Method for carrying out drug loading and active oxygen removal by using engineered DNA (deoxyribonucleic acid) condensed-state liquid drops as multifunctional nano-carrier
By engineering DNA condensed droplets as multifunctional nanocarriers, the problems of limited drug carrier sites and insufficient reactive oxygen species scavenging were solved, precise loading of multiple drugs and efficient reactive oxygen species scavenging were achieved, and the therapeutic effect of the drug delivery system was improved.
Patent Information
- Application Number
- CN202510719655.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-09-19
AI Technical Summary
Existing drug carriers have limited drug loading sites, which makes it difficult to meet the needs of simultaneous delivery of multiple drugs. The spatial position of drugs on the carrier is difficult to precisely control. Traditional methods lack efficient means of scavenging reactive oxygen species, making it difficult to achieve simultaneous delivery of multiple drugs and effectively protect cells from oxidative damage.
Engineered DNA condensed droplets are used as multifunctional nanocarriers to form Y-shaped DNA nanostructures through self-assembly. Combined with covalent modification, non-covalent interaction and physical retention methods, multiple drug loading sites and reactive oxygen species scavenging are achieved, and the bases and phosphate backbones in the DNA molecules are used to react with reactive oxygen species to neutralize them.
It achieves the simultaneous loading of multiple drugs and precise control of their spatial positions, with an efficiency of up to 85% in clearing reactive oxygen species, reducing oxidative stress-related cell damage. It can also simultaneously load chemotherapy drugs, anti-inflammatory drugs, and nucleic acid dyes to achieve the coordinated delivery of multiple drugs.
Smart Images
Figure CN120661684A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to bionanomaterial technology, and in particular to a method for utilizing engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging. Background Art
[0002] Biomolecular condensates play a key role in cellular functions and biological processes. For example, P particles and Cajal bodies can organize specific biomolecules in an orderly manner in time and space. They have significant dynamics and superior kinetic stability, can rapidly recruit and continuously retain guest molecules, and maintain their own integrity when exchanging with surrounding cytoplasmic components.
[0003] Biomolecular condensates have great potential as multifunctional delivery platforms in the biopharmaceutical field. DNA has become an outstanding building block for constructing these condensates to explore their formation mechanisms and biological applications. DNA can be assembled into a variety of condensate droplets due to its programmability and precise base pairing. Its three-dimensional hierarchical self-assembly structure provides multiple pathways for drug delivery and has the potential for sequential drug release. It is sensitive to reactive oxygen species and can act as a ROS scavenger. However, there are still many limitations on the hierarchical structure of DNA droplets in drug delivery.
[0004] The field of drug delivery currently faces many challenges: on the one hand, traditional drug carriers have limited drug loading sites, making it difficult to meet the needs of simultaneous delivery of multiple drugs; on the other hand, the spatial position of the drug on the carrier is difficult to precisely control, which may affect the drug's release behavior and therapeutic effect, and the drug loading amount is also difficult to achieve precise regulation. In addition, in the treatment of some diseases, such as inflammation and oxidative stress-related diseases, existing methods lack efficient reactive oxygen species (ROS) scavenging methods to protect cells from oxidative damage. At the same time, traditional drug delivery systems can usually only deliver one or a few drugs, making it difficult to achieve the simultaneous delivery of multiple drugs to achieve better therapeutic effects. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen scavenging, so as to address the above-mentioned deficiencies in the prior art.
[0006] To achieve the above objectives, the present invention provides the following technical solution: a method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen species scavenging, comprising the following steps:
[0007] S1. Dissolving single-stranded DNA or single-stranded DNA modified with biotin in ultrapure water to obtain a DNA solution; the single-stranded DNA is Y1, Y2, and / or Y3, the DNA sequence of Y1 is SEQ ID NO.1, the DNA sequence of Y2 is SEQ ID NO.2, and the DNA sequence of Y3 is SEQ ID NO.3; then adding the DNA solution to PBS and annealing the solution from 95°C to 4°C to self-assemble into Y-shaped DNA nanostructures; storing the Y-shaped DNA nanostructures at 28°C for 6 hours to obtain DNA condensed droplets, i.e., multifunctional nanocarriers;
[0008] S2, loading the drug into the DNA condensed droplets to complete drug loading;
[0009] S3. When DNA condensed droplets encounter reactive oxygen species, the bases and phosphate backbones in the DNA molecules react with the reactive oxygen species, thereby neutralizing the reactive oxygen species and completing the removal of the reactive oxygen species.
