-70％、31％-70％、32％-70％、33％-70％、34％-70％、35％-70％、36％-70％、37％-70％、38％-70％、39％-70％、40％-70％、41％-70％、42％-70％、43％-70％、44％-70％、45％-70％、46％-70％、47％-70％、48％-70％、49％-70％、50％-70％、51％-70％、52％-70％、53％-70％、54％-70％、55％-70％、56％-70％、57％-70％、58％-70％、59％-70％、60％-70％、61％-70％、62％-70％、63％-70％、64％-70％、65％-70％、66％-70％、67％-70％、68％-70％、69％-70％、1％-60％、2％-60％、3％-60％、4％-60％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、11％-60％、12％-60％、13％-60％、14％-60％、15％-60％、16％-60％、17％-60％、18％-60％、19％-60％、20％-60％、21％-60％、22％-60％、23％-60％、24％-60％、25％-60％、26％-60％、27％-60％、28％-60％、29％-60％、30％-60％、31％-60％、32％-60％、33％-60％、34％-60％、35％-60％、36％-60％、37％-60％、38％-60％、39％-60％、40％-60％、41％-60％、42％-60％、43％-60％、44％-60％、45％-60％、46％-60％、47％-60％、48％-60％、49％-60％、50％-60％、51％-60％、52％-60％、53％-60％、54％-60％、55％-60％、56％-60％、57％-60％、58％-60％、59％-60％、1％-50％、2％-50％、3％-50％、4％-50％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、11％-50％、12％-50％、13％-50％、14％-50％、15％-50％、16％-50％、17％-50％、18％-50％、19％-50％、20％-50％、21％-50％、22％-50％、23％-50％、24％-50％、25％-50％、26％-50％、27％-50％、28％-50％、29％-50％、30％-50％、31％-50％、32％-50％、33％-50％、34％-50％、35％-50％、36％-50％、37％-50％、38％-50％、39％-50％、40％-50％、41％-50％、42％-50％、43％-50％、44％-50％、45％-50％、46％-50％、47％-50％、48％-50％、49％-50％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、30％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、1％-14％、2％-14％、3％-14％、4％-14％、5％-14％、6％-14％、7％-14％、8％-14％、9％-14％、10％-14％、11％-14％、12％-14％、13％-14％、1％-13％、2％-13％、3％-13％、4％-13％、5％-13％、6％-13％、7％-13％、8％-13％、9％-13％、10％-13％、11％-13％、12％-13％、1％-12％、2％-12％、3％-12％、4％-12％、5％-12％、6％-12％、7％-12％、8％-12％、9％-12％、10％-12％、11％-12％、1％-11％、2％-11％、3％-11％、4％-11％、5％-11％、6％-11％、7％-11％、8％-11％、9％-11％、10%-11%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8 %, 6%-8%, 7%-8%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3% or 1%-2% ethanol to glycerol ratio.

[0120] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In some embodiments, at a temperature of 20°C to 40°C, preferably at a temperature of 33°C to 38°C, the composition as described herein has a higher fermentation rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at a temperature of 33°C, the composition as described herein has a higher fermentation rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 In another embodiment, at a temperature of 38°C, the composition as described herein has a higher fermentation rate than typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1) with a higher fermentation rate.

[0121] In some embodiments, after 24 hours of fermentation, the compositions as described herein have a relative low gluten content compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% higher fermentation rate than those in (a) fermentation of the present invention; In some embodiments, after 24 hours of fermentation, the compositions as described herein have a relative low gluten content compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, after 24 hours of fermentation, the compositions as described herein have a relative low gluten content compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) by about 0%-450% (i.e., from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450% -450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450% , 350%-450%, 360%-450%, 370%-450%, 380%-450%, 390%-450%, 400%-450%, 410%-450%, 420%-450%, 430%-450%, 440%-450%, 0%-400%, 1%-400%, 10%-400% , 20%-400%, 30%-400%, 40%-400%, 50%-400%, 60%-400%, 70%-400%, 80%-400%, 90%-400%, 100%-400%, 110%-400%, 120%-400%, 130%-400%, 140%-400%, 15 0%-400%, 160%-400%, 170%-400%, 180%-400%, 190%-400%, 200%-400%, 210%-400%, 220%-400%, 230%-400%, 240%-400%, 250%-400%, 260%-400%, 270%-400% 0%, 280%-400%, 290%-400%, 300%-400%, 310%-400%, 320%-400%, 330%-400%, 340%-400%, 350%-400%, 360%-400%, 370%-400%, 380%-400%, 390%-400%, 0% -300%, 1%-300%, 10%-300%, 20%-300%, 30%-300%, 40%-300%, 50%-300%, 60%-300%, 70%-300%, 80%-300%, 90%-300%, 100%-300%, 110%-300%, 120%-300%,130%-300%, 140%-300%, 150%-300%, 160%-300%, 170%-300%, 180%-300%, 190%-300%, 200%-300%, 210%-300%, 220%-300%, 230%-300%, 240%-300%, 250%-300%, 26 0%-300%, 270%-300%, 280%-300%, 290%-300%, 0%-200%, 1%-200%, 10%-200%, 20%-200%, 30%-200%, 40%-200%, 50%-200%, 60%-200%, 70%-200%, 80%-200%, 90%-20 0%, 100%-200%, 110%-200%, 120%-200%, 130%-200%, 140%-200%, 150%-200%, 160%-200%, 170%-200%, 180%-200%, 190%-200%, 0%-100%, 1%-100%, 10%-100%, 20%- A fermentation rate of 100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80%-100%, 90%-100%, 0%-50%, 1%-50%, 10%-50%, 20%-50%, 30%-50%, 40%-50%, 0%-10%, or 1%-10%.

[0122] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 In one embodiment, the fermentation temperature of the present invention can be increased by 100 ℃ to 200 ℃, 100 ℃ to 300 ℃, 100 ℃ to 400 ℃, 100 ℃ to 500 ℃, 100 ℃ to 600 ℃, 100 ℃ to 700 ℃, 100 ℃ to 800 ℃, 100 ℃ to 900 ℃, 100 ℃ to 110 ℃, 100 ℃ to 220 ℃, 100 ℃ to 300 ℃, 100 ℃ to 400 ℃, 100 ℃ to 500 ℃, 100 ℃ to 600 ℃, 100 ℃ to 700 ℃, 100 ℃ to 800 ℃, 100 ℃ to 900 ℃, 100 ℃ to 500 ℃, 100 ℃ to 600 ℃, 100 ℃ to 800 ℃, 100 ℃ to 900 ℃, 100 ℃ to 500 ℃, 100 ℃ to 500 ℃, 100 ℃ to 800 ℃, 100 ℃ to 500 ℃,

[0123] In some embodiments, the compositions described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have higher low pH organic acid tolerance. Low pH organic acid tolerance can be manifested by one or more of the following: increased ethanol yield, increased fructose utilization, a higher ethanol to glycerol ratio, and increased fermentation rate. In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, the compositions as described herein have a higher yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at a temperature of 33°C, the composition as described herein has a higher organic acid tolerance than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher tolerance to lactic acid and acetic acid at low pH. In another embodiment, at a temperature of 38°C, the composition as described herein has a higher tolerance to lactic acid and acetic acid than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have higher lactic acid and acetic acid tolerance at low pH. Examples of organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.

[0124] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, the compositions as described herein have a pH value comparable to typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 33°C, the composition as described herein has a higher ethanol yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In another embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 38°C, the composition as described herein has a higher ethanol yield than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) with higher ethanol yield.

[0125] In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol yield. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, , 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75% ethanol productivity. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 60%-75%, 75%-75%, 80%-75%, 90%-75%, 100%-75%, 150%-75%, 200%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 60%-75%, 75%-75%, 80%-75%, 85%-75%, 80%-75%, 85%-75%, 90%-75%, 100%-75%, 150%-75%, 200%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50 ... 55%-75%, 60%-75%, 0.1%-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%-70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70 %, 5%-70%, 6%-70%, 7%-70%, 8%-70%, 9%-70%, 10%-70%, 15%-70%, 20%-70%, 25%-70%, 30%-70%, 35%-70%, 40%-70%, 45%-70%, 50%-70%, 55%-70%, 60%-70 %, 0.1%-60%, 0.2%-60%, 0.3%-60%, 0.4%-60%, 0.5%-60%, 0.6%-60%, 0.7%-60%, 0.8%-60%, 0.9%-60%, 1%-60%, 2%-60%, 3%-60%, 4%-60%, 5%-60%, 6%-60%. 0%, 7%-60%, 8%-60%, 9%-60%, 10%-60%, 15%-60%, 20%-60%, 25%-60%, 30%-60%, 35%-60%, 40%-60%, 45%-60%, 50%-60%, 0.1%-50%, 0.2%-50%, 0.3%-50%, 0 .4%-50%, 0.5%-50%, 0.6%-50%, 0.7%-50%, 0.8%-50%, 0.9%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50 %, 15%-50%, 20%-50%, 25%-50%, 30%-50%, 35%-50%, 40%-50%, 0.1%-40%, 0.2%-40%, 0.3%-40%, 0.4%-40%, 0.5%-40%, 0.6%-40%, 0.7%-40%, 0.8%-40%, 0.9％-40％、1％-40％、2％-40％、3％-40％、4％-40％％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、15％-40％、20％-40％、25％-40％、30％-40％、0.1％-30％、0.2％-30％、0.3％-30％、0.4％-30％、0.5％-30％、0.6％-30％、0.7％-30％、0.8％-30％、0.9％-30％、1％-30％、2％-30％、3％-30％、4％-30％％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、15％-30％、20％-30％、0.1％-20％、0.2％-20％、0.3％-20％、0.4％-20％、0.5％-20％、0.6％-20％、0.7％-20％、0.8％-20％、0.9％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、0.2％-19％、0.3％-19％、0.4％-19％、0.5％-19％、0.6％-19％、0.7％-19％、0.8％-19％、0.9％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、0.2％-18％、0.3％-18％、0.4％-18％、0.5％-18％、0.6％-18％、0.7％-18％、0.8％-18％、0.9％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、0.2％-17％、0.3％-17％、0.4％-17％、0.5％-17％、0.6％-17％、0.7％-17％、0.8％-17％、0.9％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、0.2％-16％、0.3％-16％、0.4％-16％、0.5％-16％、0.6％-16％、0.7％-16％、0.8％-16％、0.9%-16%, 1%-16%, 2%-16%, 3%-16%, 4%-16%, 5%-16%, 6%-16%, 7%-16%, 8%-16%, 9%-16%, 10%-16%, 0.2%-15%, 0.3%-15%, 0.4%-15%, 0.5%-15%, 0.6%-15%, 0.7%-15%, 0.8%-15%, 0.9%-15%, 1%-15%, 2%-15%, 3%-15%, 4%-15%, 5%-15%, 6%-15%, 7%-15%, 8%-15%, 9%-15%, 10%-15%, 0.1%-14%, 0.2%-14%, 0.3%-14 %, 0.4%-14%, 0.5%-14%, 0.6%-14%, 0.7%-14%, 0.8%-14%, 0.9%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%- 14%, 0.1%-13%, 0.2%-13%, 0.3%-13%, 0.4%-13%, 0.5%-13%, 0.6%-13%, 0.7%-13%, 0.8%-13%, 0.9%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-1 3%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 0.1%-12%, 0.2%-12%, 0.3%-12%, 0.4%-12%, 0.5%-12%, 0.6%-12%, 0.7%-12%, 0.8%-12%, 0.9%-12%, 1%-12%, 2%- 12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 0.1%-11%, 0.2%-11%, 0.3%-11%, 0.4%-11%, 0.5%-11%, 0.6%-11%, 0.7%-11% , 0.8%-11%, 0.9%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1 %-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% ethanol yield.

