Application of breast milk oligosaccharide to improvement of intestinal flora environment under constipation condition

Abstract

The invention belongs to the field of food, and relates to application of breast milk oligosaccharide to improvement of intestinal flora environment under the condition of constipation, in particular to application of 2 '-fucosyllactose to preparation of food which is taken by a constipation body and contributes to regulation of intestinal flora and intestinal environment. The food provided by the invention can effectively improve functional constipation, and the improvement of functional constipation comprises the following steps: adjusting the abundance of beneficial bacteria and harmful bacteria in intestinal tracts, improving the diversity of intestinal flora, especially adjusting the abundance of some bacteria related to maintaining flora balance and promoting short-chain fatty acid production in the intestinal tracts, and improving the functional constipation. The content of short-chain fatty acid is increased.

Description

Technical Field

[0001] The invention relates to the use of human milk oligosaccharides for improving the intestinal flora environment in the case of constipation, and belongs to the field of food. Background Art

[0002] Constipation is a common digestive problem in infants, children, and adults. Depending on whether an organic lesion is present, constipation can be divided into functional constipation and organic constipation. Functional constipation (FC) is the most common type, presenting without obvious organic lesions. Its main clinical manifestations include decreased bowel movement frequency, changes in stool consistency, difficulty defecation, abdominal discomfort, and a feeling of incomplete defecation. Clinically, slow transit constipation (STC) is the most common type of functional constipation. Among childhood constipation cases, functional constipation accounts for over 90% of cases. Long-term, recurrent constipation can cause intestinal dysfunction, loss of appetite, impaired nutrient absorption, psychological abnormalities, and decreased immunity. These problems can affect children's memory and intellectual development, and may even lead to enuresis and incontinence, severely impacting their growth, development, and physical and mental health. If childhood constipation is not effectively treated, some children may develop other digestive system diseases in adulthood, severely impacting their quality of life.

[0003] There is a complex relationship between constipation and intestinal flora. Studies have shown that there are significant differences in the intestinal flora of patients with constipation and healthy people. For example, the abundance of certain bacterial genera (such as Coprobacillus, Hungatella, Holdemanella, Anaerostipes, Bacteroides, etc.) in the intestines of patients with constipation is significantly increased, while the abundance of other bacterial genera (such as Megasphaera, Paraprevotella, Prevotella, Enterococcus, etc.) is reduced. In addition, the diversity of intestinal flora in patients with constipation is usually lower than that in healthy people. Intestinal flora affects intestinal function by producing metabolites such as short-chain fatty acids (SCFA). SCFA can increase the water content of feces and the contractility of the colon, shorten the colon transit time, and thus relieve constipation. Intestinal flora can also indirectly affect the motility and secretory function of the intestine by regulating the host's immune system. Dysbiosis may lead to abnormal intestinal immune function, thereby affecting the normal function of the intestine.

[0004] Human milk oligosaccharides (HMOs) are the third most abundant nutrient in breast milk, after lactose and fat, and possess important biological functions. HMOs are water-soluble oligosaccharides secreted by the mammary glands during late pregnancy and lactation. They are composed of 3-23 monosaccharide molecules linked by glycosidic bonds. HMOs are lactose-derived oligosaccharides composed of five basic sugar units: D-glucose (Glc), D-galactose (Gal), N-acetylglucosamine (GlcNAc), L-fucose (Fuc), and sialic acid (Sia). N-acetylneuraminic acid (Neu5Ac) is the predominant form of sialic acid. HMOs can be divided into three categories based on the monomer attached to the end of the molecule: neutral fucosylated HMOs, neutral non-fucosylated HMOs, and acidic HMOs, accounting for 64-72%, 17-21%, and 11-15% of breast milk, respectively. Acidic HMOs can be further divided into those containing fucose and those not containing fucose.

[0005] Currently, studies have shown that HMOs in breast milk can regulate the intestinal flora of infants and young children.

[0006] For example, cited document 1 discloses an infant formula containing LNB and LNT II, ​​which has good anti-inflammatory effects, is conducive to the growth of beneficial bacteria and regulates the intestinal barrier.

[0007] Reference 2 discloses the use of oligosaccharides, such as 2'-fucosyllactose or a combination of fructooligosaccharides, galactoligosaccharides and 2'-fucosyllactose, in the preparation of a product for regulating intestinal flora, wherein the regulating of intestinal flora includes inhibiting the adhesion ability of pathogenic bacteria, and / or improving the competitive adhesion antibacterial ability of Lactobacillus rhamnosus, and / or improving the repulsive adhesion antibacterial ability of Lactobacillus rhamnosus.

[0008] Cited Document 3 discloses the use of human milk oligosaccharides to improve the intestinal flora of mothers and infants, specifically the use of 2'-fucosyllactose in the preparation of a food that, when ingested by a pregnant mother, helps regulate the intestinal flora of the mother and her offspring, said mother being pregnant and / or lactating. The invention proposes that supplementing a certain amount of 2'-fucosyllactose during pregnancy and / or lactation can significantly increase the abundance of beneficial bacteria and reduce the content of harmful bacteria in the mother's intestines. It also significantly increases the abundance of beneficial bacteria and reduces the content of harmful bacteria in the intestines of her offspring, particularly regulating the abundance of some non-edible beneficial bacteria in the intestines of both mothers and offspring.

[0009] Reference 4 discloses a human milk oligosaccharide composition and its application for improving the abundance of intestinal flora and stool odor in infants and young children. The human milk oligosaccharide composition includes 2'-FL, 3'-FL, 3'-SL or 6'-SL and ganglioside GM3. The human milk oligosaccharide composition, through the use of various proportions of human milk oligosaccharides, can increase the abundance of actinomycetes and firmicutes in the infant intestinal microbiome, increase the number of bifidobacteria and lactobacilli in infants and young children, and change the composition of the intestinal flora. It can also reduce intestinal pH and indole and skatole content, reduce the indole and skatole content in infant feces, improve the properties of infant feces, and produce the concentration of odorous compounds.

[0010] Reference 5 discloses human milk oligosaccharides that regulate butyrate and improve intestinal microenvironment health and their applications. The human milk oligosaccharides include 2'-FL, 3'-FL, 3'-SL, or 6'-SL. Improving intestinal microenvironment health includes regulating butyrate production in the intestinal system, increasing the overall production of short-chain fatty acids, which are utilized by intestinal flora as prebiotics and produce gas in the intestinal system, reducing the production of isobutyrate and isovaleric acid, and / or lowering the pH to maintain a healthy intestinal microenvironment.

[0011] Reference 6 discloses a prebiotic composition comprising 2'-FL, galacto-oligosaccharide (GOS) and fructo-oligosaccharide (FOS), which has a good regulating effect on intestinal flora and can enhance the body's immunity.

[0012] Although many existing technologies have revealed that human milk oligosaccharides have the function of regulating intestinal flora, most research directions are aimed at the intestinal flora of healthy organisms, and there are few reports on the impact on intestinal flora in constipation.

