Saccharomyces cerevisiae, screening method and application of saccharomyces cerevisiae in Guoguang apple wine brewing

Abstract

The invention belongs to the technical field of fruit wine brewing, and discloses a saccharomyces cerevisiae strain, a screening method and application of the saccharomyces cerevisiae strain in Guoguang apple wine brewing. The saccharomyces cerevisiae strain is CGMCC No.34726, is separated from fermentation mash of Guoguang apple juice and is obtained through ARTP mutagenesis. The saccharomyces cerevisiae disclosed by the invention is applied to the production of the Guoguang cider, the alcoholic strength of the produced fruit wine is 8.0-9.0%, the total acid is 5.0-5.5 g / L, the malic acid content is lower than that of the Guoguang cider fermented by other yeasts, the content of aroma substances is more, the fermentation period is shorter, the high-quality Guoguang cider can be produced, and the production of the Guoguang cider is facilitated.

Description

Technical Field

[0001] The invention belongs to the technical field of fruit wine brewing, and relates to a brewing yeast and a screening method and application of the yeast in Guoguang cider brewing. Background Art

[0002] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is an essential fermentation microorganism in the production of fruit wine and grape wine. The Guoguang apple (Ralls Janet) is a variety of apple from the genus Malus, in the Rosaceae family. Guoguang apples are favored by consumers for their rich aroma, making them an ideal ingredient for cider production. With the growing demand for healthy beverages, the market potential of Guoguang cider is gradually emerging.

[0003] Commercial wine yeast is currently widely used in fruit wine brewing. While its fermentation process is stable, the resulting wine often has a monotonous taste and lacks the characteristic fruit flavor. A growing number of studies have shown that selecting the right yeast from the raw materials can better adapt to the fermentation characteristics of the raw materials, thereby brewing fruit wines with rich aroma and unique flavor.

[0004] However, strains directly bred from nature often lack ideal traits and require improvement. Atmospheric and Room Temperature Plasma (ARTP) mutagenesis has been widely used in microbial breeding due to its simplicity, safety, and efficiency, and has demonstrated promising results in yeast mutagenesis.

[0005] Therefore, breeding specialized yeast strains that can adapt to the fermentation environment of Guoguang cider, have strong alcohol production capacity, fast fermentation speed and outstanding performance to improve the quality of Guoguang cider has become a hot research direction. Summary of the Invention

[0006] In order to solve the above problems, the present invention provides a brewing yeast that can be used to produce high-quality Guoguang cider. The Guoguang cider produced has a significantly improved aroma compared to commercial yeast, a lower total acid content than Guoguang cider fermented with ordinary commercial yeast, and a lower malic acid content than Guoguang cider fermented with commercial brewing yeast. The yeast is used to produce high-quality Guoguang cider.

[0007] The first object of the present invention is to provide a strain of brewer's yeast, which is deposited in the General Microbiology Center of the China Culture Collection Administration on May 29, 2025, with a deposit number of CGMCC No. 34726 and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The brewer's yeast (Saccharomyces cerevisiae) with a deposit number of CGMCC No. 34726 was isolated from the naturally fermented mash of fruit wine produced by Guoguang apples in Gaizhou, Liaoning Province, and was obtained through ARTP mutagenesis breeding and screening.

[0009] The brewer's yeast (Saccharomyces cerevisiae) with the deposit number CGMCC No. 34726 is used to produce high-quality Guoguang cider and has the following characteristics:

[0010] (1) The fermentation period is 7 to 9 days, the alcohol content of the fermented fruit wine is 8.0 to 9.0% (v / v), and the aging period is 14 to 21 days;

[0011] (2) The total acid content of fermented fruit wine is 3.9-4.2 g / L, and the total sugar content is 4.2-6.1 g / L;

[0012] (3) It has no unpleasant odor and its aroma is richer than that of Guoguang cider fermented with commercial brewing yeast.