[0126] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, the compositions as described herein have a pH value comparable to typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C, the composition as described herein has a higher fructose utilization rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In another embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 38°C, the composition as described herein has a higher fructose utilization rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) for higher fructose utilization.

[0127] In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization than those in the embodiments of the present invention (e.g., CN, PE-2, CAT-1). In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% fructose utilization. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55%, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 55%-55%, 56%-55%, 57%-55%, 58%-55%, 59%-55%, 60%-55%, 61%-55%, 62%-55%, 63%-55%, 64%-55%, 65%-55%, 66%-55%, 67%-55%, 68%-55%, 69%-55%, 70%-55%, 71%-55%, 72%-55%, 73%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%-55%, 47%-55%, 48%-55%, 49%-55%, 50%-55 %, 51%-55%, 52%-55%, 53%-55%, 54%-55%, 0.5%-50%, 1%-50%, 2%-50%, 3%-50%, 4%-50%, 5%-50%, 6%-50%, 7%-50%, 8%-50%, 9%-50%, 10%-50%, 11%-50%, 12%-50%, 13%-50%, 14%-50%, 15%-50%, 16%-50%, 17%-50%, 18%-50%, 19%-50%, 20%-50%, 21%-50%, 22%-50%, 23%- 50%, 24%-50%, 25%-50%, 26%-50%, 27%-50%, 28%-50%, 29%-50%, 30%-50%, 31%-50%, 32%-50%, 33%-50%, 34%-50%, 35%-50%, 36%-50%, 37%-50%, 38%-50%, 39%-50%, 40%-50%, 41%-50%, 42%-50%, 43%-50%, 44%-50%, 45%-50%, 46%-50%, 47%-50%, 48%-50%, 49%-50%, 0.5％-45％、1％-45％、2％-45％、3％-45％、4％-45％、5％-45％、6％-45％、7％-45％、8％-45％、9％-45％、10％-45％、11％-45％、12％-45％、13％-45％、14％-45％、15％-45％、16％-45％、17％-45％、18％-45％、19％-45％、20％-45％、21％-45％、22％-45％、23％-45％、24％-45％、25％-45％、26％-45％、27％-45％、28％-45％、29％-45％、30％-45％、31％-45％、32％-45％、33％-45％、34％-45％、35％-45％、36％-45％、37％-45％、38％-45％、39％-45％、40％-45％、41％-45％、42％-45％、43％-45％、44％-45％、0.5％-40％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、40％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、0.5％-35％、1％-35％、2％-35％、3％-35％、4％-35％、5％-35％、6％-35％、7％-35％、8％-35％、9％-35％、10％-35％、11％-35％、12％-35％、13％-35％、14％-35％、15％-35％、16％-35％、17％-35％、18％-35％、19％-35％、20％-35％、21％-35％、22％-35％、23％-35％、24％-35％、25％-35％、26％-35％、27％-35％、28％-35％、29％-35％、30％-35％、31％-35％、32％-35％、33％-35％、34％-35％、0.5％-30％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、0.5％-29％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、0.5％-28％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、0.5％-27％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、0.5％-26％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、0.5％-25％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、0.5％-24％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、0.5％-23％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、0.5％-22％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、0.5％-21％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、0.5％-20％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、0.5％-19％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、0.5％-18％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、0.5％-17％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、0.5％-16％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、0.5％-15％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、0.5%-14%, 1%-14%, 2%-14%, 3%-14%, 4%-14%, 5%-14%, 6%-14%, 7%-14%, 8%-14%, 9%-14%, 10%-14%, 11%-14%, 12%-14%, 13%-14%, 0.5%-13%, 1%-13%, 2%-13%, 3%-13%, 4%-13%, 5%-13%, 6%-13%, 7%-13%, 8%-13%, 9%-13%, 10%-13%, 1 1%-13%, 12%-13%, 0.5%-12%, 1%-12%, 2%-12%, 3%-12%, 4%-12%, 5%-12%, 6%-12%, 7%-12%, 8%-12%, 9%-12%, 10%-12%, 11%-12%, 0.5%-11%, 1%-11%, 2%-11%, 3%-11%, 4%-11%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.5%-10%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 0.5%-9%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 0.5%-8%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 0.5%- 7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% fructose utilization.

[0128] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, the compositions as described herein have a pH value comparable to typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher ethanol to glycerol ratio. In a specific embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 33°C, the composition as described herein has a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have a higher ethanol to glycerol ratio. In another embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 38°C, the composition as described herein has a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) higher ethanol to glycerol ratio.

[0129] In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM、 %, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45% higher than , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90% ethanol to glycerol ratio. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) up to about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 9%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% ethanol to glycerol ratio. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, after 48 hours of fermentation, the compositions as described herein have a relative to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 18%-90%, 19%-90%, 20%-90%, 21%-90%, 22%-90%, 23%-90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73%-90%, 74%-90%, 75%-90%, 76%-90%, 77%-90%, 78%-90%, 79%-90%, 80%-90%, 81%- 0%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90%, 61% 5%-90%, 46%-90%, 47%-90%, 48%-90%, 49%-90%, 50%-90%, 51%-90%, 52%-90%, 53%-90%, 54%-90%, 55%-90%, 56%-90%, 57%-90%, 58%-90%, 59%-90%, 60%-90 %, 61%-90%, 62%-90%, 63%-90%, 64%-90%, 65%-90%, 66%-90%, 67%-90%, 68%-90%, 69%-90%, 70%-90%, 71%-90%, 72%-90%, 73%-90%, 74%-90%, 75%-90%, 76 %-90%, 77%-90%, 78%-90%, 79%-90%, 80%-90%, 81%-90%, 82%-90%, 83%-90%, 84%-90%, 85%-90%, 86%-90%, 87%-90%, 88%-90%, 89%-90%, 1%-80%, 2%-80%, 3%-80%, 4%-80%, 5%-80%, 6%-80%, 7%-80%, 8%-80%, 9%-80%, 10%-80%, 11%-80%, 12%-80%, 13%-80%, 14%-80%, 15%-80%, 16%-80%, 17%-80%, 18%-80%, 19% -80%, 20%-80%, 21%-80%, 22%-80%, 23%-80%, 24%-80%, 25%-80%, 26%-80%, 27%-80%, 28%-80%, 29%-80%, 30%-80%, 31%-80%, 32%-80%, 33%-80%, 34%-80%,35％-80％、36％-80％、37％-80％、38％-80％、39％-80％、40％-80％、41％-80％、42％-80％、43％-80％、44％-80％、45％-80％、46％-80％、47％-80％、48％-80％、49％-80％、50％-80％、51％-80％、52％-80％、53％-80％、54％-80％、55％-80％、56％-80％、57％-80％、58％-80％、59％-80％、60％-80％、61％-80％、62％-80％、63％-80％、64％-80％、65％-80％、66％-80％、67％-80％、68％-80％、69％-80％、70％-80％、71％-80％、72％-80％、73％-80％、74％-80％、75％-80％、76％-80％、77％-80％、78％-80％、79％-80％、1％-70％、2％-70％、3％-70％、4％-70％、5％-70％、6％-70％、7％-70％、8％-70％、9％-70％、10％-70％、11％-70％、12％-70％、13％-70％、14％-70％、15％-70％、16％-70％、17％-70％、18％-70％、19％-70％、20％-70％、21％-70％、22％-70％、23％-70％、24％-70％、25％-70％、26％-70％、27％-70％、28％-70％、29％-70％、30％-70％、31％-70％、32％-70％、33％-70％、34％-70％、35％-70％、36％-70％、37％-70％、38％-70％、39％-70％、40％-70％、41％-70％、42％-70％、43％-70％、44％-70％、45％-70％、46％-70％、47％-70％、48％-70％、49％-70％、50％-70％、51％-70％、52％-70％、53％-70％、54％-70％、55％-70％、56％-70％、57％-70％、58％-70％、59％-70％、60％-70％、61％-70％、62％-70％、63％-70％、64％-70％、65％-70％、66％-70％、67％-70％、68％-70％、69％-70％、1％-60％、2％-60％、3％-60％、4％-60％、5％-60％、6％-60％、7％-60％、8％-60％、9％-60％、10％-60％、11％-60％、12％-60％、13％-60％、14％-60％、15％-60％、16％-60％、17％-60％、18％-60％、19％-60％、20％-60％、21％-60％、22％-60％、23％-60％、24％-60％、25％-60％、26％-60％、27％-60％、28％-60％、29％-60％、30％-60％、31％-60％、32％-60％、33％-60％、34％-60％、35％-60％、36％-60％、37％-60％、38％-60％、39％-60％、40％-60％、41％-60％、42％-60％、43％-60％、44％-60％、45％-60％、46％-60％、47％-60％、48％-60％、49％-60％、50％-60％、51％-60％、52％-60％、53％-60％、54％-60％、55％-60％、56％-60％、57％-60％、58％-60％、59％-60％、1％-50％、2％-50％、3％-50％、4％-50％、5％-50％、6％-50％、7％-50％、8％-50％、9％-50％、10％-50％、11％-50％、12％-50％、13％-50％、14％-50％、15％-50％、16％-50％、17％-50％、18％-50％、19％-50％、20％-50％、21％-50％、22％-50％、23％-50％、24％-50％、25％-50％、26％-50％、27％-50％、28％-50％、29％-50％、30％-50％、31％-50％、32％-50％、33％-50％、34％-50％、35％-50％、36％-50％、37％-50％、38％-50％、39％-50％、40％-50％、41％-50％、42％-50％、43％-50％、44％-50％、45％-50％、46％-50％、47％-50％、48％-50％、49％-50％、1％-40％、2％-40％、3％-40％、4％-40％、5％-40％、6％-40％、7％-40％、8％-40％、9％-40％、10％-40％、11％-40％、12％-40％、13％-40％、14％-40％、15％-40％、16％-40％、17％-40％、18％-40％、19％-40％、20％-40％、21％-40％、22％-40％、23％-40％、24％-40％、25％-40％、26％-40％、27％-40％、28％-40％、29％-40％、30％-40％、31％-40％、32％-40％、33％-40％、34％-40％、35％-40％、36％-40％、37％-40％、38％-40％、39％-40％、1％-30％、2％-30％、3％-30％、4％-30％、5％-30％、6％-30％、7％-30％、8％-30％、9％-30％、10％-30％、11％-30％、12％-30％、13％-30％、14％-30％、15％-30％、16％-30％、17％-30％、18％-30％、19％-30％、20％-30％、21％-30％、22％-30％、23％-30％、24％-30％、25％-30％、26％-30％、27％-30％、28％-30％、29％-30％、1％-29％、2％-29％、3％-29％、4％-29％、5％-29％、6％-29％、7％-29％、8％-29％、9％-29％、10％-29％、11％-29％、12％-29％、13％-29％、14％-29％、15％-29％、16％-29％、17％-29％、18％-29％、19％-29％、20％-29％、21％-29％、22％-29％、23％-29％、24％-29％、25％-29％、26％-29％、27％-29％、28％-29％、1％-28％、2％-28％、3％-28％、4％-28％、5％-28％、6％-28％、7％-28％、8％-28％、9％-28％、10％-28％、11％-28％、12％-28％、13％-28％、14％-28％、15％-28％、16％-28％、17％-28％、18％-28％、19％-28％、20％-28％、21％-28％、22％-28％、23％-28％、24％-28％、25％-28％、26％-28％、27％-28％、1％-27％、2％-27％、3％-27％、4％-27％、5％-27％、6％-27％、7％-27％、8％-27％、9％-27％、10％-27％、11％-27％、12％-27％、13％-27％、14％-27％、15％-27％、16％-27％、17％-27％、18％-27％、19％-27％、20％-27％、21％-27％、22％-27％、23％-27％、24％-27％、25％-27％、26％-27％、1％-26％、2％-26％、3％-26％、4％-26％、5％-26％、6％-26％、7％-26％、8％-26％、9％-26％、10％-26％、11％-26％、12％-26％、13％-26％、14％-26％、15％-26％、16％-26％、17％-26％、18％-26％、19％-26％、20％-26％、21％-26％、22％-26％、23％-26％、24％-26％、25％-26％、1％-25％、2％-25％、3％-25％、4％-25％、5％-25％、6％-25％、7％-25％、8％-25％、9％-25％、10％-25％、11％-25％、12％-25％、13％-25％、14％-25％、15％-25％、16％-25％、17％-25％、18％-25％、19％-25％、20％-25％、21％-25％、22％-25％、23％-25％、24％-25％、1％-24％、2％-24％、3％-24％、4％-24％、5％-24％、6％-24％、7％-24％、8％-24％、9％-24％、10％-24％、11％-24％、12％-24％、13％-24％、14％-24％、15％-24％、16％-24％、17％-24％、18％-24％、19％-24％、20％-24％、21％-24％、22％-24％、23％-24％、1％-23％、2％-23％、3％-23％、4％-23％、5％-23％、6％-23％、7％-23％、8％-23％、9％-23％、10％-23％、11％-23％、12％-23％、13％-23％、14％-23％、15％-23％、16％-23％、17％-23％、18％-23％、19％-23％、20％-23％、21％-23％、22％-23％、1％-22％、2％-22％、3％-22％、4％-22％、5％-22％、6％-22％、7％-22％、8％-22％、9％-22％、10％-22％、11％-22％、12％-22％、13％-22％、14％-22％、15％-22％、16％-22％、17％-22％、18％-22％、19％-22％、20％-22％、21％-22％、1％-21％、2％-21％、3％-21％、4％-21％、5％-21％、6％-21％、7％-21％、8％-21％、9％-21％、10％-21％、11％-21％、12％-21％、13％-21％、14％-21％、15％-21％、16％-21％、17％-21％、18％-21％、19％-21％、20％-21％、1％-20％、2％-20％、3％-20％、4％-20％、5％-20％、6％-20％、7％-20％、8％-20％、9％-20％、10％-20％、11％-20％、12％-20％、13％-20％、14％-20％、15％-20％、16％-20％、17％-20％、18％-20％、19％-20％、1％-19％、2％-19％、3％-19％、4％-19％、5％-19％、6％-19％、7％-19％、8％-19％、9％-19％、10％-19％、11％-19％、12％-19％、13％-19％、14％-19％、15％-19％、16％-19％、17％-19％、18％-19％、1％-18％、2％-18％、3％-18％、4％-18％、5％-18％、6％-18％、7％-18％、8％-18％、9％-18％、10％-18％、11％-18％、12％-18％、13％-18％、14％-18％、15％-18％、16％-18％、17％-18％、1％-17％、2％-17％、3％-17％、4％-17％、5％-17％、6％-17％、7％-17％、8％-17％、9％-17％、10％-17％、11％-17％、12％-17％、13％-17％、14％-17％、15％-17％、16％-17％、1％-16％、2％-16％、3％-16％、4％-16％、5％-16％、6％-16％、7％-16％、8％-16％、9％-16％、10％-16％、11％-16％、12％-16％、13％-16％、14％-16％、15％-16％、1％-15％、2％-15％、3％-15％、4％-15％、5％-15％、6％-15％、7％-15％、8％-15％、9％-15％、10％-15％、11％-15％、12％-15％、13％-15％、14％-15％、1％-14％、2％-14％、3％-14％、4％-14％、5％-14％、6％-14％、7％-14％、8％-14％、9％-14％、10％-14％、11％-14％、12％-14％、13％-14％、1％-13％、2％-13％、3％-13％、4％-13％、5％-13％、6％-13％、7％-13％、8％-13％、9％-13％、10％-13％、11％-13％、12％-13％、1％-12％、2％-12％、3％-12％、4％-12％、5％-12％、6％-12％、7％-12％、8％-12％、9％-12％、10％-12％、11％-12％、1％-11％、2％-11％、3％-11％、4％-11％、5％-11％、6％-11％、7％-11％、8％-11％、9％-11％、10%-11%, 1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10%, 8%-10%, 9%-10%, 1%-9%, 2%-9%, 3%-9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8 %, 6%-8%, 7%-8%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3% or 1%-2% ethanol to glycerol ratio.