[0013] References:

[0014] Reference 1: CN119563717A

[0015] Reference 2: CN115836733A

[0016] Reference 3: CN119138609A

[0017] Reference 4: CN110839702A

[0018] Reference 5: CN114568504A

[0019] Reference 6: CN111838683A Summary of the Invention

[0020] Problems to be solved by the invention

[0021] Although prior art has disclosed the improvement effects of human milk oligosaccharides on intestinal flora, most of these studies have focused on healthy individuals, such as the intestinal flora of healthy infants, and there are few reports on their effects on intestinal flora in cases of constipation. It is known that the intestinal conditions of constipation are different from those in normal conditions. For example, in a disordered constipated intestinal environment, the number of harmful intestinal flora may increase, while the number of beneficial flora may decrease. Whether or how to alleviate constipation by improving the intestinal conditions of constipated people is possible is not an easy question.

[0022] The present invention relates to the use of 2'-fucosyllactose in improving the intestinal flora environment of constipated subjects, and its use in preparing foods that, when ingested by constipated subjects, help regulate the intestinal flora environment. Based on extensive research, the present invention proposes that supplementing a constipated subject with a certain amount of 2'-fucosyllactose can improve constipation, significantly increase the content of short-chain fatty acids, significantly increase the abundance of beneficial bacteria in the intestines, and reduce the abundance of harmful bacteria. The intestinal flora diversity is close to that of normal mice, and in particular, the abundance of bacterial genera in the intestine that are associated with maintaining flora balance and promoting the production of short-chain fatty acids can be regulated.

[0023] Solutions for solving problems

[0024] [1]. Use of 2'-fucosyllactose in the preparation of food for improving constipation, wherein the constipation is functional constipation.

[0025] [2] The use according to [1], wherein the constipation improvement comprises at least one of (a1) to (a3):

[0026] (a1) Increase the water content of feces;

[0027] (a2) Improve intestinal motility;

[0028] (a3) Regulates the SCF / C-kit signaling pathway.

[0029] [3] The use according to [2], wherein the regulation of the SCF / C-kit signaling pathway comprises increasing the expression of SCF and C-kit mRNA in colon tissue.

[0030] [4] The use according to any one of [1] to [3], wherein the constipation improvement further comprises regulating the intestinal flora structure;

[0031] Optionally, regulating the intestinal flora structure includes reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.

[0032] [5] The use according to any one of [1] to [4], characterized in that the abundance and diversity of intestinal flora are improved;

[0033] Optionally, said increasing the abundance and diversity of intestinal flora comprises increasing the relative abundance of Verrucomicrobia;

[0034] Optionally, the improving the abundance and diversity of intestinal flora includes improving the relative abundance of Bacteroides, Akkermansia, Odoribacter, Parabacteroides, and the relative abundance of one or more bacterial genera of the genera Ruminococcus, Lactobacillus and Brevibacterium.

[0035] [6] The use according to any one of [1] to [5], wherein the constipation improvement further comprises restoring the content of short-chain fatty acids in the intestine;

[0036] Optionally, restoring the content of short-chain fatty acids in the intestine includes increasing the content of at least one of acetic acid, propionic acid, butyric acid and valeric acid.

[0037] [7]. Use of 2'-fucosyllactose in the preparation of food for improving the intestinal flora environment under constipation conditions, wherein the constipation is functional constipation.

[0038] [8] The use according to [7], wherein the improvement of the intestinal flora environment under constipation conditions includes increasing the abundance and diversity of intestinal flora, and / or regulating the structure of intestinal flora;

[0039] Optionally, said increasing the abundance and diversity of intestinal flora comprises increasing the relative abundance of Verrucomicrobia;

[0040] Optionally, improving the abundance and diversity of intestinal flora includes increasing the relative abundance of Bacteroides, Akkermansia, Odoribacter, Parabacteroides, and the relative abundance of one or more bacterial genera of the genus Ruminococcus, Lactobacillus, and Brevibacterium;

[0041] Optionally, regulating the intestinal flora structure includes reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.

[0042] [9]. The use according to any one of [1] to [8], wherein the food is in the form of solid, semi-solid or liquid at room temperature.

[0043]

[10] The use according to any one of [1] to [9], wherein the food is an oral preparation; the oral preparation comprises at least one of tablets, pills, granules, powders, teas, capsules and oral liquids.

[0044]

[11] . The use according to any one of [1] to

[10] , wherein the mass content of 2'-fucosyllactose in the food is at least 0.05%.

[0045] Effects of the Invention

[0046] The food containing 2'-fucosyllactose provided by the present invention can significantly improve the condition of constipation, specifically including increasing the water content of feces and improving intestinal peristalsis. Furthermore, it has been found that it can improve the abundance and diversity of intestinal flora and increase the content of short-chain fatty acids in the intestine, more specifically including: increasing the relative expression of SCF and C-kit mRNA in colon tissue to relieve constipation; the diversity of intestinal flora is improved and the difference with normal mice is reduced; the intestinal flora at the phylum level, such as Firmicutes and Bacteroidetes, and the F / B value are closer to normal mice; the intestinal flora at the genus level, such as Bacteroides and Akkermansia, are closer to normal mice; the relative abundance of beneficial bacteria genera such as Lactobacillus, Akkermansia, Anaerobic Truncation, Anaerobic Plasmodium, and Anaerobic Steineria is significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Figure 3 shows the feces morphology of mice; A: feces of mice in group K; B: feces of mice in group M; C: feces of mice in group Y.

[0048] Figure 2 The effect of different doses of 2'-FL on the α-diversity of intestinal flora in constipated mice.

[0049] Figure 3 Effects of different doses of 2'-FL on the β-diversity of intestinal flora in constipated mice; A: PCoA analysis; B: NMDSI analysis.

[0050] Figure 4 Effects of different doses of 2'-FL on the relative abundance of intestinal flora in constipated mice (phylum level); A: bar graph of the average relative abundance of species in the intestinal flora of each group of mice at the phylum level; B: relative abundance of Bacteroidetes; C: relative abundance of Firmicutes; D: ratio of the relative abundance of Bacteroidetes to the relative abundance of Firmicutes; different letters indicate significant differences among the treatment groups (P < 0.05).

[0051] Figure 5 Effects of different doses of 2'-FL on the relative abundance of intestinal microbiota in constipated mice (genus level); A: Bar graph of the average relative abundance of species at the genus level for each group; B: Relative abundance of Bacteroides; C: Relative abundance of Parabacteroides; D: Relative abundance of Odoribacter; E: Akkermansia. Different letters indicate significant differences among treatment groups (P < 0.05).

[0052] Figure 6 Analysis of LEfSe species differences in the intestinal flora of mice in groups treated with different doses of 2'-FL; A: taxonomic branch diagram; B: LDA histogram. DETAILED DESCRIPTION

[0053] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0054] In addition, numerous specific details are provided in the following detailed description to better illustrate the present invention. Those skilled in the art will appreciate that the present invention can be practiced without certain specific details. In other instances, methods, means, equipment, and steps well known to those skilled in the art are not described in detail in order to highlight the main points of the present invention.