[0010] Furthermore, the drugs described in S2 include nucleic acid dyes, chemotherapy drugs and / or anti-inflammatory drugs.
[0011] Furthermore, the nucleic acid dye is STYO 60 fluorescent dye, the chemotherapy drug is doxorubicin, and the anti-inflammatory drug is curcumin.
[0012] Furthermore, the loading in S2 includes the following steps: mixing 0-3 parts of STYO 60 fluorescent dye, 0-3 parts of doxorubicin and 0-3 parts of curcumin by mole to obtain a guest molecule; mixing the guest molecule with the DNA condensed droplets for 2 hours to complete drug loading.
[0013] Furthermore, the drug described in S2 includes biological molecules.
[0014] Furthermore, the loading described in S2 includes the following steps: mixing the biological molecules, 3-(2-pyridyldisulfide) propionic acid N-hydroxysuccinimide ester and PBS buffer with a pH of 8.5, reacting for 2 hours to obtain a reaction solution; passing the reaction solution through a Zeba centrifugal desalting column to remove excess 3-(2-pyridyldisulfide) propionic acid N-hydroxysuccinimide ester to obtain a mixed solution; incubating the mixed solution with DNA condensed droplets in PBS buffer with a pH of 7.2 for 8 hours. After the incubation is completed, ultrafiltration is performed using a 30kDa retention filter to complete the drug connection.
[0015] Furthermore, the biomolecule includes IgG, BSA or peptide.
[0016] Furthermore, the removal of excess SPDP from the reaction solution by a Zeba centrifugal desalting column comprises the following steps: loading the reaction solution onto a Zeba centrifugal desalting column, centrifuging at a centrifugal force of 10,000 g for 2 minutes, repeating the centrifugation process three times, and collecting the outflowing liquid to obtain a mixed solution.
[0017] Furthermore, the incubation temperature is 28°C.
[0018] Furthermore, the ultrafiltration was performed 3 times, and the time for each ultrafiltration was 10 minutes.
[0019] Compared with the prior art, the present invention provides a method for drug loading and reactive oxygen species scavenging using engineered DNA condensed droplets as multifunctional nanocarriers. The DNA condensed droplets provide multiple drug loading sites through covalent modification or non-covalent interaction, as well as physical retention, and can be loaded with a variety of drugs such as small molecules and primary amine-containing protein biomolecules; the hierarchical structure of the DNA condensed droplets enables precise control of the spatial position of different drugs on the droplets; for small molecule drugs, the loading amount in the DNA condensed droplets can be controlled by adjusting the input ratio to achieve ratio-controlled loading; the DNA condensed droplets can effectively scavenge reactive oxygen species, with a scavenging efficiency of over 85% for hydroxyl radicals, etc., and can also efficiently scavenge ROS in cells, helping to reduce cell damage related to oxidative stress; the DNA condensed droplets can simultaneously load multiple drugs, such as the chemotherapy drug doxorubicin, the anti-inflammatory drug curcumin, and the nucleic acid dye STYO 60, to achieve coordinated delivery of multiple drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.
[0021] Figure 1 Schematic diagram of the preparation process and characterization results of DNA condensed droplets provided in an embodiment of the present invention;
[0022] Figure 2 Schematic diagram of biomolecules being recruited into DNA condensate droplets according to an embodiment of the present invention;
[0023] Figure 3 A schematic diagram of loading nucleic acid dyes, chemotherapy drugs and / or anti-inflammatory drugs into DNA condensed droplets according to an embodiment of the present invention;
[0024] Figure 4Schematic diagram of loading biomolecules into DNA condensed droplets via biotin-SA interaction provided in an embodiment of the present invention;
[0025] Figure 5 Schematic diagram of the ability of DNA condensed droplets to scavenge ROS according to an embodiment of the present invention;
[0026] Figure 6 Schematic diagram of the coupling of ssDNA (Y1, Y2, Y3) with IgG, BSA and peptide provided in an embodiment of the present invention;
[0027] Figure 7 Schematic diagram of a fluorescent image of protein-loaded DNA condensed droplets provided in an embodiment of the present invention;
[0028] Figure 8 Schematic diagram of fluorescence images of small molecule-loaded DNA condensed droplets with different input ratios provided by an embodiment of the present invention;
[0029] Figure 9 Schematic diagram of a fluorescent image of biotin-modified IgG-loaded DNA condensed droplets provided in an embodiment of the present invention;
[0030] Figure 10 Schematic diagram of fluorescence images of IgG-loaded DNA condensed droplets containing different ratios of input cargo provided in an embodiment of the present invention. DETAILED DESCRIPTION
[0031] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.