[0130] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, the compositions as described herein have a pH value comparable to typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In a particular embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, and at a temperature of 33°C, the composition as described herein has a higher fermentation rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1). In another embodiment, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, at a pH of 3.5 to pH 5.0, preferably at a pH of 4.2 to pH 4.9, and at a temperature of 38°C, the composition as described herein has a higher fermentation rate than typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) with a higher fermentation rate.

[0131] In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, after 24 hours of fermentation, the compositions as described herein have a pH value comparable to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 %, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% higher fermentation rate than those in (a) fermentation of the present invention; In some embodiments, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, after 24 hours of fermentation, the compositions as described herein have a relative improved yield compared to typical yeast products used for fermentation (e.g., M, Ethanol AngelSuper 46EDV、Superstart TM 、 %, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440% or 450% of the fermentation rate. In some embodiments, at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at a pH of 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, after 24 hours of fermentation, the compositions as described herein have a relative improved yield compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) by about 0%-450% (i.e., from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450% -450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450% , 350%-450%, 360%-450%, 370%-450%, 380%-450%, 390%-450%, 400%-450%, 410%-450%, 420%-450%, 430%-450%, 440%-450%, 0%-400%, 1%-400%, 10%-400% , 20%-400%, 30%-400%, 40%-400%, 50%-400%, 60%-400%, 70%-400%, 80%-400%, 90%-400%, 100%-400%, 110%-400%, 120%-400%, 130%-400%, 140%-400%, 15 0%-400%, 160%-400%, 170%-400%, 180%-400%, 190%-400%, 200%-400%, 210%-400%, 220%-400%, 230%-400%, 240%-400%, 250%-400%, 260%-400%, 270%-400% 0%, 280%-400%, 290%-400%, 300%-400%, 310%-400%, 320%-400%, 330%-400%, 340%-400%, 350%-400%, 360%-400%, 370%-400%, 380%-400%, 390%-400%, 0% -300%, 1%-300%, 10%-300%, 20%-300%, 30%-300%, 40%-300%, 50%-300%, 60%-300%, 70%-300%, 80%-300%, 90%-300%, 100%-300%, 110%-300%, 120%-300%,130%-300%, 140%-300%, 150%-300%, 160%-300%, 170%-300%, 180%-300%, 190%-300%, 200%-300%, 210%-300%, 220%-300%, 230%-300%, 240%-300%, 250%-300%, 26 0%-300%, 270%-300%, 280%-300%, 290%-300%, 0%-200%, 1%-200%, 10%-200%, 20%-200%, 30%-200%, 40%-200%, 50%-200%, 60%-200%, 70%-200%, 80%-200%, 90%-20 0%, 100%-200%, 110%-200%, 120%-200%, 130%-200%, 140%-200%, 150%-200%, 160%-200%, 170%-200%, 180%-200%, 190%-200%, 0%-100%, 1%-100%, 10%-100%, 20%- A fermentation rate of 100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80%-100%, 90%-100%, 0%-50%, 1%-50%, 10%-50%, 20%-50%, 30%-50%, 40%-50%, 0%-10%, or 1%-10%.

[0132] In some embodiments, the compositions as described herein have one or more defined characteristics as described herein. In some embodiments, at a temperature of 20° C. to 40° C., preferably at a temperature of 33° C. to 38° C., at a concentration of 0.1% w / v to 0.5% w / v acetic acid, preferably at a concentration of 0.25% w / v acetic acid, at a concentration of 0.50% w / v to 1.0% w / v lactic acid, preferably at a concentration of 0.36% w / v to 0.90% w / v lactic acid, and at pH 3.5 to pH 5.0, preferably at pH 4.2 to pH 4.9, the compositions as described herein have one or more defined characteristics as described herein. For example, in some embodiments, the compositions as described herein have a pH value compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) with higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher fermentation rate, higher temperature tolerance, and higher organic acid tolerance.

[0133] In some embodiments, one or more compositions as described herein are compared to typical yeast products used for fermentation (e.g., M, Ethanol Angel Super 46EDV、Superstart TM 、 CN, PE-2, CAT-1) have statistically significantly higher organic acid tolerance at low pH. Organic acid tolerance at low pH can be manifested by one or more of the following: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate. In a specific embodiment, one or more yeast strains and derivatives thereof as described herein can tolerate about 0.1%-1.5%, 0.2%-1.5%, 0.3%-1.5%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1.5%, 0.9%-1.5%, 1.0%-1.5%, 1.1%-1.5%, 1.2%-1.5%, 1.3%-1.5%, 1.4%-1.5%, 0.1%-1.4%, 0.2%-1.4%, 0.3%-1.4%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1.5%, 0.9%-1.5%, 1.0%-1.5%, 1.1%-1.5%, 1.2%-1.5%, 1.3%-1.5%, 1.4%-1.5%, 0.1%-1.4%, 0.2%-1.4%, 0.3%-1.4%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1.5%, 0.9%-1.5%, 1.4%, 0.6%-1.4%, 0.7%-1.4%, 0.8%-1.4%, 0.9%-1.4%, 1.0%-1.4%, 1.1%-1.4%, 1.2%-1.4%, 1.3%-1.4%, 0.1%-1.3%, 0.2%-1.3%, 0.3%-1.3%, 0.4%-1.3%, 0.5%-1.3%, 0.6%-1.3%, 0.7%-1.3%, 0.8%-1.3%, 0.9%-1.3%, 1.0%-1.3%, 1.1%-1.3%, 1.2%-1.3%, 0.1%-1.2%, 0.2%-1.2% , 0.3%-1.2%, 0.4%-1.2%, 0.5%-1.2%, 0.6%-1.2%, 0.7%-1.2%, 0.8%-1.2%, 0.9%-1.2%, 1.0%-1.2%, 1.1%-1.2%, 0.1%-1.1%, 0.2%-1.1%, 0.3%-1.1%, 0.4%-1.1%, 0.5%-1.1%, 0.6%-1.1%, 0.7%-1.1%, 0.8%-1.1%, 0.9%-1.1%, 1.0%-1.1%, 0.1%-1.0%, 0.2%-1.0%, 0.3%-1.0%, 0.4 %-1.0%, 0.5%-1.0%, 0.6%-1.0%, 0.7%-1.0%, 0.8%-1.0%, 0.9%-1.0%, 0.1%-0.9%, 0.2%-0.9%, 0.3%-0.9%, 0.4%-0.9%, 0.5%-0.9%, 0.6%-0.9%, 0.7%-0.9%, 0.8%-0.9%, 0.1%-0.8%, 0.2%-0.8%, 0.3%-0.8%, 0.4%-0.8%, 0.5%-0.8%, 0.6%-0.8%, 0.7%-0.8%, 0.1%-0.7%, 0.2%-0.7%, 0.3%-0.7%, 0.4%-0.7%, 0.5%-0.7%, 0.6%-0.7%, 0.1%-0.6%, 0.2%-0.6%, 0.3%-0.6%, 0.4%-0.6%, 0.5%-0.6%, 0.1%-0.5%, 0.2%-0.5%, 0.3%-0.5%, 0.4%-0.5%, 0.1%-0.4%, 0.2%-0.4%, 0.3%-0.4%, 0.1% -0.3%, 0.2%-0.3%, or 0.1%-0.2% organic acid concentration (e.g., acetic and lactic acid) and a pH of about 3.0-5.5, 3.5-5.5, 4.0-5.5, 4.5-5.5, 5.0-5.5, 3.0-5.0, 3.5-5.0, 4.0-5.0, 4.5-5.0, 3.0-4.5, 3.5-4.5, 4.0-4.5, 3.0-4.0, 3.5-4.0, or 3.0-3.5.