[0013] The second object of the present invention is to provide a method for screening brewer's yeast with outstanding performance from Guoguang apple naturally fermented mash.

[0014] The method comprises the following steps: separation and purification of natural brewing yeast, primary screening of natural brewing yeast, secondary screening of natural brewing yeast, small-scale fermentation test of natural brewing yeast, and determination of natural brewing yeast with outstanding performance.

[0015] The specific method includes:

[0016] (1) Isolation and purification of natural brewer's yeast: adjust the sugar content of Guoguang apple juice to 170g / L-180g / L and potassium metabisulfite to 150mg / L-200mg / L. After the sucrose is fully dissolved, 100mL of the adjusted components are measured and placed in a 250mL triangular flask and fermented naturally at 18-20℃. When bubbles appear in the bottle, take 0.1mL of the shaken fermentation liquid and dilute it. Apply different gradients of dilutions on a plate containing 12% (v / v -1 ) on YPD plates containing ethanol and cultured at 30°C for 48-72 hours. Single colonies with typical Saccharomyces cerevisiae morphology and good growth were selected for plate streak isolation until purification.

[0017] (2) Initial screening of natural brewer’s yeast: The isolated and purified yeast was cultured in liquid YPD to a concentration of 1×10 7 CFU·mL -1 Or higher, and inoculate at a 3% inoculum into a test tube containing 7 mL of treated Guoguang apple juice (adjusted to 170 g / L-180 g / L total sugar and 150 mg / L-200 mg / L SO2). The test tube contains an inverted Dulbecco's tubule filled with treated apple juice. Incubate at 30°C, observing gas production every 2 hours, and selecting yeasts with strong fermentation performance for rescreening.

[0018] (3) Rescreening of natural Saccharomyces cerevisiae: After step (2), the Saccharomyces cerevisiae with stronger expression were subjected to ITS rRNA sequencing, and the strains identified as Saccharomyces cerevisiae were collected for future use.

[0019] (4) Fermentation test of natural brewer's yeast: The strains with strong fermentation ability obtained in the initial screening were subjected to ITS rDNA molecular biological bacterial genus identification, and the strains identified as brewer's yeast were used to brew Guoguang cider, and the fermentation process was monitored by measuring the CO2 mass loss.

[0020] (5) Determination of natural brewing yeast with outstanding performance: The sensory evaluation team conducted olfactory tests on wine samples fermented by different brewing yeasts, measured the basic physical and chemical indicators of wine samples with higher olfactory evaluations, and preliminarily selected a brewing yeast with better comprehensive performance for mutation breeding.

[0021] The third object of the present invention is to provide a method for using a normal pressure room temperature plasma mutation breeding instrument to induce and screen brewer's yeast with outstanding performance.

[0022] The method comprises the following steps: bacterial liquid culture, bacterial liquid mutagenesis, primary screening of the mutagenized strain, secondary screening of the mutagenized strain, and physical, chemical and quality analysis of Guoguang cider.

[0023] The specific method includes:

[0024] (1) Culture: The natural Saccharomyces cerevisiae culture solution obtained by the method of the present invention was cultured to the logarithmic phase and then centrifuged and collected, washed twice with physiological saline and diluted to OD 600 Bacterial suspension at 0.6-0.8;

[0025] (2) Mutagenesis of bacterial solution: Evenly apply 10 μL of the bacterial suspension treated in (1) on a metal slide, then place the slide in the mutagenesis system and select an appropriate treatment time. After the treatment, the slide automatically falls into a centrifuge tube containing 1 mL of physiological saline; vortex the centrifuge tube for 1 minute to form a new bacterial suspension, which is appropriately diluted and then spread on a plate. The plate is then incubated at 30°C, with a bacterial suspension that has not been treated with ARTP as a control. Single colonies of Saccharomyces cerevisiae with a lethality rate greater than 95% on the plate are selected for multi-stage mutagenesis;