[0032] Example 1:
[0033] See also Figure 3 and Figure 8 A method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen species scavenging comprises the following steps:
[0034] S1. Dissolve single-stranded DNA Y1, Y2, and Y3 in ultrapure water, respectively, to obtain DNA solution 1, DNA solution 2, and DNA solution 3; the DNA sequence of Y1 is SEQ ID NO. 1, the DNA sequence of Y2 is SEQ ID NO. 2, and the DNA sequence of Y3 is SEQ ID NO. 3; then add 1 μL of DNA solution 1, 1 μL of DNA solution 2, and 1 μL of DNA solution 3 to 97 μL of PBS, and anneal from 95° C. to 4° C. to self-assemble into Y-shaped DNA nanostructures; store the Y-shaped DNA nanostructures at 28° C. for 6 hours to obtain DNA condensed droplets, i.e., multifunctional nanocarriers;
[0035] SEQ ID NO.1: ACCTGGGGGAGTATTGCGGAGGAAGAGCGCTC;
[0036] SEQ ID NO.2: GTGTCGGACTGAACTCCCCCAGGTGAGCGCTC;
[0037] SEQ ID NO. 3: TTCCTCCGCAATTCAGTCCCGACACGAGCGCTC.
[0038] S2. Mix 0-3 parts of STYO 60 fluorescent dye, 0-3 parts of doxorubicin, and 0-3 parts of curcumin by mole ratio to obtain a guest molecule; mix the guest molecule with the DNA condensed droplets for 2 hours to complete drug loading;
[0039] S3. When DNA condensed droplets encounter reactive oxygen species, the bases and phosphate backbones in the DNA molecules react with the reactive oxygen species, thereby neutralizing the reactive oxygen species and completing the removal of the reactive oxygen species.
[0040] The hierarchical structure of DNA condensates enables them to interact with guest molecules through different physicochemical forces. The major and minor grooves of the DNA double helix can bind various guest molecules, such as curcumin (Cur), doxorubicin (DOX), and various nucleic acid dyes, through non-covalent interactions. The nucleic acid dye STYO 60 (emission wavelength: 678 nm), the chemotherapy drug doxorubicin (emission wavelength: 600 nm), and the anti-inflammatory drug curcumin (emission wavelength: 530 nm) were selected as guest molecules to be loaded into DNA condensates.
[0041] Place 100 μL of drug-loaded DNA condensate droplets in a glass-bottomed culture dish (D29-10-1.5-N) and incubate for 20 minutes. After incubation, capture fluorescence images using a fluorescence microscope. Figure 3 A, All small molecules can be embedded in DNA condensate droplets and appear as fluorescent spherical particles, indicating that these small molecules have been successfully loaded into DNA condensate droplets.
[0042] See also Figure 3 B, Three small molecules were loaded into DNA condensate droplets at different molar ratios (STY060: doxorubicin: curcumin = 1:1:1 or 3:1:1 or 1:3:1 or 1:1:3). Figure 3 C and Figure 8 Fluorescence imaging showed that the fluorescence of the three molecules overlapped significantly, indicating that these molecules can be loaded into DNA condensate droplets simultaneously. Figure 3C and 3D , the fluorescence intensities of the three molecules are consistent with their input ratios, indicating that the loading amount of each molecule can be controlled by its input.