[0134] 4. Ethanol production

[0135] This paper describes a method for producing ethanol by substrate by contacting a substrate with a fermenting organism or a composition comprising a fermenting organism. The fermenting organism is selected from yeast strains described herein and derivatives thereof. Saccharomyces cerevisiae Y2083, Y2084, Y2086, Y2087, or fermenting organisms with the property roughly the same as the property of yeast strains described herein, or derivatives of the yeast strains described herein with defined characteristics can be used in the method described herein. This paper also describes a fermentation product comprising any yeast described herein. This paper further describes the fermentation product obtained by the method described herein. Fermentation product can include but is not limited to fuel ethanol, industrial ethanol, drinking ethanol, bioethanol, fermented food (such as alcoholic beverages, cultured milk and yogurt, wine, beer, cider, tempeh, miso, pickles, sauerkraut and fermented sausage).

[0136] Fermentation occurs in a fermentation medium. The fermentation medium includes a fermentation substrate, i.e., a carbohydrate source, such as biomass, that is metabolized by the fermenting organism. The fermentation medium may contain nutrients for one or more of the fermenting organisms. Nutrients are widely used in the fermentation field and include nitrogen sources, vitamins, minerals, or combinations thereof.

[0137] In one embodiment, bacterial strain or derivative as described herein or composition are cultivated together with the substrate that comprises fermentable sugar from biomass, and described biomass is such as from forest and / or from the plant biomass of agricultural or food processing products and / or by-products, and described biomass constitutes the considerable carbon source for producing the molecule of interest.Under the condition that allows fermentable sugar fermentation, bacterial strain or derivative are cultivated together with substrate.Fermentable sugar can be glucose, galactose, maltose, fructose, sucrose, mannose or its combination.Usually, fermentable sugar is glucose, fructose and sucrose.The source of the fermentable sugar in substrate can be any source containing fermentable sugar.The fermentable sugar in substrate can be for example from any one or more of following sources: hydrolyzed starch, hydrolyzed cellulose, molasses from sugarcane, beet or sweet sorghum, sugarcane juice, agave, beet juice, grape juice, fruit juice, glucose, fructose, hydrolysis maltodextrin, raw sugar juice, galactose, sucrose, any other form of fermentable sugar or its combination.Starch can be obtained from any starch-rich crop. Examples of starch-rich crops include, but are not limited to, corn, wheat, barley, cassava, sorghum, sweet potato, millet, rice, or any other starch-rich crops. In the preparation of the substrate, the crop is typically pulverized and mixed with water and one or more hydrolytic enzymes under conditions that result in starch hydrolysis and release of fermentable sugars (such as glucose). Typical enzymes used for starch hydrolysis include alpha-amylase, amyloglucosidase, pullulanase, beta-amylase, glucoamylase, or mixtures thereof.

[0138] Typically, fermenting organisms, such as yeast (including Saccharomyces cerevisiae yeast), require sufficient nitrogen sources for breeding and fermentation. A variety of nitrogen sources can be used, and such nitrogen sources are well known in the art. The nitrogen source can be organic, such as urea or corn mash, or inorganic, such as ammonia or ammonium hydroxide or an ammonium salt.

[0139] In a specific embodiment, the biomass can comprise or be derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In a specific embodiment, the substrate is provided in the form of molasses. Methods for producing molasses are known in the art and are described, for example, in: Olbrich, (2006) Biotechnologie-Kempe GmbH, 128; Clarke and Godshall, (2013) Chemistry and processing of sugarbeet and sugarcane: Proceedings of the Symposium on Sugarbeet Chemistry and Processing, Denver, Colorado, April 6, 1987, and Proceedings of the Symposium on Sugarcane Chemistry and Processing, New Orleans, Louisiana, September 3-4, 1987, Elsevier. In a specific embodiment, the substrate is provided in the form of syrup. In a specific embodiment, the substrate is provided in the form of corn mash or synthetic corn medium (SCM). Methods for preparing corn mash are known in the art and are described, for example, in Thomas et al. (2001) Journal of Applied Microbiology, 90, 819-828. Methods for preparing substrates functionally similar to SCM are known in the art and are described, for example, in U.S. Patent No. 10,106,823, which is incorporated by reference in its entirety and herein. Methods for preparing starch-based substrates are also described, for example, in PCT Publication No. 2006 / 113683 and U.S. Patent Publication No. 2007 / 0014905.

[0140] The sugar content of the fermentation medium can be adjusted so that it is as high as possible while ensuring that the sugars are converted to ethanol as quickly and completely as possible. Preferably, the yeast converts all of the sugars in the medium to ethanol and the overall conversion yield of consumed sugars to ethanol is as high as possible, and thus produces minimal by-products (such as glycerol) during fermentation.

[0141] Fermentation is carried out at a temperature that allows fermentable sugars to ferment. Generally speaking, the higher the temperature that fermentation is carried out, the more economical the industrial process is. Typically, the temperature that fermentation is carried out is about 25-42 ℃ (that is, about 25 ℃ to about 42 ℃). Suitable temperature ranges include 25-41 ℃, 26-40 ℃, 27-40 ℃, 28-40 ℃, 29-40 ℃, 30-40 ℃, 25-39 ℃, 26-39 ℃, 27-39 ℃, 28-39 ℃, 29-39 ℃, 30-39 ℃, 31-39 ℃, 32-39 ℃, 33-39 ℃, 25-38 ℃, 26-38 ℃, 27-38 ℃, 28-38 ℃, 29-38 ℃, 30-38 ℃, 31-38 ℃, 32-38 ℃, 33-38 ℃, 25-27 ℃, 26-37℃, 27-37℃, 28-37℃, 29-37℃, 30-37℃, 31-37℃, 32-37℃, 33-37℃, 25-36℃, 26-36℃, 27-36℃, 28-36℃, 29-36℃, 30-36℃, 31-36℃, 32-36℃, 33-36℃, 25-35℃, 6-35℃, 27-35℃, 28-35℃, 29-35℃, 30-35℃, 31-35℃, 32-35℃ or 33-35℃.

[0142] Methods for fermentation and distillation are known in the art and are described, for example, in PCT Publication No. 2006 / 113683 and U.S. Patent Publication No. 2007 / 0014905. In particular, ethanol production as described herein can be performed using simultaneous saccharification and fermentation ("SSF"), batch fermentation, semi-batch fermentation, or continuous fermentation.

[0143] a. Fermentation of sucrose-based substrates

[0144] Utilizing molasses and other sugar refinery products as feedstock is common practice in the industrial-scale production of bioethanol and distilled spirits. The ethanol fermentation process can utilize sugars obtained during refining, originating from any refining step. The fermentation process is typically a fed-batch fermentation. Yeast can be propagated prior to fermentation, or the propagation step can be omitted by directly adding active dry yeast product. Fermentation can be carried out at a temperature of about 25°C to about 40°C, such as about 25°C to about 33°C, about 30°C to about 34°C, or about 32°C to about 36°C. For bioethanol applications, the temperature is preferably about 33°C. In one embodiment, fermentation is carried out for about 6 hours to about 120 hours, particularly for about 18 hours to about 72 hours, and preferably for about 24 hours to about 48 hours. In one embodiment, the pH is about 3.0 to about 6.0, preferably about 4.0 to about 5.0.

[0145] b. Simultaneous saccharification and fermentation ("SSF")

[0146] SSF is widely used in industrial-scale fermentation product production processes, especially ethanol production processes. When SSF is performed, the saccharification step and the fermentation step are carried out simultaneously. There is no holding phase for saccharification, which means that the fermentation organism (such as yeast) and one or more enzymes are added together. However, it is also contemplated to add the fermentation organism and one or more enzymes separately (i.e., separate hydrolysis and fermentation (SHF)). SSF can be carried out at a temperature of about 25°C to about 40°C, such as about 28°C to about 35°C, such as about 30°C to about 34°C, preferably about 33°C. In one embodiment, the fermentation is carried out for about 6 hours to about 120 hours, particularly for about 24 hours to about 96 hours, and preferably for about 48 hours. In one embodiment, the pH is about 3.0-6.0, preferably about 4.0-5.0.

[0147] c. Ethanol recovery

[0148] After fermentation (such as SSF), ethanol can be separated from spent fermentation medium or beer. Beer can be rectified or distilled to reclaim / extract required fermentation products (i.e., ethanol and higher alcohols). Alternatively, required fermentation products (i.e., ethanol) can be extracted from fermentation medium by microfiltration or membrane filtration technology known in the art. Fermentation products (i.e., ethanol) can also be reclaimed by stripping or other methods well known in the art.

[0149] In some embodiments, ethanol is not recovered / extracted from the fermentation medium or beer, such as in the production of alcoholic beverages.

[0150] d. Batch fermentation

[0151] Batch fermentation refers to fermentation in separate batches. Batch fermentation is a process in which a fermentation medium is provided in a fermentor from the start, the fermentor is inoculated with a predetermined microorganism (i.e., yeast, yeast product), and the fermentation process is carried out until a predetermined condition has been reached, which is typically the exhaustion of the substrate in the fermentation medium and the cessation of ethanol production caused by exhaustion. Once the process is complete, the product is removed from the fermentor and sterilized before the next fermentation. The contents are then either a final product (e.g., wine) or can be rectified / distilled (e.g., fuel ethanol and whiskey).

[0152] e. Fed-batch fermentation

[0153] A fed-batch process can also be used. A fed-batch process is a fermentation in which a portion of the fermentation medium is provided from the start of the fermentation process (addition of inoculum), and at some point after the start of fermentation, additional substrate, the feed, is supplied to the fermentor at a rate that can be predetermined or determined by the conditions in the fermentor; until the maximum volume has been reached. The feed may or may not have the same composition as the initial fermentation medium. The contents are then the final product (e.g., wine) or can be rectified / distilled (e.g., fuel ethanol and whiskey).