[0026] (3) Initial screening of mutagenic strains: Single colonies grown on the mutagenic plate were inoculated into a 96-well plate containing 200 μL YPD (pH 3.0, 10% ethanol) and cultured at 30°C with shaking (220 r·min -1 2d), measure the OD of each well using a microplate reader 600 Use the uninoculated culture medium as the control and select the culture medium with the higher OD value. 600 Improved mutant strains by 20%;

[0027] (4) Rescreening of the mutated strains: After the mutant strains obtained from the initial screening were activated, they were inoculated into a fermentation medium at 5% concentration and cultured overnight. The cells were collected by centrifugation, washed with phosphate buffer solution, and then suspended for esterase activity determination. The mutant strains with good phenotypes were used to ferment Guoguang cider according to the method described in the present invention. After fermentation, the basic physical and chemical indicators of the wine samples were measured and an olfactory test was performed. The mutant strain with the best overall performance was initially selected for the brewing of Guoguang cider.

[0028] (5) Physicochemical and quality analysis of Guoguang cider: After fermentation, the wine samples were tested for routine physicochemical indicators, total phenols, in vitro antioxidant activity, organic acids, monomeric phenols and volatile flavor compounds. The wine samples were also subjected to sensory evaluation and a comprehensive evaluation was conducted to determine the most suitable brewing yeast for Guoguang cider brewing.

[0029] A fourth object of the present invention is to provide a method for producing high-quality Guoguang cider, wherein the method utilizes the brewer's yeast with the deposit number CGMCC No. 34726 of the present invention.

[0030] In one embodiment of the present invention, the method comprises the following steps: soaking, cutting, pulping, inoculation, fermentation, filtering, aging, and centrifugation.

[0031] In an embodiment of the present invention, the fermentation temperature of the method is 20-25°C.

[0032] In an embodiment of the present invention, the method comprises the following steps: the inoculation amount of brewer's yeast with the deposit number CGMCC No. 34726 is 3% to 5% (w / w pulp), the fermentation temperature is 20 to 25° C., the time is 7 to 8 days; the aging temperature is 0 to 4° C., and the time is 14 to 21 days.

[0033] In one embodiment of the present invention, the method comprises:

[0034] (1) Soaking: Select Guoguang apples with intact surfaces, soak them in water, and drain the water;

[0035] (2) Cutting: Cut the washed Guoguang apples into pieces, remove the core, and cut into tubers for later use;

[0036] (3) Pulping: After cutting Guoguang apples, add edible water according to the material-water ratio of 7.0:3.0, and add sucrose to adjust the total sugar content of the pulp to 170-180g·L -1 SO2 (added as potassium metabisulfite) 150 mg·L -1 , 300mL of Guoguang apple pulp in a 500mL triangular bottle;

[0037] (4) Inoculation: Saccharomyces cerevisiae with a preservation number of CGMCC No. 34726 was inoculated at a 5% inoculation rate. The total concentration of the inoculated Saccharomyces cerevisiae was approximately 1×10 7 CFU·mL -1 , the inoculation process is completed in a clean bench;

[0038] (5) Fermentation: Fermentation was carried out in an incubator at 20°C. The fermentation process was monitored by measuring the CO2 mass loss. The fermentation was terminated when the mass loss was less than 0.2 g after 12 h.

[0039] (6) Filtration: After the fermentation in step (5) is completed, the fermented slurry is filtered using sterile gauze to obtain a crude liquor;

[0040] (7) Aging: aging the crude liquor in step (6) at 4° C. for 14 to 21 days;

[0041] (8) Centrifugation: After the crude wine from step (7) is aged, centrifuge it at 4000 rpm for 10 minutes. The supernatant is collected by filtration to obtain the Guoguang cider sample.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] (1) The method of the present invention for obtaining natural brewing yeast from Guoguang apple naturally fermented mash through multi-stage screening is relatively simple and easy to implement compared with other methods for obtaining natural brewing yeast.