[0055] Unless otherwise stated, the units used in this specification are international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0056] In this specification, the use of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

[0057] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "embodiments," etc., mean that the specific elements (e.g., features, structures, properties, and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0058] As used herein, "optional" and "optionally" mean that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0059] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints A and B.

[0060] In this specification, when "normal temperature" or "room temperature" is used, the temperature may be 23±2°C.

[0061] In addition, unless otherwise defined, other technical and scientific terms used in the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0062] The present invention is mainly completed based on the following insights:

[0063] Human milk oligosaccharides have been shown to improve the intestinal flora of infants, but most of the research subjects are focused on the intestinal environment of healthy infants. There are no reports on improving the intestinal environment in constipated conditions. The impact of human milk oligosaccharides on the intestinal environment in a constipated state is still unknown, and whether or how to improve the intestinal conditions in constipated conditions can be used to alleviate constipation is not easy to know. The present invention constructed a constipation mouse model and administered 2'-fucosyllactose to the model. It was unexpectedly found that 2'-fucosyllactose can improve the constipation symptoms of mice, and has a significant promoting effect on increasing the abundance of microorganisms in the intestine, reducing the ratio of Firmicutes to Bacteroidetes, improving the SCF / C-kit pathway, and increasing the content of short-chain fatty acids.

[0064] That is, the present invention relates to the use of 2'-fucosyllactose in preparing a food for improving (functional) constipation. At the same time, the present invention relates to the use of 2'-fucosyllactose in preparing a food having one or more of the following effects (a1) to (a6).

[0065] (a1) Increase the water content of feces;

[0066] (a2) Improve intestinal motility;

[0067] (a3) Improve the abundance and diversity of intestinal flora;

[0068] (a4) regulating the structure of intestinal flora;

[0069] (a5) regulates the SCF / C-kit signaling pathway;

[0070] (a6) Restore the content of short-chain fatty acids in the intestine.

[0071] I. 2'-fucosyllactose

[0072] The 2'-fucosyllactose (2'-FL) described in the present invention is a neutral trisaccharide composed of L-fucose, D-galactose and D-glucose units, wherein the monosaccharide L-fucose is linked to the disaccharide D-lactose via an α(1→2) bond. Its molecular formula is C 18 H 31 O 15 , molecular weight is 488.439 g / mol.

[0073] The present invention does not particularly limit the source of the 2'-fucosyllactose, and it can be, for example, natural, synthetic, or derived from microbial fermentation. Typically, 2'-fucosyllactose can be synthesized through steps such as a glycosylation reaction between a lactose acceptor and a fucosyl donor. Alternatively, exogenously added lactose can be used as a substrate, and 5'-diphosphate guanosine-fucose disodium salt formed by the microorganism's own metabolic pathway is used as a precursor to synthesize 2'-fucosyllactose under the action of a fucosyltransferase. In some embodiments, the mass content of 2'-fucosyllactose can be 60% or more, preferably 80% or more, more preferably 90% or more, or any other content, relative to the total mass of the products from each source of 2'-fucosyllactose.

[0074] II. Food

[0075] The food of the present invention contains or uses the above-mentioned human milk oligosaccharides, especially 2'-fucosyllactose.

[0076] The present invention is not particularly limited to the specific form of the food. At room temperature, the edible nutrient is solid, semi-solid, or liquid, and can illustratively include a drinkable composition, a powdered or granular composition, a gel, or a frozen or partially frozen composition. The food can optionally form part of a capsule filling, or can optionally form part of a beverage, dairy product, non-dairy cream, sauce, or baked product.

[0077] In some specific embodiments, the food can be powdered reconstituted food (solid beverages, instant coffee, cereal powder, nut powder or lotus root powder, etc.), baked food (bread, cake or biscuit baked food, etc.), beverages (carbonated beverages, fruit and vegetable juice beverages, functional beverages, tea beverages, milk beverages or alcoholic beverages, etc.), candy (jelly candy, hard candy, compressed candy, etc.), milk and dairy products (fresh milk from fresh cow (sheep) milk, milk powder, whey powder, fermented milk, cheese or condensed milk, etc.), etc.

[0078] In some other specific embodiments, the food of the present invention may also be a health food, such as various types of oral preparations, including but not limited to tablets, pills, granules, powders, teas, capsules or oral liquids.

[0079] The present invention does not particularly limit the absolute content of 2'-fucosyllactose in food, as long as it meets the requirements of local food laws and regulations. In some embodiments, the mass content of 2'-fucosyllactose is at least 0.05%, preferably at least 0.1%, more preferably at least 1%, and even more preferably at most 12%, relative to the total mass of the food.

[0080] In addition to the 2'-fucosyllactose, other ingredients commonly found in food may also be included, such as proteins / amino acids, carbohydrates, fats, vitamins, minerals, and the like. Furthermore, depending on the type of food and the ultimate needs of the intended recipient, in some embodiments, the food of the present invention further includes any one or more of the following ingredients: plant product ingredients, animal dairy product ingredients, animal meat product ingredients, functional additives, and any acceptable excipients.

[0081] For plant product ingredients, examples include fruits such as figs, pomegranates, kiwis, tangerines, oranges, pineapples, strawberries, apples, bananas, grapes, pears, cherries, blueberries, blackberries, blackcurrants, cranberries, raspberries, melons, emblica and bilberry or their extracts; vegetables such as onions, cucumbers, tomatoes, cauliflower, carrots, spinach, kale, Brussels sprouts, garlic, basil, oregano or their extracts; rice (indica rice) , japonica rice, glutinous rice), wheat (wheat, barley, oats, rye), corn, sorghum, millet, sorghum, millet, yellow rice, buckwheat, soybeans, broad beans, peas, mung beans, red beans, kidney beans and other grains or their extracts; walnuts, pistachios, cashews, hazelnuts, almonds, apricots, pine nuts, peanuts, melon seeds, chestnuts, macadamia nuts, ginkgo nuts and other nuts or their extracts; coffee or its extract; and some Chinese medicinal plants with edible properties or their extracts.

[0082] Examples of animal dairy ingredients include fresh milk from mammals such as cows, sheep, and camels, as well as reprocessed dairy products such as whole milk powder, skim milk powder, concentrated whey protein powder, desalted whey powder, whey protein powder, and hydrolyzed whey protein powder.

[0083] Examples of animal meat product ingredients include meat product ingredients from pigs, cattle, sheep, aquatic products, poultry, and the like.

[0084] Functional added ingredients include vitamin supplements, mineral supplements, nucleotide supplements, dietary fiber, functional polyunsaturated fatty acid supplements, and the like.

[0085] As for any acceptable excipients, examples include solvents, antioxidants, antibacterial agents, thickeners, diluents, cosolvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, edible flavors, edible pigments, etc.