[0154] f. Continuous fermentation

[0155] Continuous fermentation allows fermentation to be performed over a long period of time without having to ferment in separate batches. A continuous fermentation process is one in which new growth medium is continuously fed to the fermenter and fermentation is simultaneously removed from the fermenter at the same rate, so that the volume in the fermenter is constant. The contents are then either the final product (e.g., wine) or can be subjected to rectification / distillation (e.g., fuel ethanol and whiskey).

[0156] 5. Ethanol

[0157] The ethanol produced by the yeast and its derivatives as described herein can be fuel ethanol, industrial ethanol and / or drinking ethanol. Fuel ethanol, industrial ethanol and drinking ethanol can be produced from starch-containing biomass, including starch present in cereals (e.g., corn, wheat, rice, sorghum / milo, barley, etc.), and starch in tubers and root vegetables (e.g., potatoes, cassava, etc.); can be produced from vegetative parts of plants containing the sugars sucrose, glucose and fructose (e.g., sugarcane, sweet sorghum, beets, agave, etc.); and can be produced from fruits and berries of plants containing sucrose, glucose and fructose (e.g., grapes, oranges, peaches, cherries, etc.).

[0158] Fuel ethanol and industrial ethanol can also be produced from plant biomass containing cellulose and hemicellulose, such as cereal crop residues (e.g., wheat and rice straw, corn stover, corn cobs, etc.), corn fiber, so-called energy crops (such as switchgrass and poplar), woody material waste (including residues from sawmills (e.g., sawdust and wood chips)), residues from pulp and paper manufacturing, and waste paper and cardboard.

[0159] a. Fuel ethanol

[0160] Fuel ethanol is manufactured for use in internal combustion engines and can be made into anhydrous or aqueous fuel ethanol. Anhydrous fuel ethanol can be mixed with gasoline to form an ethanol / gasoline blend, or it can be mixed with diesel to form an ethanol / diesel blend. Aqueous fuel ethanol can be used directly as a fuel in internal combustion engines.

[0161] b. Industrial ethanol

[0162] Industrial ethanol is manufactured for a variety of applications, including as a solvent in pharmaceuticals, cosmetics, detergents, household cleaners and disinfectants, and paints and inks; and as a chemical intermediate in the manufacture of ethyl acetate, ethyl acrylate, polyethylene, acetic acid, and other industrially important organic molecules.

[0163] c. Drinking ethanol

[0164] Potable ethanol is manufactured for human consumption and includes the ethanol found in wine, beer, cider, sake, mead, kombucha, and distilled spirits including whiskey, bourbon, cachaça, baijiu, scotch biscuits, and others.

[0165] 6. Yeast Strain Production

[0166] a. Directed mating

[0167] Provided herein is a method for producing a derivative of the Saccharomyces yeast strain Y2083 as described herein. The method may include providing a first yeast strain and a second yeast strain, the first yeast strain being selected from the Saccharomyces strains Y2083, Y2084, Y2086, and Y2087, and the second yeast strain being any yeast strain, such as a yeast strain in the narrow clade of Saccharomyces, such as a Saccharomyces cerevisiae strain. The second strain may also be any yeast strain described herein. The method may also include inducing sporulation of the first yeast strain and the second yeast strain. The method may also include screening and selecting spores from the first yeast strain and spores from the second yeast strain. In addition, the method may include hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain, and screening or selecting derivative strains. The method may include screening or selecting spores that exhibit one or more defined characteristics of the Saccharomyces strain as described herein. The method may also include screening or selecting hybrids that exhibit one or more defined characteristics of the Saccharomyces strain as described herein. Figure 1A An example of directed mating is provided in . Thus, the parents (i.e., the donors of the "a" and "α" haploids) that produce hybrids are known. In one embodiment, yeast strains and their derivatives as described herein are generated by Figures 1A to 1D In one embodiment, the yeast strains of the genus Saccharomyces designated as Y2083, Y2084, Y2086 and Y2087 are prepared by Figures 1A to 1D The method shown in Figure 1AThe method shown in derives from one or more different Saccharomyces yeast strains such that one or more of Y2083, Y2084, Y2086 or Y2087 are the product of directed mating. Methods of directed mating are known in the art and are described in U.S. Patent No. 10,308,963 and U.S. Patent No. 10,106,823, both of which are incorporated herein by reference.

[0168] b. Group mating

[0169] Provided herein is a method for producing a derivative of the Saccharomyces yeast strain Y2083 as described herein. The method may include providing a first yeast strain and one or more additional yeast strains, the first yeast strain being selected from the Saccharomyces strains Y2083, Y2084, Y2086, and Y2087, the one or more additional yeast strains being any yeast strain, such as a yeast strain in the narrow genus Saccharomyces clade, such as a Saccharomyces cerevisiae strain. The one or more additional yeast strains may also be any yeast strain described herein. The method may also include inducing sporulation of the first yeast strain and the one or more additional yeast strains. The method may also include mixing all of the spores to allow hybridization of the spores, and screening or selecting derivative strains. The method may include screening or selecting hybrids that exhibit one or more defined characteristics of the yeast strains as described herein. Figure 1B An example of a population mating is provided in . Thus, the parents (i.e., the donors of the "a" and "α" haploids) from which the hybrids are produced are unknown. In one embodiment, the yeast strains and their derivatives as described herein are derived from Figures 1A to 1D In one embodiment, the yeast strains of the genus Saccharomyces designated as Y2083, Y2084, Y2086 and Y2087 are prepared by Figures 1A to 1D The method shown in Figure 1B The methods shown in derive from one or more different Saccharomyces yeast strains such that one or more of Y2083, Y2084, Y2086, or Y2087 are the product of mass mating.

[0170] 7. Examples

[0171] The foregoing may be better understood by reference to the following examples, which are presented for purposes of illustration and are not intended to limit the scope of the invention.The present disclosure has various aspects and embodiments, illustrated by the accompanying non-limiting examples.

[0172] Example 1

[0173] Materials and methods

[0174] Diluted cane molasses medium (DM) was used in the following examples. Blackstrap molasses (79 Brix, U.S. Cane Molasses Grade Standard, USDA, 1956) is commonly used in industrial bioethanol production. DM is prepared by diluting commercial blackstrap molasses and adjusted to reflect the chemical composition of production-scale cane molasses in terms of sugar and nutrient availability. DM reflects a medium-gravity model cane molasses of 22-25% fermentable sugars, which should yield 7-11% w / v final ethanol. The quality and composition of molasses vary depending on geographic location and refining practices.

[0175] This medium is used to monitor yeast performance during a batch fermentation process in which fermentable sugars are added immediately before fermentation begins.

[0176] Preparation of Standard DM (SDM). 1 kg of SDM medium was made by adding 1 L of water to 615 g of molasses and 1.6 g of urea. The medium was autoclaved at 120°C for 20 minutes and then cooled to room temperature. The pH was adjusted to 4.87 using hydrochloric acid and / or potassium hydroxide while mixing at 24-25°C. To minimize the growth of contaminants during fermentation, vildalin was added to 1.0 ppm and penicillin G was added to 100 ppm. The liquid medium was adjusted to 22-25% w / v fermentable sugars with water. The resulting medium contained 0.36% w / v lactic acid and 0.25% w / v acetic acid. Representative samples of the solution were collected for specific gravity measurement and HPLC analysis.

[0177] Preparation of high organic acid DM (ALM). 1 kg of ALM was prepared in the same manner as SDM, except that lactic acid was added and the pH was adjusted to 4.2. The resulting medium contained 22-25% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% acetic acid.

[0178] Yeast product rehydration: The dry yeast product was resuspended in 0.9% sodium chloride (0.07 g / g) and hydrated at room temperature for 30 minutes before inoculation.

[0179] Batch fermentation. 95.00 ± 0.02 mL of SDM or ALM was added to each test sample container for each yeast strain. 5 g of yeast culture or rehydrated yeast product was inoculated into the sample container with SDM or ALM. The sample container was sealed with an airlock cap filled with water. The sample container was incubated at 33°C or 38°C, 150 rpm, and 80% humidity for 48 hours. The weight of each sample container was measured before, and at 24 and 48 hours of incubation. After 48 hours of incubation, the fermentation was terminated, and the sample container was removed from the incubator and sampled for HPLC analysis.

[0180] End-of-fermentation HPLC analysis: The composition of samples at the end of fermentation is analyzed using state-of-the-art methods for residual sugars, lactic acid, acetic acid, glycerol, and ethanol.

[0181] Ethanol Yield. Ethanol yield was determined using the ratio of ethanol glucose equivalents present at the end of the fermentation to the total glucose equivalents at the end of the fermentation. The relative difference in ethanol yield was determined as the difference between the ethanol yield and the percentage ratio of the average ethanol yield for Y1027 minus 100%.

[0182] Ethanol to glycerol ratio. The net glycerol produced during fermentation was determined as the difference between the total glycerol at the end of fermentation and the initial glycerol present in the culture medium. The ethanol to glycerol ratio (ethanol:glycerol) was determined as the ratio of ethanol to net glycerol. The relative percent change in ethanol:glycerol relative to Y1027 was determined as the difference between the percent ratio of ethanol:glycerol and the average ethanol:glycerol value for Y1027 minus 100%.

[0183]

[0184] Fructose utilization. The residual fructose concentration at the end of fermentation was used as an indicator of fructose utilization capacity; for example, lower residual fructose indicated higher fructose utilization. The relative percentage change in fructose utilization relative to Y1027 was determined as the difference between the residual fructose percentage and the mean residual fructose value for Y1027 minus 100%.

[0185]

[0186] Fermentation rate. The amount of CO2 produced in grams during an ethanol fermentation is proportional to the amount of ethanol produced in grams during the same reaction. Therefore, the mass loss in grams can be used to assess the progress of the fermentation reaction without breaking the anaerobic seal. The mass loss in grams at 24 hours of fermentation is used as an indication of the midpoint fermentation rate. The relative change in fermentation rate of a given strain relative to Y1027 is determined as the percentage ratio of the fermentation rate of that strain to the average fermentation rate of Y1027 minus 100%.

[0187]

[0188] Statistical Analysis. Student's T-tests were performed on ethanol, ethanol yield, ethanol, glycerol, ethanol to glycerol ratio, glucose and fructose values ​​and ratios. 95% confidence intervals (95% CI) and standard errors were calculated for each analyte.

[0189] Example 2

[0190] Obtaining mutants from Y1027

[0191] Genetic diversity can be generated in a yeast population by artificially introducing mutations. Artificial mutagenesis can be achieved by exposure to radiant energy (e.g., ultraviolet radiation), chemical mutagens (e.g., ethyl methanesulfonate, EMS), or a combination of both. The following section shows the use of artificial mutagenesis to generate a genetically diverse population starting with Y1027.

[0192] A fresh colony of Y1027 was inoculated into 50 mL of YPS medium (1% w / v yeast extract, 2% w / v bacto-peptone, 2% w / v sucrose) and cultured at 33°C with stirring at 250 rpm for 24 hours. The culture was diluted to 2.2 × 10 8 cells / mL. The cells were exposed to 0 to 4 kJ / cm 2 The culture was exposed to UV radiation and 3% w / v EMS for 90 to 240 minutes. The culture was washed in phosphate buffered saline buffer at pH 7.4 and stored at 4°C. Aliquots of the culture before and after treatment were plated on YPS agar plates, and the ratio of colonies relative to untreated cultures was used to determine survival (Table 1).