[0044] (2) The present invention utilizes a method of ARTP mutagenesis breeding combined with multi-stage mutagenesis to obtain brewer's yeast with good fermentation performance, which can efficiently and accurately screen out mutated brewer's yeast suitable for fermentation and brewing.

[0045] (3) The brewer's yeast with the deposit number CGMCC No. 34726 of the present invention is used to produce high-quality Guoguang cider. The resulting cider can achieve a relatively suitable alcohol content, aroma, and various physical and chemical indicators, and has outstanding performance compared to Guoguang cider fermented with commercial yeast. The malic acid content in the resulting Guoguang cider is lower than that in Guoguang cider fermented with other commercial yeasts. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is a genetic stability monitoring chart of Guoguang cider fermented by brewer's yeast with the deposit number CGMCC No.34726. DETAILED DESCRIPTION

[0047] Example 1: Mutagenesis of Guoguang Apple Wine Natural Saccharomyces cerevisiae

[0048] 1. Isolation and purification of natural brewing strains

[0049] Take 0.1mL of the naturally fermented mash sample of Natural Guoguang Cider and add it to 0.9mL of sterile water. Then perform a gradient dilution of 10, 100, 1000, and 10,000. After the dilution is complete, take 100μL of each dilution and spread it on a YPD solid plate. Incubate at 28-30℃ for 72-120 hours, and observe the colonies growing on the plate. Select a portion of the colonies that conform to yeast morphology and prepare slides for observation under a microscope. Morphological observation is performed according to the "YEAST" guide. After confirming the morphological characteristics and identifying it as yeast, the single colony is streaked onto a new solid culture medium plate for isolation and purification.

[0050] Among them, the formula of YPD solid culture medium is: 0.5% to 1.5% yeast extract, 1% to 2% peptone, 2% to 4% glucose, 1.5% to 2.5% agar powder, and the rest is distilled water.

[0051] 2. Initial screening of natural yeast strains

[0052] The purified yeast was inoculated into YPD liquid medium to a concentration of 1×10 7 After measuring the CFU / mL, inoculate at a 3% inoculum into a test tube containing 5-7 mL of YPD liquid culture medium, containing an inverted Dulbecco's tubule. After inoculation, incubate at 30°C with shaking, observing gas production in each test tube every 2 hours for 12-16 hours. Select the pre-screened yeast strain with the best gas production and store it for future use.

[0053] 3. Rescreening of natural brewer's yeast strains

[0054] The strains collected from the initial screening were selected for brewing Guoguang cider at a temperature of 18-20°C. Fermentation progress was monitored by monitoring CO2 loss during fermentation. Fermentation was complete when the CO2 weight loss during fermentation was less than 0.2g. After completion, the resulting wine samples were olfactory tested, and the basic physicochemical parameters of the five wine samples with favorable olfactory evaluations were measured. Combining olfactory intensity and physicochemical properties, the strain C69 with the best performance was selected for ITS rRNA sequencing.

[0055] The ITS rRNA sequencing sequence of C69 is as follows:

[0056] CCTCTTTCCGGAAGGGGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGA

[0057] AAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGA

[0058] GATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTT

[0059] CTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACC

[0060] GTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGA

[0061] GCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTC

[0062] AAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATC

[0063] TCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAG

[0064] AATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCA

[0065] TGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTG

[0066] GAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCT

[0067] CTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAAT

[0068] CTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACA

[0069] ATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAA

[0070] TAAGCGGAGGAAA

[0071] The strain identification results were imported into the NCBI website (https: / / blast.ncbi.nlm.nih.gov / ) for nucleic acid sequence BLAST, and based on the alignment results, it was identified as Saccharomyces cerevisiae (Sequence ID: U53879.1).