[0043] Example 2:
[0044] A method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen species scavenging comprises the following steps:
[0045] S1. Dissolve single-stranded DNA Y1, Y2, and Y3 in ultrapure water, respectively, to obtain DNA solution 1, DNA solution 2, and DNA solution 3; the DNA sequence of Y1 is SEQ ID NO. 1, the DNA sequence of Y2 is SEQ ID NO. 2, and the DNA sequence of Y3 is SEQ ID NO. 3; then add 1 μL of DNA solution 1, 1 μL of DNA solution 2, and 1 μL of DNA solution 3 to 97 μL of PBS, and anneal from 95° C. to 4° C. to self-assemble into Y-shaped DNA nanostructures; store the Y-shaped DNA nanostructures at 28° C. for 6 hours to obtain DNA condensed droplets, i.e., multifunctional nanocarriers;
[0046] SEQ ID NO.1: ACCTGGGGGAGTATTGCGGAGGAAGAGCGCTC;
[0047] SEQ ID NO.2: GTGTCGGACTGAACTCCCCCAGGTGAGCGCTC;
[0048] SEQ ID NO. 3: TTCCTCCGCAATTCAGTCCCGACACGAGCGCTC.
[0049] S2. Mixing a biomolecule, 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester, and a PBS buffer solution at pH 8.5, and reacting for 2 hours to obtain a reaction solution; loading the reaction solution onto a Zeba centrifugal desalting column, centrifuging at a centrifugal force of 10,000 g for 2 minutes, repeating the centrifugation process three times, and collecting the effluent to obtain a mixed solution; incubating the mixed solution with DNA condensed droplets in a PBS buffer solution at pH 7.2 for 8 hours at a temperature of 28° C. After the incubation is completed, ultrafiltration is performed using a 30 kDa cutoff filter for three times, each ultrafiltration time being 10 minutes to complete drug loading; the biomolecule includes IgG, BSA, or peptide;
[0050] S3. When DNA condensed droplets encounter reactive oxygen species, the bases and phosphate backbones in the DNA molecules react with the reactive oxygen species, thereby neutralizing the reactive oxygen species and completing the removal of the reactive oxygen species.
[0051] Example 3:
[0052] See also Figure 1 This embodiment provides a technical solution based on the first embodiment: performing a characterization experiment on DNA condensed droplets.
[0053] Verification of the formation of DNA condensate droplets: The Y-shaped DNA nanostructures were stained with SYBR Green dye and observed under a fluorescence microscope.
[0054] Determine the diameter of DNA condensate droplets: 50 μL DNA condensate droplets were stained with tungstic acid for 20 minutes, then dropped on a copper grid for 30 minutes, and finally imaged using TEM.
[0055] See also Figure 1 A, DNA condensate droplets were formed by phase separation of a Y-shaped DNA nanostructure (named Y-DNA nanostructure). The Y-DNA nanostructure is a DNA triplex structure consisting of three 24-base pair "stems" and three 8-nucleotide (nt) "sticky ends" (SEs). The Y-DNA nanostructure was prepared from three separate single-stranded DNA chains (ssDNA, Y1, Y2, and Y3) with rationally designed partially complementary sequences ( Figure 1 A). Three SEs designed with identical sequences can assemble with each other, enabling a Y-shaped DNA nanostructure to combine with other Y-shaped DNA nanostructures to form DNA condensate droplets.
[0056] See also Figure 1 B. The phosphate backbone, the primary structure of DNA condensates, can be easily modified with a variety of functional groups, such as sulfenyl (-SH) groups. These modifications allow the primary structure to covalently attach different drugs. The major and minor grooves of the DNA double helix serve as loading sites, into which small molecules such as the chemotherapy drug doxorubicin (DOX) and the anti-inflammatory drug curcumin (Cur) can be embedded. The advanced structure of DNA condensates allows for the spatial manipulation of different drugs by either recruiting them within their porous structure or displaying them exclusively on their surface.
[0057] To verify the formation of DNA condensate droplets, the Y-shaped DNA nanostructures were stained with SYBR Green dye after annealing from 95°C to 25°C. The annealing procedure is shown in Table 1 and observed under a fluorescence microscope.
[0058] Table 1. Annealing program for assembling rectangular DNA origami.
[0059] temperature gradient 95℃ 2min 95-25℃ -0.1℃ / 6s / cycle, 699 cycles 4℃ save
[0060] See also Figure 1 C, Spherical particles were observed, indicating that DNA condensate droplets were successfully formed.