[0193] Table 1. Chemical mutagenesis treatments.

[0194]

[0195] Example 3

[0196] Selection of strains with improved acid resistance

[0197] The mutant pool derived from Y1027 was inoculated with 1% w / v yeast extract, 2% w / v bacto-peptone, 10.8% w / v fermentable sugars (2.8% glucose, 8% fructose), 9.6% w / v ethanol, 1.2% w / v lactic acid, pH 3.8, and incubated for 24 h at 38° C. Surviving cells were plated on YPS agar plates and incubated at 32° C. to obtain isolated colonies.

[0198] Example 4

[0199] Directed evolution

[0200] Directed evolution applies selective pressure to genetic diversity colonies to obtain adaptive advantages that are difficult to obtain by traditional breeding and selection. Directed evolution can be carried out under continuous culture conditions as described herein, as continuous culture batches or fed batch passages, or as a combination of the two. Selective conditions can be applied simultaneously, continuously or in an alternating pattern to improve specific traits throughout the entire process of strain development. Those skilled in the art will recognize that the protocol modification step is needed during the execution of the entire directed evolution experiment. As an example, those skilled in the art can adjust the feed rate of specific nutrients.

[0201] Genetically diverse populations can be generated by naturally occurring mutations and / or by artificial mutagenesis (e.g., chemical mutagenesis).Genetically diverse populations can also be generated by breeding genetically different strains, as described in the previous examples.

[0202] Directed evolution of temperature tolerance. In one example, directed evolution was performed by continuously culturing an acid-tolerant strain as a starting strain in a sugarcane molasses medium at 37°C-38°C for 100 days. The cells were kept suspended by continuous stirring at 150rpm. The culture was continuously supplemented with standard diluted molasses medium (SDM). Throughout the experiment, the fermentable sugar concentration was maintained at 4-6% w / v and the ethanol concentration was maintained at 3.6-7.7% w / v. The initial organic acid concentration was 0.326±0.015% w / v acetic acid and 0.5-0.6% w / v lactic acid. The initial pH was adjusted to 4.8-4.9. After 650h of continuous culture, the feed medium was acidified to pH 4.4 with hydrochloric acid, and the lactic acid concentration in the feed was increased to 1% w / v. At the end of the directed evolution in the culture vessel, the lactic acid concentration in the feed reached 0.77% w / v and the pH was 4.4. Growth was stimulated by the addition of Tween-80 (420 mg / L) and ergosterol (10 mg / L).

[0203] Example 5

[0204] Sporulation of yeast cultures

[0205] The formation of meiotic yeast spores can be induced according to methods well known in the art (e.g., as described in "Methods in Yeast Genetics, A Cold Spring Harbor Laboratory Course Manual, 2000 Edition" de D. Burke, D. Dawson et T. Stearns, Cold Spring Harbor Laboratory Press (ISBN 0-87969-588-9)). The formation of meiotic yeast spores is promoted by resuspending a fresh yeast culture grown in acetate medium (1% w / v yeast extract, 2% w / v bacto-peptone, 2% w / v potassium acetate) into a spore-forming medium and culturing at 30°C and 250 rpm for 5 days. In some cases, the spore suspension is treated with an equal volume of ether, cultured at room temperature (e.g., 25°C) for 2 hours, and washed in sterile spore-forming medium to remove vegetative cells. The spore suspension is stored at 4°C until use.

[0206] Spore germination. A spore suspension from a strain with the desired trait was treated with 5 units / mL of zymolyase for 15 minutes to disrupt the ascus wall and facilitate spore separation. Spore germination was induced by culturing on YPS medium.

[0207] Example 6

[0208] Isolation of haploid strains

[0209] To isolate individual haploid strains, germinated meiotic spores were immediately dissected from the asci with the aid of a micromanipulator and cultured on YPS agar plates at 32°C until growth was observed. Haploid mating type was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990; 6(8):236).

[0210] Example 7

[0211] Directed mating

[0212] Breeding occurs when physical contact between two haploid cells or meiotic spores from opposite mating types (MATα and MATa) causes cell fusion and forms a diploid cell. Directed mating is the result of artificial induction breeding, and by artificial induction breeding, those skilled in the art have promoted the physical contact between the two cells. Use a micromanipulator (e.g., Singer model 1377A3) to facilitate that two cells are placed in physical contact.

[0213] In some cases, two independent stable haploid cells of opposite mating types were physically contacted. As an example, a single MATα haploid cell was obtained from the offspring of the Y1027 mutant. The MATα haploid cell was physically contacted with a single MATa haploid cell descended from a hybrid strain. With the help of a micromanipulator, the pair was placed together on a YPS agar plate and incubated at 32°C until growth was observed.

[0214] In other cases, after treatment with 5 units / mL of zymolyase, random meiotic spores from a first strain with the desired properties were physically dissected and separated from other meiotic spores in the same ascus, then placed on a YPS agar plate with the help of a micromanipulator. Random meiotic spores from a second strain with the desired properties were dissected in the same manner and physically placed next to the first spores to allow physical contact on the YPS agar plate. The spore pairs were allowed to germinate and fuse by incubation at 32°C until growth was observed. For example, hybrid diploid progeny were obtained by physically contacting individual spores from an acid-tolerant mutant strain and the high-fructose-utilizing strain Fermichamp.

[0215] In other cases, a random spore from a first strain having the desired characteristic that has been treated with an enzyme is physically contacted with a single cell from a stable haploid strain that exhibits the desired characteristic on a YPS agar plate with the aid of a micromanipulator and incubated at 32° C. until growth is observed. For example, a random spore from an intermediate hybrid is contacted with a single MATα haploid cell derived from a CAT-1 strain to produce a new hybrid strain.

[0216] Colonies obtained by directed mating were re-isolated onto new YPS agar plates, and the diploid state was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990; 6(8):236).

[0217] Example 8

[0218] Group mating

[0219] Breeding by mass mating is the result of random cell fusion of two haploid cells of opposite mating types in a mixed haploid cell suspension. A haploid cell suspension can be obtained from one or more stable haploid populations, provided both mating types are present. Alternatively, a haploid cell suspension can be obtained by treating a spore suspension with an enzymolytic enzyme to digest the ascus wall and promote mechanical separation of meiotic spores. The enzymolytic enzyme-treated spore suspension is diluted into a medium containing sucrose or glucose to promote germination of the spores into haploid cells. The suspension is mixed and allowed to stand for a short period of time to promote cell fusion events.

[0220] In the context of the present invention, ether-treated meiotic spores from at least two different strains with desired characteristics were treated with 5 units / mL of zymolyase for 30 minutes, mixed, and resuspended in 10 mL of YPS liquid medium (1% yeast extract, 1% peptone, 2% sucrose). The mixture was incubated for 1.5 hours without stirring to allow the germinated individual spores to come into contact with each other. The mixture was further incubated at 33°C for 18-20 hours with gentle agitation at 70 rpm.

[0221] Colonies obtained by direct mating were re-isolated onto new YPS agar plates, and the diploid state was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990; 6(8):236).

[0222] Example 9

[0223] Breeding and selection for tolerance to multiple stresses and fermentation rates

[0224] A combination of breeding and directed evolution was used to improve tolerance to multiple stresses and increase fermentation rate. Tolerance to multiple stresses was achieved by performing several rounds of colony mating and selection on an intermediate strain population, which was obtained by breeding and screening for improved acid and temperature tolerance in sugarcane molasses medium. Initially, a portion of the strains was inoculated into a continuous culture in SDM medium at 33°C. A second portion of the strains was initially selected in YP (1% yeast extract, 2% bacto-peptone) at various levels of temperature and pH between 36°C and 40°C to tolerate different concentrations of organic acids and ethanol. Isolates that passed each selection criterion were combined for sporulation and colony mating. At various time points throughout the experiment, aliquots from the continuous cultures were obtained and subjected to colony mating and selection protocols. Conversely, a portion of the surviving strains in each round of temperature and acid selection were inoculated into a continuous culture in SDM medium at 33°C for rate selection.

[0225] Example 10

[0226] Strain description

[0227] Based on experiments conducted at 33°C or 38°C, at normal pH without organic acid or at low pH with added organic acid, the following properties were observed for representative samples of the Saccharomyces yeast strains described herein and the strain deposited under NRRL Patent Accession No. Y-68182 (Y2083), the strain deposited under NRRL Patent Accession No. Y-68183 (Y2084), the strain deposited under NRRL Patent Accession No. Y-68184 (Y2086), and the strain deposited under NRRL Patent Accession No. Y-68185 (Y2087). Y1027 is shown for comparison and was analyzed under similar conditions.

[0228] Significant and advantageous features of the yeast strains as described herein include increased ethanol productivity, increased fructose utilization, increased ethanol to glycerol ratio, and increased initial fermentation rate compared to controls. Advantageous fermentation properties of the yeast strains as described herein and their corresponding products are provided in the following examples.

[0229] Example 11

[0230] Ethanol yield, glycerol yield and fermentation rate

[0231] Active dry yeast products derived from yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate in standard dilute molasses medium (SDM) initially containing 22.5-24.5% w / v fermentable sugars, 0.36% w / v lactic acid, and 0.25% w / v acetic acid at 33°C and pH 4.9 (Tables 2 and 3). Figures 2A to 2E). A control (Y1027) is shown for comparison.

[0232] Table 2. Active dry yeast product at 33°C and pH 4.9 in SDM initially containing 0.36% w / v lactic acid and 0.25% w / v acetic acid.

[0233]

[0234] Active dry yeast products derived from yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 33°C and pH 4.2 in ALM initially containing 22.5-24.5% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% w / v acetic acid (Tables 3 and 4). Figures 3A to 3E ). A control (Y1027) is shown for comparison.

[0235] Table 3. Active dry yeast product at 33°C and pH 4.2 in ALM initially containing 0.9% w / v lactic acid and 0.25% w / v acetic acid.

[0236]

[0237] Active dry yeast products derived from yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 38°C and pH 4.9 in SDM initially containing 22.5-24.5% w / v fermentable sugars, 0.36% w / v lactic acid, and 0.25% w / v acetic acid (Tables 4 and 5). Figures 4A to 4E ). A control (Y1027) is shown for comparison.

[0238] Table 4. Active dry yeast product at 38°C and pH 4.9 in SDM initially containing 0.36% w / v lactic acid and 0.25% w / v acetic acid.

[0239]

[0240] Active dry yeast products derived from yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 38°C and pH 4.2 in ALM initially containing 22.5-24.5% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% w / v acetic acid (Tables 5 and 6). Figures 5A to 5E ). A control (Y1027) is shown for comparison.

[0241] Table 5. Active dry yeast product at 38°C and pH 4.2 in ALM initially containing 0.9% w / v lactic acid and 0.25% w / v acetic acid.

[0242]

[0243] A summary of the above results is shown in Table 6. These percentages show the percent change relative to the control for the yeast strains as described herein.

[0244] Table 6. Summary of results.

[0245]

[0246]

[0247] Example 12

[0248] Differentiation of strains Y2083, Y2084, Y2086, and Y2087 from each other and other commercially available bioethanol yeast strains by microsatellite PCR

[0249] Genotypic comparisons using PCR amplification of microsatellite loci were performed to verify that strains Y2083, Y2084, Y2086, and Y2087 (NRRL patent deposit numbers Y-68182, Y-68183, Y-68184, and Y-68185, respectively) had unique genotypes and could be distinguished from other strains isolated from commercial yeast products used in bioethanol production (Table 7).