[0072] The brewing conditions of Guoguang cider are total sugar content of 150-180 g / L, SO2 150-200 mg / L, and the inoculation amount of brewer's yeast is 1×10 7 CFU / mL. The physical and chemical properties were tested in accordance with GB / T 15038-2006 "General Analytical Methods for Grape and Fruit Wine".

[0073] 4. Mutagenesis of Natural Saccharomyces cerevisiae C69

[0074] The C69 strain was mutated using room temperature atmospheric pressure plasma (ARTP) mutagenesis technology.

[0075] Mutagenesis equipment: ARTP--ⅢS, Wuxi Yuanqing Tianhe Biotechnology Co., Ltd., and operated normally according to the equipment instructions.

[0076] Experimental procedure: Select a single colony from the plate of C69 strain and inoculate it into a triangular flask containing 50mL YPD seed medium. Incubate in a shaker at 28℃~32℃ at 180rpm~220rpm for 12~14 hours to obtain a logarithmic phase bacterial solution. Take 1mL of the bacterial solution in the logarithmic phase, collect the cells by centrifugation, wash three times with 0.9% sterile saline, and then resuspend the cells to make the OD 600 Between 0.9 and 1.1. Take 10μL of the treated bacterial solution and evenly spread it on the ARTP metal slide, and then transfer it to the ARTP mutagenesis irradiation area. Set the power to 110W~120W, the carrier gas volume to 10SLM, the mutagenesis time to 0s~180s on the control panel, and click "Start" to process the sample. After processing, transfer the metal slide to a centrifuge tube containing 1mL0.9% saline and shake it thoroughly. After the shaking is completed, collect the bacterial solution, dilute it appropriately, and spread it on the YPD solid plate. Calculate the mutagenesis lethality with a treatment time of 0s as a reference. Select single colonies on the plate with a lethality of 95%~97% for multiple mutagenesis. The mutagenesis time is the time when the lethality reaches 95%~97%. After the mutagenesis is completed, collect single colonies.

[0077] The formula for the mutagenic lethality is:

[0078]

[0079] Example 2: Screening of Guoguang Apple Wine Natural Saccharomyces cerevisiae after Mutagenesis

[0080] 1. Initial screening after natural brewer's yeast mutagenesis

[0081] The single colony after mutagenesis in Example 1 was collected and inoculated into YPD liquid medium for cultivation for 12 to 16 hours. After the cultivation was completed, the bacterial solution was diluted with sterile water to adjust the bacterial solution OD 600 Take the same amount of bacterial solution and inoculate it into 200μL YPD (pH 3.0, 10% ethanol) 96-well plate, culture at 30℃ with shaking for 1.5-2.5 days, and measure OD using a microplate reader. 600 Use the uninoculated culture medium as the control and select the culture medium with the higher OD value. 600 Improve the mutant strain by more than 20%.

[0082] The formula of YPD (pH 3.0, 10% ethanol) liquid culture medium is as follows: 0.5% to 1.5% yeast extract, 1% to 2% peptone, 2% to 4% glucose, containing 10% ethanol, adjusted to pH 3.0 with dilute hydrochloric acid, and the rest is distilled water.

[0083] 2. Rescreening after natural brewer's yeast mutagenesis

[0084] After activation, the mutant strains obtained in the initial screening were inoculated with 5% YPD liquid medium and cultured for 12-16 hours. The cells were collected by centrifugation, washed and suspended in phosphate buffer solution, and then used for esterase activity determination. The yeast strain with high esterase activity, deposited with CGMCC No. 34726, was selected for the production of Guoguang cider.

[0085] The esterase activity determination method was based on the method of Matthews A et al. published in Biochemical characterization of the esterase activities of wine lactic acid bacteria. (Applied Microbiology and Biotechnology. 2007, 77(2): 329-337).

[0086] Example 3: Genetic stability test of Guoguang cider natural brewer's yeast after mutagenesis

[0087] The cerevisiae yeast with the deposit number CGMCC No.34726 was subcultured for 7 generations, and the total esterase activity and fermentation days of each generation were measured. Figure 1 shown.