[0086] III. Uses for improving constipation

[0087] The present invention unexpectedly discovered that 2'-fucosyllactose can effectively improve constipation, especially functional constipation. This improvement includes one or more of the following: regulating the SCF / C-kit signaling pathway, increasing fecal water content, enhancing intestinal motility, increasing intestinal flora abundance, regulating intestinal flora structure, and restoring intestinal short-chain fatty acid content.

[0088] In some embodiments, the SCF (stem cell factor) / C-kit signaling pathway plays a key role in regulating gastrointestinal motility, and its dysfunction is closely related to the occurrence of constipation. It primarily acts on interstitial cells of Cajal (ICC), regulating the rhythmic contraction of smooth muscle by generating slow-wave potentials, directly affecting gastrointestinal motility. In the colon tissue of constipated mice, the mRNA levels of SCF and C-kit were significantly decreased compared with the blank control group. However, after the administration of 2'-fucosyllactose, the mRNA expression levels of SCF and C-kit in the colon tissue of constipated mice were significantly increased.

[0089] In some embodiments, the improvement of intestinal motility includes increasing the intestinal movement rate and shortening the time to the first black stool.

[0090] In some embodiments, the present invention performs α diversity analysis, β diversity analysis, phylum level difference analysis, genus level difference analysis, and LEfSe species difference analysis on the intestinal flora of mice, and finds that the 2'-fucosyllactose provided in the present invention can improve the decreased abundance and diversity of intestinal flora in constipated mice.

[0091] In some specific embodiments, the improvement of the decreased abundance and diversity of intestinal flora in constipated mice includes an increase in Chao1, Observed species, Shannon and Simpson indices; a reduction in the difference in flora diversity compared with normal mice, and an alleviation of the change in β diversity of intestinal flora in constipated mice.

[0092] In some specific embodiments, at the phylum level of the intestinal flora, 2'-fucosyllactose can reduce the relative abundance of Firmicutes in the intestines of constipated mice and increase the relative abundance of Bacteroidetes and Verrucomicrobia. Constipation increases the relative abundance of Firmicutes in the intestines of mice and reduces the relative abundance of Bacteroidetes, resulting in a significant increase in the ratio of Firmicutes to Bacteroidetes (F / B ratio) compared to normal mice. The F / B ratio is an important indicator of the composition of the intestinal flora, and its imbalance is closely related to the occurrence and development of constipation. After the administration of 2'-fucosyllactose, the increase in the F / B ratio can be significantly improved, thereby improving the constipation condition.

[0093] In some specific embodiments, at the genus level of intestinal flora, 2'-fucosyllactose can improve the relative abundance of Bacteroides, Akkermansia, Odoribacter, and Parabacteroides.

[0094] In some exemplary embodiments, 2'-fucosyllactose can increase the relative abundance of Bacteroides, which is associated with promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in the intestinal flora.

[0095] In some exemplary embodiments, 2'-fucosyllactose can enhance Akkermansia, which is associated with maintaining the balance of intestinal flora and intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation.

[0096] In some exemplary embodiments, 2'-fucosyllactose can increase the relative abundance of Odoribacter and Parabacterodes, which are related to sugar metabolism and short-chain fatty acid secretion.

[0097] In some specific embodiments, 2'-fucosyllactose can increase the relative abundance of Ruminococcus, which is associated with the intestinal flora and can promote the production of short-chain fatty acids, maintain intestinal health, and inhibit the growth of harmful microorganisms.

[0098] In some specific embodiments, 2'-fucosyllactose can increase the relative abundance of Lactobacillus, which is associated with maintaining the balance of intestinal flora and the intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation, and increase the relative abundance of other beneficial intestinal bacteria, Brevibacterium.

[0099] In some embodiments of the present invention, 2'-fucosyllactose improves constipation by improving the intestinal flora. In particular, high doses of 2'-fucosyllactose have a more significant effect on improving the abundance and diversity of intestinal flora, and also have a more pronounced effect on improving constipation.

[0100] Furthermore, the present invention also found that, consistent with the improvements in intestinal flora abundance and structure, 2'-fucosyllactose significantly promoted the restoration of short-chain fatty acid content in the intestines of constipated mice. The present invention found that the levels of short-chain fatty acids, including formic acid, acetic acid, propionic acid, and butyric acid, in the intestines of constipated mice were significantly reduced. After administration of 2'-fucosyllactose, the levels of short-chain fatty acids were restored, and high doses of 2'-fucosyllactose showed a particularly effective restorative effect.

[0101] Therefore, the food containing 2'-fucosyllactose provided by the present invention helps to relieve constipation, especially functional constipation. The improvement of constipation in the present invention is not intended to prevent or treat diseases.

[0102] IV. Use of Improving the Intestinal Flora Environment in Constipation

[0103] The present invention also found that 2'-fucosyllactose can improve the intestinal flora environment under constipation conditions, especially functional constipation conditions.

[0104] In some embodiments, improving the intestinal flora environment under constipation conditions includes increasing the abundance and diversity of intestinal flora and regulating the structure of intestinal flora.

[0105] In some specific embodiments, at the phylum level of the intestinal flora, 2'-fucosyllactose can reduce the relative abundance of Firmicutes in the intestines of constipated mice and increase the relative abundance of Bacteroidetes and Verrucomicrobia. Furthermore, constipation increases the relative abundance of Firmicutes in the intestines of mice and reduces the relative abundance of Bacteroidetes, resulting in an increase in the ratio of Firmicutes to Bacteroidetes (F / B ratio), which is an important indicator of intestinal flora composition, and its imbalance is closely related to the occurrence and development of constipation. After the administration of 2'-fucosyllactose, the increase in the F / B ratio can be significantly improved, thereby improving the constipation condition.

[0106] In some specific embodiments, at the genus level of intestinal flora, 2'-fucosyllactose can improve the relative abundance of Bacteroides, Akkermansia, Odoribacter, and Parabacteroides.

[0107] In some exemplary embodiments, 2'-fucosyllactose can increase the relative abundance of Bacteroides, which is associated with promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in the intestinal flora.

[0108] In some exemplary embodiments, 2'-fucosyllactose can enhance Akkermansia, which is associated with maintaining the balance of intestinal flora and intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation.

[0109] In some exemplary embodiments, 2'-fucosyllactose can increase the relative abundance of Odoribacter and Parabacterodes, which are related to sugar metabolism and short-chain fatty acid secretion.

[0110] In some specific embodiments, 2'-fucosyllactose can increase the relative abundance of Ruminococcus, which is associated with the intestinal flora and can promote the production of short-chain fatty acids, maintain intestinal health, and inhibit the growth of harmful microorganisms.

[0111] In some specific embodiments, 2'-fucosyllactose can increase the relative abundance of Lactobacillus, which is associated with maintaining the balance of intestinal flora and the intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation, and increase the relative abundance of other beneficial intestinal bacteria, Brevibacterium.