[0250] Table 7. List of commercial yeast products used for microsatellite PCR comparison.

[0251] Company: Products ABMauriFaliM (including Y1027 strain) INDIANYEASTCOMPANYHRC3 ZILLOLORENZETTIGROUP (Brazilian Molasses Strain) BG1 MAURIBRASILINDUSTRIALTDC7 FLEISCHMANN'SLTU-26 FERMENTECBrasilPE-2 FERMENTECBrasilCAT-1 LallemandEDV46 FERMENTISEthanolRed Isolated from the RadicoIndian molasses ethanol plant Nature Biochem Y-Max Isolate C1 AngelSuperAlcohol NovozymesInnovaFit Rymco Pty Ltd (Anchor Yeast): ThermosaccXL

[0252] In this example, microsatellite DNA amplification products were generated by multiplex PCR of the YPL009C and YOR267C loci. The primers used were YPL009C_F1: GGTTTTGGATTTTTATGGAAAG (SEQ ID NO: 1), YPL009C_R1: TTTCGTGCTATCGTTTGAATC (SEQ ID NO: 2), YOR267C_F1: CGATGCTAATGGTGACTCTAAC (SEQ ID NO: 3), and YOR267C_R1: CTGTTGACTCGATTTATTATCG (SEQ ID NO: 4). Each primer was used at a concentration of 0.4 μM. Reactions were performed in a final volume of 20 μl using 10 μl of OneTaq Hot Start 2x Master Mix (New England Biolabs, catalog number: M0484S) with standard buffer. PCR amplification was performed using a Mastercycler Nexus Gradient instrument (Eppendorf) under the following thermal cycling conditions: an initial denaturation step at 94°C for 2 minutes, followed by 35 cycles of 30 seconds at 94°C, 20 seconds at 53.5°C, and 30 seconds at 68°C, followed by a final extension step of 5 minutes at 68°C. PCR products were analyzed by capillary electrophoresis using a QIAxcel Advanced instrument (Qiagen) with the following run settings: rise time: 0.3 seconds; applied injection time: 20 seconds; applied separation time: 425 seconds; method injection time: 10 seconds; method separation time: 420 seconds; method injection voltage: 5.0 kV; and method separation voltage: 5.0 kV. Fragment sizes were compared to a reference marker table generated using QX DNA SizeMarker 100 BP–2.5 kb (Qiagen catalog number: 929559) prepared at a final concentration of 20 ng / μl in 1x PCR buffer. The alignment marker used was QX Alignment Marker 15 bp / 5 kb (Qiagen Cat. No. 929524).

[0253] As a result of this analysis, it was observed that strains Y2083, Y2084, Y2086 and Y2087 were novel yeast strains that could be distinguished from prior art strains based on their microsatellite DNA patterns ( Figure 6 ).

[0254] Example 13

[0255] Methods for analyzing strain uniqueness using bioinformatics analysis

[0256] To further verify that strains Y2083, Y2084, Y2086, and Y2087 were genetically unique and distinct from each other and from Y1027, PacBio whole-genome sequencing was performed. The coding ORF from the reference strain S288C was used as a query sequence in a blastn analysis against the whole-genome assembly from each strain to identify the corresponding ORF in the strain.

[0257] Further bioinformatic sequence analysis was performed in which a subset of ORF sequences were compared between strains.

[0258] The sequence comparison results are displayed as a heat map showing the percentage of identical nucleotide matches for each strain relative to Y1027 for the 56 ORF sequences ( Figure 7A ). The intensity legend accompanying the heatmap corresponds to the percentage of identical matches generated by blastn analysis using the Y1027 ORF sequence as the query sequence. Shaded rectangles indicate percent identity less than 100% compared to the Y1027 sequence and therefore represent sequence variation. Figure 7A Among them, strains Y2083, Y2084, Y2086 and Y2087 each had a unique shading pattern, which together with the microsatellite PCR results indicated that the strains claimed in the present invention were novel and had unique genotypes.

[0259] Additional bioinformatics analysis was performed to verify the unique genotypes of strains Y2083 and Y2084, the two strains with the most similar microsatellite PCR profiles. Using blastn, an additional subset of predicted ORF sequences was used to compare strain Y2083 with strain Y2084. Figure 7B The heat map in Figure 2 shows the percentage of identical matches for 16 ORFs in strain Y2083 relative to Y2084. Percent identities below 100% in Y2083 relative to Y2084 indicate that the two strains have different genotypes.

[0260] ***

[0261] The foregoing description of specific aspects will fully reveal the general nature of the invention so that others can easily modify and / or adapt various applications, such as specific aspects, by applying the knowledge of those skilled in the art without departing from the general concept of the present disclosure without excessive experimentation. Therefore, based on the teachings and guidance given herein, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed aspects. It should be understood that the wording or terminology herein is for descriptive purposes and not for limitation, so that those skilled in the art should interpret the terms or wording of this specification in accordance with the teachings and guidance.

[0262] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects, but should be defined only in accordance with the following claims and their equivalents.

[0263] All publications, patents, patent applications and / or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application and / or other document were individually indicated to be incorporated by reference for all purposes.

[0264] For the sake of completeness, various aspects of the invention are listed in the following numbered clauses:

[0265] Item 1. A non-naturally occurring Saccharomyces yeast strain selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184; and (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185.

[0266] Item 2. A derivative of a non-naturally occurring Saccharomyces yeast strain selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184; and (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185.

[0267] Item 3. A yeast strain according to item 1 or a derivative according to item 2, wherein the yeast strain or the derivative comprises one or more defining characteristics selected from the group consisting of: (a) higher ethanol yield compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) improved temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) improved organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

[0268] Clause 4. The yeast strain or derivative according to any one of clauses 1 to 3, wherein the yeast strain or the derivative has an ethanol yield that is at least about 3.3% higher relative to Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

[0269] Clause 5. The yeast strain or derivative according to any one of clauses 1 to 3, wherein after 48 hours of fermentation, the yeast strain or the derivative has a fructose utilization efficiency that is at least about 5% higher relative to Saccharomyces cerevisiae strain Y1027.

[0270] Clause 6. The yeast strain or derivative according to any one of clauses 1 to 3, wherein after 48 hours of fermentation, the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 11% higher than that of Saccharomyces cerevisiae strain Y1027.

[0271] Clause 7. The yeast strain or derivative according to any one of clauses 1 to 3, wherein the yeast strain or the derivative has a fermentation rate that is at least about 1.5% higher than that of Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation.

[0272] Clause 8. The yeast strain or derivative according to any one of the preceding clauses, wherein the yeast strain or the derivative has a higher temperature tolerance during fermentation at a fermentation temperature of 33°C to 38°C relative to Saccharomyces cerevisiae strain Y1027.

[0273] Item 9. The yeast strain or derivative according to Item 8, wherein the fermentation temperature is 33°C.

[0274] Clause 10. The yeast strain or derivative according to Clause 8, wherein the fermentation temperature is 38°C.

[0275] Clause 11. The yeast strain or derivative of any one of clauses 1 to 10, wherein the yeast strain or derivative has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 when the fermentation pH is reduced from about 4.9 to about 4.0 in the presence of increasing amounts of organic acids in the fermentation medium.

[0276] Clause 12. The yeast strain or derivative according to Clause 11, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9.

[0277] Clause 13. The yeast strain or derivative of any one of clauses 3 to 11, wherein the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

[0278] Item 14. A method for producing a derivative of a Saccharomyces yeast strain according to any one of items 2 to 13, comprising: (1) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087 and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain belongs to the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain; and (e) screening or selecting derivative strains; or (2) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087 and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain belongs to the Saccharomyces sensu stricto clade. sensu stricto clade); (b) inducing sporulation of the first yeast strain and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow the spores to hybridize; and (d) screening or selecting derivative strains.

[0279] Clause 15. The method of clause 14, wherein step (1)(c) comprises screening or selecting spores that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof; and step (1)(e) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof.

[0280] Clause 16. The method of Clause 14, wherein step (2)(d) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, or Y2087.

[0281] Item 17. A mutant yeast of the yeast strain according to Item 1 or the derivative according to Item 2.

[0282] Item 18. A method of producing the mutant yeast according to Item 17, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.

[0283] Item 19. The method according to Item 18, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170) or nitrogen mustard.

[0284] Item 20. A method of producing the mutant yeast according to Item 17, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.

[0285] Clause 21. The method according to clause 20, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170) or nitrogen mustard.

[0286] Item 22. An evolved yeast of the yeast strain according to Item 1 or the derivative according to Item 2.

[0287] Item 23. A method of producing the evolved yeast of Item 22, wherein evolution is induced by applying selective pressure to the yeast strain.

[0288] Item 24. A method of producing an evolved yeast according to Item 22, wherein evolution is induced by applying selective pressure to the derivative.

[0289] Item 25. A genetically modified yeast of the yeast strain according to Item 1 or a derivative according to Item 2.

[0290] Item 26. The genetically modified yeast according to Item 25, wherein the nucleic acid sequence of the genetically modified yeast is altered using gene editing.

[0291] Item 27. A recombinant yeast of the yeast strain according to Item 1 or the derivative according to Item 2.

[0292] Item 28. The recombinant yeast according to Item 27, wherein the recombinant yeast comprises modifications to inhibit gene expression, enhance gene expression, introduce a gene, or delete a gene.

[0293] Item 29. A method for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185, or a derivative thereof.

[0294] Clause 30. The method of Clause 29, wherein the substrate comprises or is derived from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

[0295] Clause 31. The method of clause 29, wherein the yeast comprises one or more defining characteristics selected from the group consisting of: (a) higher ethanol productivity compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

[0296] Clause 32. The method of any one of clauses 29 to 31, wherein the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature of 33°C to 38°C.

[0297] Clause 33. The method of clause 32, wherein the fermentation temperature is 33°C.

[0298] Clause 34. The method of Clause 32, wherein the fermentation temperature is 38°C.

[0299] Clause 35. The method of any one of clauses 29 to 34, wherein the yeast has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 in the presence of increased organic acids in a fermentation medium having a pH reduced from about 4.9 to about 4.0.

[0300] Clause 36. The method of Clause 35, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9.

[0301] Clause 37. The method of Clause 35, wherein the organic acids in the fermentation medium comprise 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2.

[0302] Clause 38. The method of any one of Clauses 29 to 37, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0303] Clause 39. The process of any one of Clauses 29 to 37, wherein the ethanol is produced using starch.

[0304] Clause 40. The method of Clause 39, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation.

[0305] Clause 41. The method according to any one of Clauses 29 to 37, wherein the ethanol is produced using sugar.

[0306] Clause 42. The method of Clause 41, wherein the ethanol is produced using batch fermentation or continuous fermentation.

[0307] Clause 43. The process of any one of Clauses 29 to 37, wherein the ethanol is produced using lignocellulosic sugars.

[0308] Clause 44. The method of Clause 43, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF).

[0309] Item 45. A composition comprising the yeast strain according to Item 1 or the derivative according to Item 2 and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants and antioxidants.

[0310] Clause 46. A composition according to clause 45, wherein the composition comprises one or more defining characteristics selected from the group consisting of: (a) higher ethanol yield compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) higher fructose utilization compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) increased fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions.