[0088] It can be seen that the total esterase specific activity and fermentation performance of Saccharomyces cerevisiae with the deposit number CGMCC No. 34726 remained relatively stable during the 7th generation of subculture, and can be used in the production of Guoguang cider.

[0089] Example 4: Fermentation process of Guoguang apple wine

[0090] 1. Activation of Saccharomyces cerevisiae with a deposit number of CGMCC No. 34726

[0091] The yeast strain CGMCC No. 34726 was inoculated into a 50 mL YPD seed medium flask and cultured in a shaker at 28°C to 32°C at 180 rpm to 220 rpm for 12 to 14 hours to obtain a bacterial solution. The bacterial solution was diluted with sterile water to a uniform concentration close to 1×10 7 CFU / mL.

[0092] 2. Brewing of Guoguang Cider

[0093] Guoguang apples from Gaizhou City, Liaoning Province were used as raw materials and Guoguang cider was fermented according to the following steps.

[0094] (1) Soaking: Select Guoguang apples with intact surfaces, soak them in water, and drain the water;

[0095] (2) Cutting: Cut the washed Guoguang apples into pieces, remove the core, and cut into tubers for later use;

[0096] (3) Pulping: After cutting Guoguang apples, add edible water according to the material-water ratio of 7.0:3.0, add sucrose to adjust the total sugar content of the pulp to 150-180 g / L, SO2 (added as potassium metabisulfite) to 150-200 mg / L, and put 250 mL to 300 mL of Guoguang apple pulp into 500 mL triangular bottles;

[0097] (4) Inoculation: Saccharomyces cerevisiae with a preservation number of CGMCC No. 34726 was inoculated at a 5% inoculation rate. The total concentration of the inoculated Saccharomyces cerevisiae was approximately 1×10 7 CFU / mL, the inoculation process was completed in a clean bench;

[0098] (5) Fermentation: Fermentation was carried out at 20°C. The fermentation process was monitored by measuring the CO2 mass loss. Fermentation was terminated when the CO2 mass loss was less than 0.2 g within 12 h.

[0099] (6) Filtration: After the fermentation in step (5) is completed, the fermented slurry is filtered using sterile gauze to obtain a crude liquor;

[0100] (7) Aging: aging the crude liquor in step (6) at 4° C. for 14 to 21 days;

[0101] (8) Centrifugation: After the crude wine in step (7) is aged, centrifuge it at 4000 rpm for 10 minutes. Filter and collect the supernatant, which is the Guoguang cider sample.

[0102] Example 5: Analysis of physical and chemical parameters of Guoguang cider fermented with Saccharomyces cerevisiae, C69 yeast and commercial Saccharomyces cerevisiae

[0103] 1. Analysis of total acid and organic acid in Guoguang cider fermented with Saccharomyces cerevisiae (CGMCC No. 34726), C69 yeast and commercial Saccharomyces cerevisiae

[0104] Total acidity is an important physicochemical property routinely tested in fruit wine quality analysis. This physicochemical property is determined in accordance with GB / T15038-2006, "General Methods for the Analysis of Grape and Fruit Wine." High-performance liquid chromatography (HPLC) was also used to determine the presence of malic, lactic, tartaric, and citric acids in the samples. Samples were filtered through a 0.22 μm aqueous microporous membrane filter before injection using a C18 column, mobile phase: 20 mmol·L⁻¹ KH₂PO₄ (pH 2.5), flow rate: 0.8 mL·min⁻¹, column temperature: 30°C, UV detection wavelength: 210 nm, and injection volume: 10 μL.

[0105] The total acid and organic acid contents of wine samples fermented by three yeasts are shown in Table 1.