[0112] In some embodiments of the present invention, 2'-fucosyllactose has a good effect on improving intestinal flora, especially high doses of 2'-fucosyllactose have a more significant effect on improving the abundance and diversity of intestinal flora and the flora structure.

[0113] Furthermore, the food containing 2'-fucosyllactose provided by the present invention helps to alleviate the intestinal flora environment under constipation conditions, especially the intestinal flora environment under functional constipation conditions. The improvement of the intestinal flora environment of the present invention is not intended to prevent or treat diseases.

[0114] Example

[0115] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0116] 1 Materials and Methods

[0117] 1.1 Raw materials:

[0118] Table 1 Experimental raw materials

[0119] raw material Product Name company batch number 1 2'-FL 2'-fucosyllactose DSM NO:DK22296001

[0120] 1.2 Animal Experiment Design

[0121] Sixty healthy male BALB / c mice (6 weeks old, 20 g) were housed under a 12-h light / dark cycle, 25 ± 2°C, and 55%-65% humidity. They had free access to sterile water and normal chow throughout the experiment. After one week of adaptive feeding, they were randomly divided into six groups of 10 mice each: a blank group (K), a constipation model group (M), a positive control group (Y), a high-dose 2'-FL group (H2), a medium-dose 2'-FL group (M2), and a low-dose 2'-FL group (L2). Except for the blank group, mice in all other groups received loperamide (10 mg / kg bw) orally at 9:00 AM daily. The blank group received an equal volume of saline for 7 days. Starting on day 8, group K received daily orally with saline, while the remaining groups received loperamide (10 mg / kg bw). Two hours after loperamide gavage, group M was gavaged with normal saline, group Y was gavaged with 2.5 mg / kg·bw mosapride, and groups H2, M2, and L2 were gavaged with 2500, 1500, and 500 mg / kg·bw 2'-FL, respectively. On day 29, mice were fasted for 12 hours (with free access to water), and colon and cecal contents were collected in sterile centrifuge tubes for subsequent microbial sequencing analysis. All remaining animal tissues were frozen in a -80°C freezer until use.

[0122] Table 2 Experimental groups

[0123]

[0124] 1.3 Health Index

[0125] During the mouse breeding period, the mice were observed daily for defecation, activity, and death. In addition, the mice's weight, water intake, and food intake were recorded at the same time every day.

[0126] 1.4 Determination of constipation-related indicators

[0127] Fecal moisture content: Feces were collected on days 14 and 28 of feeding and dried to constant weight to obtain the dry weight and moisture content of the feces. At the same time, the fecal sample collected on day 28 was stored at -80°C for analysis of short-chain fatty acids and intestinal microbiota. The fresh mouse feces were weighed and recorded as wet weight. Then, the feces were dried at 105°C for 5 hours to constant weight, then weighed and recorded as dry weight:

[0128] Fecal moisture content = (wet weight - dry weight) / dry weight × 100%

[0129] Defecation time: On day 28, all mice were fasted overnight for 12 hours and then gavaged with activated carbon solution (10% activated carbon, 0.5% carboxymethylcellulose suspension). The mice were then placed in metabolic cages. The time between activated carbon ingestion and dark feces was recorded.

[0130] Gastrointestinal transit rate: Activated carbon solution was administered orally for 29 days. Thirty minutes later, all animals were euthanized by cervical dislocation, and the small intestine was collected by dissection. The distance from the pylorus to the border of the activated carbon was considered the migration distance. After measuring this length, the gastrointestinal transit rate was calculated using the following formula:

[0131] Gastrointestinal transit rate = activated carbon migration distance / total length of small intestine × 100%

[0132] Total mRNA was extracted from mouse colon using an RNA extraction kit, and cDNA was synthesized using a reverse transcription kit according to the manufacturer's instructions. PCR was performed using SYBR Green Master Mix. Genes tested included SCF and C-kit in colon tissue.

[0133] SCF-F: AGCTTGACTACTCTTCTGGACA (SEQ ID NO: 1)

[0134] SCF-R: TGGCCTCTTCGGAGATTCTTTT (SEQ ID NO: 2)

[0135] C-kit-F:GGCCTCACGAGTTCTATTTACG(SEQ ID NO:3)

[0136] C-kit-R:GGGGAGAGATTTCCCATCACAC(SEQ ID NO:4)

[0137] Actin-F: GATATCGCTGCGCTGGTCG (SEQ ID NO: 5)

[0138] Actin-R: CATTCCCACCATCACACCCT(SEQ ID NO:6)

[0139] 1.5 High-throughput analysis of colonic microbiota

[0140] After each group of mice was sacrificed by cervical dislocation, the intestinal contents were collected into sterile cryovials, quickly stored in liquid nitrogen, and then frozen at -80°C. First, total DNA was extracted from the samples using a DNA kit and quality tested. After passing the test, the 16S rDNA hypervariable region (V3-V4 region) was sequenced. Microbial populations were classified according to their 16S rDNA similarity. MiSeq libraries were constructed and 16S rDNA sequencing was performed by a sequencing company. The raw data were then subjected to bioinformatics analysis. Cluster analysis was performed on the filtered valid tags to obtain representative sequences of operational taxonomic units (OTUs). The OTU sequences were annotated to identify the corresponding microbial species. The abundance and structural changes of the intestinal microbiome species in each group of mice were analyzed at the phylum and genus levels, and species differences were identified using LEfSe analysis.

[0141] V3-V4 region amplification primer-F: ACTCCTACGGGAGGCAGCA (SEQ ID NO: 7)

[0142] V3-V4 region amplification primer-R: GGACTACHVGGGTWTCTAAT (SEQ ID NO: 8)

[0143] 1.6 Determination of fecal short-chain fatty acid content

[0144] Levels of acetic acid, propionic acid, butyric acid, and valeric acid in mouse feces were determined using gas chromatography-mass spectrometry (GC-MS). Briefly, 100 mg of fecal sample was homogenized with 1 mL of 0.5% phosphoric acid and centrifuged at 12,000 × g for 10 min. The collected supernatant was mixed with 500 μL of ethyl acetate and then analyzed by passing through a 0.22 μm PVDF membrane. SCFAs were separated using a GC-MS system equipped with an Agilent DB-WAX capillary column (30 m × 0.25 mm ID × 0.25 μm, 0.25 μm film thickness, 5% phenylmethylsiloxane). Helium (99.999%) was used as the carrier gas at a rate of 1.00 mL / min. The column temperature was initially set to 90°C, gradually increased to 150°C at 10°C / min, then to 230°C at 20°C / min, and finally held for 3 min. The ion source temperature, forward sample orifice temperature, and interface temperature were set at 230, 250, and 280° C. The detector was operated in electron impact ionization mode (electron energy 70 eV) with a scan range of 30–250 m / z.