[0061] To determine the diameter of DNA condensate droplets, they were stained with tungstic acid and observed using a transmission electron microscope (TEM). Figure 1 C. When the concentration of the Y-shaped DNA nanostructure is 5 μM, the DNA condensate droplets are spherical with an average diameter of 43.6 ± 7.3 nm. This size in the TEM image is much smaller than the size in the fluorescence image (5.3 ± 1.1 μm). The observed light spot is significantly larger than the physical size of the actual object. A DNA condensate droplet is stained by many SYBR Green dye molecules, making the light spot of a DNA condensate droplet larger. On the other hand, drying and flattening of the sample during TEM imaging may cause the DNA condensate droplet structure to collapse and reduce in size. In summary, it is speculated that the diameter of the water-soluble DNA condensate droplets may be in the nanometer range.
[0062] Example 4:
[0063] See also Figure 2 、 Figure 6 and Figure 7 This embodiment provides a technical solution based on the second embodiment: biomolecule (IgG, BSA or peptide) loading experiment.
[0064] IgG, BSA or peptides were modified with fluorescein: 100-fold excess NHS-Alexa647, NHS-Alexa488 and NHS-Alexa568 were mixed with IgG, BSA and peptides in 1×PBS for 2 hours (pH=8). Excess NHS-Alexa647, NHS-Alexa488 and NHS-Alexa568 were removed by centrifugation through a Zeba spin desalting column (7K MWCO, 0.5 mL) (1000 g, 2 min, 3 times).
[0065] The phosphate backbone, the primary structure in DNA condensed droplets, can be easily modified with various functional molecules to bind drugs through covalent interactions. Sulfhydryl functional groups are among the most commonly used linkers for conjugating DNA to amino-group bioactive molecules, including peptides, proteins, and antibodies.
[0066] See also Figure 2 A, Thiol-modified single-stranded DNA (SH-ssDNA) is coupled to amino molecules using the bifunctional crosslinker 3-(2-pyridyldithio)propionate N-hydroxysuccinimide ester (SPDP). These molecules can then be loaded into DNA condensate droplets via liquid-liquid phase separation (LLPS).
[0067] IgG, BSA, and peptides were selected as amino-based carrier molecules and modified with Alexa 647, Alexa 488, and Alexa 568, respectively. Agarose gel electrophoresis (AGE) was performed using 1% agarose gel in 1× TAE buffer (containing 4 mM Tris base, 2 mM acetic acid, and 0.2 mM EDTA) at 4°C for approximately 1 to 1.5 hours, and imaging and analysis were performed.
[0068] See also Figure 2 B and Figure 6 , agarose gel electrophoresis showed that the fluorescence of IgG, BSA, and peptide overlapped well with that of ssDNA, indicating that ssDNA was successfully coupled to IgG, BSA, or peptide.
[0069] See also Figure 2 C and Figure 7 All DNA condensate droplets loaded with IgG, BSA, or peptides displayed dispersed spherical particles, and the fluorescence signals of IgG, BSA, and peptides overlapped well with the fluorescence signals of DNA condensate droplets (stained with GelRed or STYO 60). Therefore, IgG, BSA, or peptides can be coupled to single-stranded DNA through covalent interactions and dispersed in DNA condensate droplets.
[0070] Embodiment 5:
[0071] See also Figure 4 、 Figure 9 and Figure 10 A method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen species scavenging comprises the following steps:
[0072] S1. Dissolving biotin-modified single-stranded DNAs Y1, Y2, and Y3 in ultrapure water, respectively, to obtain DNA solutions 1, DNA solutions 2, and DNA solutions 3. The DNA sequence of Y1 is SEQ ID NO. 1, the DNA sequence of Y2 is SEQ ID NO. 2, and the DNA sequence of Y3 is SEQ ID NO. 3. Then, 1 μL of DNA solution 1, 1 μL of DNA solution 2, and 1 μL of DNA solution 3 are added to 97 μL of PBS and annealed from 95° C. to 4° C. to self-assemble into Y-shaped DNA nanostructures. The Y-shaped DNA nanostructures are stored at 28° C. for 6 hours to obtain DNA condensed droplets, i.e., multifunctional nanocarriers.
[0073] SEQ ID NO.1: ACCTGGGGGAGTATTGCGGAGGAAGAGCGCTC;
[0074] SEQ ID NO.2: GTGTCGGACTGAACTCCCCCAGGTGAGCGCTC;
[0075] SEQ ID NO. 3: TTCCTCCGCAATTCAGTCCCGACACGAGCGCTC.