[0106] Table 1 Total acid and organic acid of Guoguang cider fermented by three yeasts

[0107]

[0108] 3. Analysis of flavor compounds in Guoguang cider fermented with Saccharomyces cerevisiae (CGMCC No. 34726), C69 yeast, and commercial Saccharomyces cerevisiae

[0109] Flavor compounds are important for the quality of fruit wine. Therefore, headspace solid phase microextraction coupled with gas chromatography-mass spectrometry was used to analyze the flavor compounds in Guoguang cider fermented with three yeasts.

[0110] Equipment: Agilent 6890GC, Agilent 5975mass

[0111] The method design refers to the article Changes in flavor characteristics and bacterial diversity during the traditional fermentation of Chinese rice wines from Shaoxing region (Food Control, 2014, 44: 58-63.) by Wang et al.

[0112] The main flavor substances of Guoguang cider fermented by three yeasts are shown in the table.

[0113] Table 2 Main flavor compounds of Guoguang cider fermented by three yeasts

[0114]

[0115]

[0116] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Saccharomyces cerevisiae, characterized in that: The Saccharomyces cerevisiae strain is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No.34726.

2. A method for screening a strain of Saccharomyces cerevisiae, characterized in that: The method comprises the following steps: isolation and purification of natural brewer's yeast, primary screening of natural brewer's yeast, secondary screening of natural brewer's yeast, small-scale fermentation test of natural brewer's yeast, identification of natural brewer's yeast with outstanding performance, primary screening of fermentation performance using gas production capacity as an evaluation indicator, and secondary screening for ITS rRNA sequencing.

3. A method for mutagenesis of a strain of Saccharomyces cerevisiae, characterized in that: The method comprises the following steps: bacterial liquid culture, bacterial liquid mutagenesis, primary screening of mutagenized strains, secondary screening of mutagenized strains, and physical, chemical, and quality analysis of Guoguang cider. During bacterial liquid mutagenesis, a bacterial suspension is evenly smeared on a metal slide, and the slide is then placed in a normal-pressure room-temperature plasma mutagenesis breeding instrument. After the treatment is completed, the slide automatically falls into a centrifuge tube filled with physiological saline; the centrifuge tube is vortexed to form a new bacterial suspension, which is appropriately diluted and then applied to a plate, which is then statically cultured at 25-35°C. A bacterial suspension not treated with ARTP is used as a control, and single colonies of Saccharomyces cerevisiae with a lethality rate greater than 95% on the plate are selected for multi-stage mutagenesis.

4. The method for mutagenesis of yeast according to claim 3, wherein The initial screening of mutagenic strains was based on OD 600 As an evaluation indicator.

5. The method for mutagenesis of yeast of claim 3, wherein: The esterase activity of the mutagenized strains was determined.

6. The method for mutagenesis of yeast according to claim 3, wherein Physicochemical and quality analyses included conventional physicochemical indices, total phenolics, in vitro antioxidant activity, organic acids, monomeric phenols, and volatile flavor compounds.

7. Use of a strain of Saccharomyces cerevisiae, characterized in that: Used in the production of Guoguang cider.

8. The use of brewer's yeast according to claim 7, characterized in that Guoguang cider has the following characteristics: (1) The fermentation period is 7 to 9 days, the alcohol content of the fermented fruit wine is 8.0 to 9.0% (v / v), and the aging period is 14 to 21 days; (2) The total acid content of fermented fruit wine is 3.9-4.2 g / L, and the total sugar content is 4.2-6.1 g / L; (3) No bad smell, rich wine aroma.

9. A method for producing Guoguang cider, characterized in that: The method comprises the following steps: soaking, cutting, pulping, inoculating, fermenting, filtering, aging and centrifuging. During the fermentation process, the inoculation amount of brewer's yeast is 3% to 5% (w / w pulp), the fermentation temperature is 20 to 25° C., and the fermentation time is 7 to 8 days.

10. The method for producing Guoguang cider according to claim 9, characterized in that: The aging temperature is 0-4°C and the time is 14-21 days.

Images