[0145] 1.7 Statistical analysis

[0146] The experimental data are expressed as mean ± standard deviation. SPSS 26.0 software was used for statistical analysis. One-way analysis of variance was used to compare the differences between the groups using Turkey test. P < 0.05 was considered to be a significant difference between the data, and P > 0.05 was considered to be insignificant.

[0147] 2 Experimental results

[0148] 2.1 Effects of human milk oligosaccharides on constipation indicators in mice

[0149] The fecal characteristics of mice are one of the important indicators for successfully establishing a constipation model. Figure 1 As shown in A, the feces of the blank group mice were cylindrical and smooth in surface. Compared with the blank group mice, the feces of the model group mice had a dull, hard, dry, and granular surface ( Figure 1 B). Compared with the model group, the feces of the mice in the positive drug group were moist and cylindrical, and the feces length was close to that of the blank group ( Figure 1 C). Fecal moisture content is one of the important indicators reflecting the degree of constipation in mice. The effect of human milk oligosaccharides on the fecal moisture content of mice is shown in Table 3. Compared with the K group, the fecal moisture content of mice in the M group was significantly reduced (P<0.05), indicating that the administration of loperamide caused the feces to become dry and hard. Compared with the M group, the fecal moisture content of mice in the Y group was significantly increased (P<0.05). After intervention with different doses of 2'-FL, the fecal moisture content was significantly higher than that in the M group (P<0.05). Among them, the fecal moisture content of the H2 and M2 groups was not significantly different from that of the K group (P>0.05). The time to the first black stool can reflect the peristaltic ability of the entire gastrointestinal tract. The longer the time to the first black stool, the weaker the peristaltic ability of the mouse gastrointestinal tract. As shown in Table 3, the time to first black stool was significantly longer in group M than in group K. Compared with group M, the time to first black stool was significantly reduced in group Y (P < 0.05), indicating that mosapride effectively improves gastrointestinal motility. Compared with group M, treatment with different doses of 2'-FL significantly reduced the time to first black stool (P < 0.05). Intestinal transit rate (ITR) reflects the motility of the entire gastrointestinal tract and is an important indicator for evaluating constipation. A faster ITR indicates a more favorable stool excretion. As shown in Table 3, ITR was significantly reduced in group M compared with group K (P < 0.05), similar to the results for ITR and fecal water content, indicating that the constipation model was successfully established. Compared with group M, treatment with the positive drug and different doses of 2'-FL significantly increased ITR (P < 0.05). These results demonstrate that 2'-FL can significantly improve loperamide-induced constipation in mice.

[0150] The SCF / C-kit pathway plays a vital role in the treatment of constipation. SCF / C-kit signaling is crucial for the development, differentiation and phenotypic maintenance of interstitial cells of Cajal (ICC). Abnormalities in the SCF / C-kit signaling pathway may lead to impaired number and function of ICC, thereby affecting the conduction of intestinal nerve signals and the motor function of intestinal smooth muscle, resulting in a slowdown in the transmission of intestinal contents and causing constipation symptoms. The present invention studied the effect of 2'-FL on the mRNA expression of SCF and C-kit in the colon tissue of constipated mice by RT-qPCR, and the results are shown in Table 4. Compared with the blank K group, the relative mRNA expression levels of SCF and C-kit in the M group mice after loperamide intervention were significantly reduced (P<0.05). Compared with the model M group, after treatment with different doses of 2'-FL, the mRNA expression levels of C-kit in the colon tissue of mice were significantly increased (P<0.05). After treatment with different doses of 2'-FL, the mRNA expression levels of C-kit in the colon tissue of mice were significantly increased (P<0.05). After treatment with high and medium doses of 2'-FL, SCF mRNA expression in the colon tissue of mice was significantly increased (P<0.05). These results indicate that 2'-FL can significantly regulate SCF / C-kit mRNA expression levels, thereby alleviating loperamide-induced constipation.

[0151] Table 3 Effects of human milk oligosaccharides on defecation indicators in mice

[0152]

[0153] Note: *P<0.05 compared with blank control group K; # Compared with model M group P<0.05

[0154] Table 4 Effects of human milk oligosaccharides on the relative expression of SCF and C-kit mRNA in mouse colon tissue

[0155] Example Dose group SCF C-kit Comparative Example 1 Blank group (K) 1.03±0.06 1.03±0.04 Comparative Example 2 Model group (M) <![CDATA[0.46±0.04 * ]]> <![CDATA[0.34±0.03 * ]]> Comparative Example 3 Positive group (Y) <![CDATA[0.76±0.03 *# ]]> <![CDATA[0.73±0.03 *# ]]> Experimental Example 1 High-dose 2'-FL group (H2) <![CDATA[0.78±0.05 *# ]]> <![CDATA[0.79±0.04 *# ]]> Experimental Example 2 Medium-dose 2'-FL group (M2) <![CDATA[0.61±0.04 *# ]]> <![CDATA[0.63±0.03 *# ]]> Experimental Example 3 Low-dose 2'-FL group (L2) <![CDATA[0.58±0.04 * ]]> <![CDATA[0.57±0.03 *# ]]>

[0156] Note: *P<0.05 compared with blank control group K; # Compared with model M group P<0.05

[0157] 2.2 Intestinal flora:

[0158] 2.2.1: Effects of 2'-FL on the intestinal flora of constipated mice

[0159] (1) Analysis of α-diversity of intestinal flora in mice treated with different doses of 2'-FL

[0160] The α diversity index of each group of samples is as follows Figure 2As shown, compared with the blank K group, the Chao1 index and observed species index of mice with loperamide-induced constipation (M group) were significantly decreased (P < 0.05). However, after oral administration of different doses of 2'-FL, the Chao1 index and observed species index of mice in each group increased to varying degrees. These results indicate that 2'-FL can improve the reduced number of intestinal microbial species in constipated mice, with mice treated with a high dose of 2'-FL having a more significant recovery effect on the number of intestinal microbial species. Furthermore, the Shannon and Simpson indices of the intestinal microbial population in mice with loperamide-induced constipation were extremely significantly decreased (P < 0.01). After oral administration of different doses of 2'-FL, the Shannon and Simpson indices of mice in each group increased to varying degrees, indicating that 2'-FL can restore the diversity of the intestinal microbial population in constipated mice. Notably, mice treated with a high dose of 2'-FL (H2 group) had a more significant recovery effect on the diversity of the intestinal microbial population. The results showed that high-dose 2'-FL intervention had a more significant effect on restoring the richness and diversity of intestinal flora in mice with loperamide-induced constipation.