[0076] S2. Mixing a biomolecule, 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester, and a PBS buffer solution at pH 8.5, and reacting for 2 hours to obtain a reaction solution; loading the reaction solution onto a Zeba centrifugal desalting column, centrifuging at a centrifugal force of 10,000 g for 2 minutes, repeating the centrifugation process three times, and collecting the effluent to obtain a mixed solution; incubating the mixed solution with DNA condensed droplets in a PBS buffer solution at pH 7.2 for 8 hours at a temperature of 28° C. After the incubation is completed, ultrafiltration is performed using a 30 kDa cutoff filter for three times, each ultrafiltration time being 10 minutes to complete drug loading; the biomolecule includes IgG, BSA, or peptide;
[0077] S3. When DNA condensed droplets encounter reactive oxygen species, the bases and phosphate backbones in the DNA molecules react with the reactive oxygen species, thereby neutralizing the reactive oxygen species and completing the removal of the reactive oxygen species.
[0078] The spatial location of drugs on nanocarriers has a significant impact on their therapeutic effects. Thanks to their hierarchical structure, DNA condensates can not only load drugs with different physical and chemical properties, but also arrange them in different spatial locations. To load drugs onto the surface of DNA condensates, biotin-streptavidin (SA) is used as a linker. Figure 4 A, Single-stranded DNA is modified with biotin and then annealed to form biotin-DNA condensate droplets. Drugs, also modified with biotin, are loaded onto the biotin-DNA condensate droplets via SA. Due to the dense DNA network and steric hindrance, SA is limited to biotin on the surface of the DNA condensate droplets. Therefore, biotinylated drugs can only be loaded onto the surface of these droplets via the biotin-SA interaction.
[0079] See also Figure 4 B and Figure 9 The fluorescence of two IgGs (IgG1 and IgG2) on the surface of DNA condensate droplets showed a pattern of darker center and brighter edge, indicating that IgG was indeed loaded on the surface of DNA condensate droplets.
[0080] See also Figure 4 C and Figure 10 Based on this approach, different IgGs can be simultaneously loaded onto the surface of DNA condensates, and the loading amount of each IgG can be controlled by input. Therefore, the precise control of the location and amount of various drugs on DNA condensates highlights its great potential in drug delivery applications.
[0081] Example 6:
[0082] See also Figure 5 This embodiment provides a technical solution based on the first embodiment: DNA condensed droplet scavenging reactive oxygen species experiment:
[0083] In order to evaluate the ability of DNA condensed droplets to scavenge hydroxyl radicals (·OH), a Fenton reaction-based experiment was conducted. PBS, single-stranded DNA (Y1, Y2, Y3) and Y-shaped DNA nanostructures were reacted with hydrogen peroxide (10 mM) and Fe 2+ The cells were mixed with 1 mM HCl and incubated at 37°C for 10 minutes. After incubation, the supernatant was collected and reacted with 10 mM methylene blue (MB), a specific probe for ·OH, at 37°C for 10 minutes. The ·OH concentration was determined by measuring MB's absorbance at 666 nm. PBS was used as a negative control in this experiment. To investigate possible structural changes in DNA condensate droplets during antioxidant treatment, they were exposed to ·OH at various time intervals and subsequently analyzed by agarose gel electrophoresis (AGE).
[0084] See also Figure 5 DNA molecules are sensitive to various reactive oxygen species (ROS), which endows DNA condensed droplets with the ability to effectively scavenge ROS. Figure 5 A, The MB absorbance at 666 nm in the Fenton+MB group disappears, indicating that MB is completely consumed by ·OH. MB in the Y1, Y2, Y3, and Y-shaped DNA nanostructure groups exhibit strong absorption at 666 nm, indicating that Y1, Y2, Y3, and Y-shaped DNA nanostructures can effectively scavenge ·OH; see Figure 5 B, The clearance efficiency of Y1, Y2, Y3, and Y-shaped DNA nanostructures exceeds 85%; see Figure 5 C, AGE further shows that Y1, Y2, Y3 and the Y-shaped DNA nanostructure itself are also consumed in the process of clearing ROS.