[0311] Clause 47. The composition of Clause 45 or Clause 46, wherein the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 at 33°C to 38°C.

[0312] Clause 48. The composition of any one of clauses 45 to 47, wherein the temperature is 33°C.

[0313] Clause 49. The composition of any one of clauses 45 to 47, wherein the temperature is 38°C.

[0314] Clause 50. The composition of any one of clauses 45 to 49, wherein the yeast has a greater organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 when the pH is decreased from about 4.9 to about 4.0 in the presence of increased organic acids.

[0315] Clause 51. The composition of any one of clauses 45 to 50, wherein the organic acid comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid and has a pH of 4.9.

[0316] Clause 52. The composition of any one of clauses 45 to 50, wherein the organic acid comprises 0.9% w / v lactic acid and 0.25% w / v acetic acid and has a pH of 4.2.

[0317] Clause 53. A method of producing ethanol from biomass by contacting the biomass with the composition according to Clause 45.

[0318] Clause 54. The method of Clause 53, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0319] Clause 55. The method of Clause 53, wherein the ethanol is produced using starch.

[0320] Clause 56. The method of Clause 53, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation.

[0321] Clause 57. The method of Clause 53, wherein the ethanol is produced using sugar.

[0322] Clause 58. The method of Clause 53, wherein the ethanol is produced using batch fermentation or continuous fermentation.

[0323] Clause 59. The method of Clause 53, wherein the ethanol is produced using lignocellulosic sugars.

[0324] Clause 60. The method of Clause 53, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF).

[0325] Item 61. A method for producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68185, or a derivative thereof.

[0326] Clause 62. The method of Clause 61, wherein the substrate comprises or is derived from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

[0327] Clause 63. The method of Clause 61, wherein the fermentation product is ethanol.

[0328] Clause 64. The method of Clause 63, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0329] Clause 65. The method of Clause 61, wherein the fermentation product is produced using batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF).

[0330] 8. Biological deposits

[0331] Representative samples of the yeast strains of the genus Saccharomyces described herein were deposited with the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL), 1815 University Street, Peoria, Illinois, United States, on July 26, 2022, and assigned NRRL Patent Deposit No. Y-68182 (Y2083), NRRL Patent Deposit No. Y-68183 (Y2084), NRRL Patent Deposit No. Y-68184 (Y2086), and NRRL Patent Deposit No. Y-68185 (Y2087). They will be maintained at the NRRL depository for at least thirty years under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Purposes of Patent Procedure and for at least five years after the last request for a sample of the deposit was received by the depository. Applicant has met all requirements of 37 CFR §§1.801–1.809, including providing an indication of sample viability. Additional deposits will be made with the NRRL as needed to ensure availability, under the conditions described herein. Applicants do not impose any restrictions on the availability of the deposited materials from the NRRL after publication of the patent application. Applicants are not authorized to waive any legal restrictions on the transfer of biological materials or their transportation in global commerce. Applicants do not waive any rights conferred by them under any patent obtained from this application in any country.

[0332] sequence

[0333] SEQ ID NO: 1

[0334] YPL009C_F1 primers

[0335] GGTTTTGGATTTTTATGGAAAG

[0336] SEQ ID NO:2

[0337] YPL009C_R1 primer

[0338] TTTCGTGCTATCGTTTGAATC

[0339] SEQ ID NO:3

[0340] YOR267C_F1 primers

[0341] CGATGCTAATGGTGACTCTAAC

[0342] SEQ ID NO:4

[0343] YOR267C_R1 primer

[0344] CTGTTGACTCGATTTATTATCG

Claims

1. A non-naturally occurring yeast strain of the genus Saccharomyces selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited under NRRL Patent Deposit No. Y-68185.

2. A derivative of a non-naturally occurring Saccharomyces yeast strain selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited under NRRL Patent Accession No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited under NRRL Patent Deposit No. Y-68185.

3. The yeast strain according to claim 1 or the derivative according to claim 2, wherein The yeast strain or the derivative comprises one or more defining characteristics selected from the group consisting of: (a) Higher ethanol productivity compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) improved temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization efficiency compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) improved organic acid tolerance compared to Saccharomyces strain Y1027 under identical fermentation conditions; and (f) Increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

4. The yeast strain or derivative according to any one of claims 1 to 3, wherein the yeast strain or the derivative has an ethanol yield that is at least about 3.3% higher relative to Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

5. The yeast strain or derivative according to any one of claims 1 to 3, wherein after 48 hours of fermentation, the yeast strain or the derivative has a fructose utilization efficiency that is at least about 5% higher relative to Saccharomyces cerevisiae strain Y1027.

6. The yeast strain or derivative according to any one of claims 1 to 3, wherein after 48 hours of fermentation, the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 11% higher than that of Saccharomyces cerevisiae strain Y1027.

7. The yeast strain or derivative according to any one of claims 1 to 3, wherein the yeast strain or the derivative has a fermentation rate that is at least about 1.5% higher than that of Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation.

8. The yeast strain or derivative according to any one of the preceding claims, wherein the yeast strain or the derivative has a higher temperature tolerance during fermentation at a fermentation temperature of 33 to 38°C relative to Saccharomyces cerevisiae strain Y1027.

9. The yeast strain or derivative according to claim 8, wherein the fermentation temperature is 33°C.

10. The yeast strain or derivative according to claim 8, wherein the fermentation temperature is 38°C.

11. The yeast strain or derivative according to any one of claims 1 to 10, wherein the yeast strain or derivative has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 when the fermentation pH is lowered from about 4.9 to about 4.0 in the presence of increasing amounts of organic acids in the fermentation medium.

12. The yeast strain or derivative according to claim 11, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

9.

13. The yeast strain or derivative according to any one of claims 3 to 11, wherein the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

14. A method for producing a derivative of the Saccharomyces yeast strain according to any one of claims 2 to 13, comprising: (1)(a) Provide: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain belongs to the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain; and (e) screening or selecting derivative strains; or (2)(a) Provide: (i) a first yeast strain, wherein the first yeast strain is selected from the group consisting of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) one or more additional yeast strains belonging to the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast strain and the one or more additional yeast strains to produce spores; (c) mixing all of the spores from step (b) to allow the spores to hybridize; and (d) Screening or selecting derivative strains.

15. The method of claim 14, wherein step (1)(c) comprises screening or selecting spores that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof; and step (1)(e) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof.

16. The method of claim 14, wherein step (2)(d) comprises screening or selecting hybrids that exhibit one or more defined characteristics of Saccharomyces strain Y2083, Y2084, Y2086, or Y2087.

17. A mutant yeast of the yeast strain according to claim 1 or the derivative according to claim 2.

18. A method for producing the mutant yeast according to claim 17, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.

19. The method of claim 18, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

20. A method for producing the mutant yeast according to claim 17, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.

21. The method of claim 20, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

22. An evolved yeast of the yeast strain according to claim 1 or a derivative according to claim 2.

23. A method of producing the evolved yeast according to claim 22, wherein evolution is induced by applying selective pressure to the yeast strain.

24. A method of producing the evolved yeast according to claim 22, wherein evolution is induced by applying selective pressure to the derivative.

25. A genetically modified yeast of the yeast strain of claim 1 or a derivative of claim 2.

26. The genetically modified yeast according to claim 25, wherein the nucleic acid sequence of the genetically modified yeast is altered using gene editing.

27. A recombinant yeast of the yeast strain according to claim 1 or the derivative according to claim 2.

28. The recombinant yeast according to claim 27, wherein the recombinant yeast comprises modifications of suppressing gene expression, enhancing gene expression, introducing a gene, or deleting a gene.

29. A method for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Deposit No. Y-68185, or a derivative thereof.

30. The method of claim 29, wherein the substrate comprises or is derived from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

31. The method of claim 29, wherein the yeast comprises one or more defining characteristics selected from the group consisting of: (a) Higher ethanol productivity compared to Saccharomyces strain Y1027 under the same fermentation conditions; (b) improved temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization efficiency compared to Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces strain Y1027 under the same fermentation conditions; (e) improved organic acid tolerance compared to Saccharomyces strain Y1027 under identical fermentation conditions; and (f) Increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

32. The method of any one of claims 29 to 31 , wherein the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature of 33 to 38°C.

33. The method of claim 32, wherein the fermentation temperature is 33°C.

34. The method of claim 32, wherein the fermentation temperature is 38°C.

35. The method according to any one of claims 29 to 34, wherein The yeast has a higher organic acid tolerance relative to Saccharomyces cerevisiae strain Y1027 in a fermentation medium having a pH decreased from about 4.9 to about 4.0 in the presence of increased organic acids.

36. The method of claim 35, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

9.

37. The method of claim 35, wherein the organic acids in the fermentation medium comprise 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

2.

38. The method of any one of claims 29 to 37, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

39. The method of any one of claims 29 to 37, wherein the ethanol is produced using starch.

40. The method of claim 39, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation.

41. The method according to any one of claims 29 to 37, wherein the ethanol is produced using sugar.

42. The method of claim 41, wherein the ethanol is produced using batch fermentation or continuous fermentation.

43. The method of any one of claims 29 to 37, wherein the ethanol is produced using lignocellulosic sugars.

44. The method of claim 43, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF).

45. A composition comprising the yeast strain according to claim 1 or the derivative according to claim 2 and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protective agents and antioxidants.

46. ​​The composition of claim 45, wherein the composition comprises one or more defining characteristics selected from the group consisting of: (a) Higher ethanol yield compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) improved temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) higher fructose utilization compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to S. cerevisiae strain Y1027 under the same fermentation conditions; (e) improved organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under identical fermentation conditions; and (f) Increased fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions.

47. A composition according to claim 45 or claim 46, wherein the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 at 33°C to 38°C.

48. A composition according to any one of claims 45 to 47, wherein the temperature is 33°C.

49. The composition of any one of claims 45 to 47, wherein the temperature is 38°C.

50. The composition of any one of claims 45 to 49, wherein the yeast has a greater tolerance to organic acids relative to Saccharomyces cerevisiae strain Y1027 when the pH is decreased from about 4.9 to about 4.0 in the presence of increased organic acids.

51. A composition according to any one of claims 45 to 50, wherein the organic acid comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid and has a pH of 4.

9.

52. A composition according to any one of claims 45 to 50, wherein the organic acid comprises 0.9% w / v lactic acid and 0.25% w / v acetic acid and has a pH of 4.

2.

53. A method of producing ethanol from biomass by contacting the biomass with the composition of claim 45.

54. The method of claim 53, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

55. The method of claim 53, wherein the ethanol is produced using starch.

56. The method of claim 53, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or continuous fermentation.

57. The method of claim 53, wherein the ethanol is produced using sugar.

58. The method of claim 53, wherein the ethanol is produced using batch fermentation or continuous fermentation.

59. The method of claim 53, wherein the ethanol is produced using lignocellulosic sugars.

60. The method of claim 53, wherein the ethanol is produced using simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF).

61. A method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from the group consisting of: (a) Saccharomyces strain Y2083, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of which has been deposited as NRRL Patent Accession No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of which has been deposited as NRRL Patent Deposit No. Y-68185, or a derivative thereof.

62. The method of claim 61, wherein the substrate comprises or is derived from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

63. The method of claim 61, wherein the fermentation product is ethanol.

64. The method of claim 63, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

65. The method of claim 61, wherein the fermentation product is produced using batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF).

Images