[0161] (2) Analysis of β-diversity of intestinal flora in mice treated with different doses of 2'-FL

[0162] PCA analysis of mice in different groups Figure 3 As shown in A, the contribution rate of PC1 (first principal component) is 41.7%, the contribution rate of PC2 (second principal component) is 18.1%, and the sum of the contribution rates of PC1 and PC2 is greater than 30%, indicating that the constipation model of mice in this study was successfully established. As can be seen from the figure, the blank group (Group K) is distributed in the leftmost area of ​​the figure, while the model group (Group M) is distributed in the rightmost area of ​​the figure, indicating that compared with the control group mice, the intestinal flora of mice with loperamide-induced constipation has changed significantly. The groups after intervention with different doses of 2'-FL concentrated close to the blank group, and reduced the distance between them and the blank group (Group K) to varying degrees. Among them, the high-dose 2'-FL intervention group (Group H2) was closer to the normal group (Group K), indicating that after high-dose 2'-FL intervention, the difference in flora with normal mice can be reduced, and the intestinal flora structure of mice can be significantly restored. NMDSI analysis of mice in different groups is shown in Figure 2. Figure 3As shown in Figure B, similar to the PCoA analysis results, the blank group (K group) is distributed in the leftmost area of ​​the figure, while the model group (M group) is distributed in the rightmost area of ​​the figure. There is no overlap between the blank K group and the model M group. The results indicate that the intestinal flora of mice with loperamide-induced constipation undergoes significant changes. However, the groups treated with different doses of 2'-FL converged towards the blank K group, reducing the distance from the blank group (K group) to varying degrees. Among them, the group treated with a high dose of 2'-FL (H2 group) had a certain area of ​​overlap with the blank K group, indicating that high-dose 2'-FL treatment can reduce the difference in flora with normal mice and more significantly restore the intestinal flora structure of mice than medium and low doses.

[0163] (3) Differences in intestinal flora at the phylum level among mice treated with different doses of 2'-FL

[0164] The phylum levels of intestinal flora in each group of mice treated with different doses of 2'-FL are as follows Figure 4 As shown, a total of 10 major bacterial groups were detected in the intestinal contents of the colon of each group of mice, including Bacteroidetes, Firmicutes, Verrucomicrobia, Proteobacteria, Actinobacteria, TM7, Tenericutes, Deferribacteres, Cyanobacieria, and Acidobacteria. The 10 bacterial phyla detected accounted for more than 99% of the total intestinal flora of each group of mice, among which Bacteroidetes and Firmicutes were the most abundant phyla and had an absolute advantage in terms of quantity. The bacterial community structure of each group was similar, but the proportion of bacterial community composition was different. From Figure 4 It can be seen that:

[0165] ① The average relative abundance of Bacteroidetes in the colonic intestinal contents of mice in the blank group (K group) was 68.08%; in the model group (M group), the proportion of Bacteroidetes was 49.01%; in the mice treated with low, medium, and high doses of 2'-FL (L2, M2, and H2 groups), the proportions of Bacteroidetes were 45.82%, 53.67%, and 56.45%, respectively.

[0166] ②For the Firmicutes in the colonic intestinal contents of each group of mice, the average relative abundance in the blank group (K group) was 21.35%; in the model group (M group), it was 49.55%; in the mice treated with low, medium and high doses of 2'-FL (L2, M2, H2 groups), it was 42.89%, 40.63% and 28.67%, respectively.

[0167] ③For Actinobacteria, the average relative abundance in the blank group (K group) was 2.03%; in the model group (M group), it was 0.98%; in mice treated with low, medium, and high doses of 2'-FL (L2, M2, and H2 groups), it was 5.63%, 1.30%, and 2.45%, respectively.

[0168] ④For Verrucomicrobia, the average relative abundance in the blank group (K group) was 3.53%; in the model group (M group), it was 0.96%; and in mice treated with high-dose 2'-FL (H2 group), it was 4.97%.

[0169] ⑤ Compared with the blank group mice, the relative abundance of Firmicutes in the intestinal flora of loperamide-induced constipation mice (M group) increased significantly, and the Bacteroidetes decreased significantly (P < 0.05). At the same time, the ratio of Firmicutes to Bacteroidetes increased significantly (P < 0.05), from 0.32 to 1.03. After intervention with different doses of 2'-FL, the relative abundance of the intestinal flora of mice changed to varying degrees. The relative abundance of Firmicutes decreased, the relative abundance of Bacteroidetes increased, and the ratio of Firmicutes to Bacteroidetes increased significantly. In addition, there was a certain dose dependence. It is worth noting that the relative abundance of Firmicutes and Bacteroidetes in the intestinal flora of mice in the high-dose 2'-FL intervention group and the ratio of Firmicutes to Bacteroidetes (F / B ratio) were closer to those of mice in the K group. The F / B ratios of each group are as follows:

[0170] K group 0.32±0.07; M group 1.03±0.22; Y group 0.92±0.18; L2 group 0.94±0.05; M2 group 0.76±0.11; H2 group 0.51±0.15.

[0171] The results showed that the high-dose 2'-FL intervention group could effectively alleviate the occurrence of constipation by regulating the ratio of Firmicutes and Bacteroidetes in the intestinal flora of constipated mice and increasing the relative abundance of Verrucomicrobia.

[0172] (4) Differences in intestinal flora at the genus level among mice treated with different doses of 2'-FL

[0173] The relative abundance of intestinal flora in constipated mice treated with different doses of 2'-FL at the genus level is shown in the figure. Figure 5 As shown in the figure, the vertical axis represents the relative abundance of the intestinal flora of each group of mice at the genus level, and each color block represents the genus level classification of different flora on the right side of each sample. Figure 5 It can be seen that a total of 20 major bacterial groups were detected in the colon intestinal contents of constipated mice intervened with different doses of 2'-FL.

[0174] ① Figure 5In A, at the genus level of intestinal flora of mice in the blank K group, Bacteroides accounted for 11.15%, Lactobacillus accounted for 10.43%, Akkermansia accounted for 6.83%, Odoribacter accounted for 2.28%, Parabacteroides accounted for 3.43%, etc.

[0175] ② From Figure 5 As shown in Figure A, the species composition of the loperamide-induced constipation mice (Group M) differed significantly at the genus level compared to the intestinal flora of the mice in Group K, indicating that the intestinal flora of the constipated mice was disturbed. Compared with the mice in Group K, the relative abundance of Bacteroides, Akkermansia, Parabacteroides, and Odoribacter decreased in the constipated mice in Group M, while the relative abundance of Oscillospira and Ruminococcus increased.

[0176] ③ After high-, medium-, and low-dose 2'-FL intervention, the relative abundance of the intestinal microbiota of mice changed significantly. Among them, the relative abundance of Bacteroides in mice treated with medium and high doses of 2'-FL was significantly higher than that in the M group (P < 0.05), approaching that of the K group. Furthermore, after high-dose 2'-FL intervention, the relative abundance of Akkermansia increased, while the relative abundance of Odorobacterium and Parabacteroides was significantly higher than that in the M group (P < 0.05). Furthermore, the abundance of the intestinal microbiota of mice treated with high-dose 2'-FL was closer to that of the blank group.