[0085] To evaluate the ability of DNA condensate droplets to scavenge intracellular reactive oxygen species (ROS), a 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) staining experiment was performed. Human epidermal keratinocytes (HaCaT) were first treated with 100 μM hydrogen peroxide to stimulate ROS production. Subsequently, cells were incubated with or without DNA condensate droplets. Following incubation, cells were stained with the ROS-sensitive fluorescent probe DCFH-DA (10 μM) for 20 minutes at 37°C. Fluorescence imaging was performed using a Leica Thunder Imager DMI8.
[0086] See also Figure 5 D, demonstrates the ability of DNA condensates to scavenge intracellular ROS. To induce intracellular ROS production, HaCaT cells were incubated with 500 μM hydrogen peroxide overnight, followed by the addition of DNA condensates to the cells. 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) was used to indicate intracellular ROS levels. Figure 5 E, Fluorescence image of HaCaT cells stained with DCFH-DA. Compared with the PBS group, the fluorescence signal observed in the DNA condensed droplet treatment group was significantly reduced, indicating that the DNA condensed droplets can efficiently clear intracellular ROS.
[0087] The above description is merely illustrative of certain exemplary embodiments of the present invention. It goes without saying that those skilled in the art will be able to modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the above drawings and description are illustrative in nature and should not be construed as limiting the scope of protection of the claims.
Claims
1. A method for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and reactive oxygen species scavenging, characterized in that: The steps include: S1. Dissolving single-stranded DNA or single-stranded DNA modified with biotin in ultrapure water to obtain a DNA solution; the single-stranded DNA is Y1, Y2, and / or Y3, the DNA sequence of Y1 is SEQ ID NO.1, the DNA sequence of Y2 is SEQ ID NO.2, and the DNA sequence of Y3 is SEQ ID NO.3; then adding the DNA solution to PBS and annealing the solution from 95°C to 4°C to self-assemble into Y-shaped DNA nanostructures; storing the Y-shaped DNA nanostructures at 28°C for 6 hours to obtain DNA condensed droplets, i.e., multifunctional nanocarriers; S2, loading the drug into the DNA condensed droplets to complete drug loading; S3. When DNA condensed droplets encounter reactive oxygen species, the bases and phosphate backbones in the DNA molecules react with the reactive oxygen species, thereby neutralizing the reactive oxygen species and completing the removal of the reactive oxygen species.
2. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 1, characterized in that: The drugs described in S2 include nucleic acid dyes, chemotherapy drugs and / or anti-inflammatory drugs.
3. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 2, characterized in that: The nucleic acid dye is STYO 60 fluorescent dye, the chemotherapy drug is doxorubicin, and the anti-inflammatory drug is curcumin.
4. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 3, characterized in that: The loading in S2 comprises the following steps: mixing 0-3 parts of STYO 60 fluorescent dye, 0-3 parts of doxorubicin and 0-3 parts of curcumin by mole to obtain a guest molecule; and mixing the guest molecule with the DNA condensed droplets for 2 hours to complete drug loading.
5. The method of claim 1 for using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging, characterized in that: S2 The drug includes a biological molecule.
6. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 5, characterized in that: The loading described in S2 includes the following steps: mixing biological molecules, 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester and PBS buffer with a pH of 8.5, reacting for 2 hours to obtain a reaction solution; passing the reaction solution through a Zeba centrifugal desalting column to remove excess 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester to obtain a mixed solution; incubating the mixed solution with DNA condensed droplets in PBS buffer with a pH of 7.2 for 8 hours. After the incubation is completed, ultrafiltration is performed using a 30kDa retention filter to complete the drug loading.
7. The method of claim 6, wherein the method comprises: The biomolecules include IgG, BSA or peptides.
8. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 6, characterized in that: The step of removing excess SPDP from the reaction solution by passing it through a Zeba centrifugal desalting column comprises the following steps: loading the reaction solution onto a Zeba centrifugal desalting column, centrifuging at a centrifugal force of 10,000 g for 2 minutes, repeating the centrifugation process three times, and collecting the outflowing liquid to obtain a mixed solution.
9. The method of claim 6, wherein the engineered DNA condensed droplets are used as multifunctional nanocarriers for drug loading and active oxygen scavenging. The incubation temperature is 28°C.
10. The method of using engineered DNA condensed droplets as multifunctional nanocarriers for drug loading and active oxygen scavenging according to claim 6, characterized in that: The number of ultrafiltrations was 3 times, and the time for each ultrafiltration was 10 minutes.