[0177] (5) Analysis of LEfSe species differences in the intestinal flora of mice in groups treated with different doses of 2'-FL

[0178] like Figure 6As shown, the species significantly enriched in the guts of mice in the blank K group was Parabacteroides, which has physiological characteristics of glucose metabolism and short-chain fatty acid secretion. The genus significantly enriched in the model M group was Odoribacter. In the Y group of mice treated with positive drug therapy, Desfufovibrio, Ruminococcus, Coprococcus, and Allobaculum were found to be relatively abundant. However, after low-dose 2'-FL treatment, Lactobacillus was found to be relatively abundant in the guts of mice. Lactobacillus plays an important role in human health, maintaining a balanced intestinal flora, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation. Lactobacillus alleviates constipation by regulating intestinal flora. Furthermore, after medium-dose 2'-FL treatment, Ruminococcus was found to be relatively abundant in the guts of mice in the M2 group. Ruminococci bacteria in the intestinal microbiota promote the production of short-chain fatty acids, maintaining intestinal health and inhibiting the growth of harmful microorganisms. After high-dose 2'-FL treatment, the relative abundance of Brevibacterium in the intestines of mice in the H2 group was higher. In summary, 2'-FL treatment effectively ameliorates changes in the structure and composition of the intestinal microbiota in mice with loperamide-induced constipation.

[0179] 2.3 Short-chain fatty acids:

[0180] Short-chain fatty acids (SCFAs) are a class of fatty acids produced by intestinal flora through the fermentation of carbohydrates such as dietary fiber. They primarily include acetic acid, propionic acid, butyric acid, and valeric acid. SCFAs play an important role in maintaining the integrity of the intestinal barrier and maintaining a balanced intestinal environment. Acetic acid is primarily involved in metabolism in the brain, heart, kidneys, and muscles; propionic acid can inhibit the synthesis of hepatic cholesterol and lower serum cholesterol levels; and butyric acid protects the intestinal mucosa, fights inflammation, enhances gastrointestinal function, inhibits tumor cell proliferation, and induces differentiation and apoptosis. Furthermore, the production of SCFAs can promote intestinal motility, thereby alleviating constipation.

[0181] The present invention studied the effects of different doses of 2'-FL on the levels of short-chain fatty acids (acetic acid, propionic acid, butyric acid, and valeric acid) in the intestinal contents of constipated mice. The results, shown in Table 5, showed that compared with normal mice in the blank K group, the intestinal contents of the model M group mice treated with loperamide significantly decreased (P < 0.05). Compared with the model M group, high and medium doses of 2'-FL significantly increased the levels of acetic acid, propionic acid, butyric acid, and valeric acid in the intestinal contents of mice (P < 0.05). The results showed that 2'-FL has the effect of restoring the content of short-chain fatty acids in the intestines of constipated mice.

[0182] Table 5 Effects of nutrients on the content of short-chain fatty acids in mouse feces

[0183] Example Dose group Acetic acid (μg / g) Propionic acid (μg / g) Butyric acid (μg / g) Valeric acid (μg / g) Comparative Example 1 K 3527.15±219.51 419.75±13.81 243.98±12.59 100.23±4.15 Comparative Example 2 M <![CDATA[1448±113.04 * ]]> <![CDATA[240.47±13.01 * ]]> <![CDATA[121.03±11.85 * ]]> <![CDATA[47.45±2.75 * ]]> Comparative Example 3 Y <![CDATA[2313.23±140.23 *# ]]> <![CDATA[283.82±13.06 *# ]]> <![CDATA[157.19±9.02 *# ]]> <![CDATA[70.07±5.07 *# ]]> Experimental Example 1 H2 <![CDATA[2419.14±139.22 *# ]]> <![CDATA[312.9±13.94 *# ]]> <![CDATA[174.6±10.03 *# ]]> <![CDATA[73.2±2.57 *# ]]> Experimental Example 2 M2 <![CDATA[2043.11±143.74 *# ]]> <![CDATA[285.84±7.49 *# ]]> <![CDATA[144.66±9.76 *# ]]> <![CDATA[65.56±2.72 *# ]]> Experimental Example 3 L2 <![CDATA[1878.15±76.9 * ]]> <![CDATA[271.54±6.17 * ]]> <![CDATA[139.57±9.27 * ]]> <![CDATA[54.95±2.49 * ]]>

[0184] Note: *P<0.05 compared with blank control group K; # Compared with model M group, P<0.05.

Claims

1. Use of 2'-fucosyllactose in preparing a food for improving constipation, characterized in that: The constipation is functional constipation.

2. The use according to claim 1, characterized in that The constipation improvement comprises at least one of (a1) to (a3): (a1) Increase the water content of feces; (a2) Improve intestinal motility; (a3) Regulates the SCF / C-kit signaling pathway.

3. The use according to claim 2, characterized in that The regulation of the SCF / C-kit signaling pathway includes increasing the expression of SCF and C-kit mRNA in colon tissue.

4. The use according to any one of claims 1 to 3, characterized in that The improvement of constipation also includes regulating the structure of intestinal flora; Optionally, the regulating the intestinal flora structure includes reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.

5. The use according to any one of claims 1 to 4, characterized in that Improve the abundance and diversity of intestinal flora; Optionally, said increasing the abundance and diversity of intestinal flora comprises increasing the relative abundance of Verrucomicrobia; Optionally, the improving the abundance and diversity of intestinal flora includes improving the relative abundance of Bacteroides, Akkermansia, Odoribacter, Parabacteroides, and the relative abundance of one or more bacterial genera of the genera Ruminococcus, Lactobacillus and Brevibacterium.

6. The use according to any one of claims 1 to 5, characterized in that The improvement of constipation also includes restoring the content of short-chain fatty acids in the intestine; Optionally, restoring the content of short-chain fatty acids in the intestine includes increasing the content of at least one of acetic acid, propionic acid, butyric acid and valeric acid.

7. Use of 2'-fucosyllactose in preparing a food for improving the intestinal flora environment under constipation conditions, characterized in that: The constipation is functional constipation.

8. The use according to claim 7, characterized in that Improving the intestinal flora environment under constipation conditions includes increasing the abundance and diversity of intestinal flora, and / or regulating the structure of intestinal flora; Optionally, said increasing the abundance and diversity of intestinal flora comprises increasing the relative abundance of Verrucomicrobia; Optionally, improving the abundance and diversity of intestinal flora includes increasing the relative abundance of Bacteroides, Akkermansia, Odoribacter, Parabacteroides, and the relative abundance of one or more bacterial genera of the genus Ruminococcus, Lactobacillus, and Brevibacterium; Optionally, regulating the intestinal flora structure includes reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.

9. The use according to any one of claims 1 to 8, characterized in that At room temperature, the food exists in the form of solid, semi-solid or liquid.

10. The use according to any one of claims 1 to 9, characterized in that The food is an oral preparation; the oral preparation includes at least one of tablets, pills, granules, powders, teas, capsules and oral liquids.

11. The use according to any one of claims 1 to 10, characterized in that The mass content of 2'-fucosyllactose in the food is at least 0.05%.

Images