TaIMPA1 gene and application thereof in improving plant genetic transformation efficiency

Abstract

The application discloses TaIMPA1 A gene and application thereof in improving plant genetic transformation efficiency. The nucleotide sequence is shown in the sequence table SEQ ID No: 1. The application clones the key gene from a plant body for the first time TaIMPA1 which enhances the genetic transformation performance by significantly improving the efficiency of exogenous DNA delivery. The finding fills the research blank of endogenous delivery regulatory factors in plants and provides an original solution to the core problem of overcoming genotype dependence.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to TaIMPA1 a gene and its application in improving plant genetic transformation efficiency. BACKGROUND

[0002] As a key technology and basic link of biological breeding, transgenic technology has become a strategic focus for strengthening international competitiveness in agriculture and seizing the commanding heights of technology in the field of future agriculture. The key to its success lies in the establishment of a high-efficiency genetic transformation system. Genotype dependence is a bottleneck problem that has long plagued plant genetic transformation. The genetic transformation of model plants such as tobacco, Arabidopsis and rice also has strong genotype dependence, which limits the breadth and depth of genetic improvement of excellent crop varieties using transgenic technology. With the increasing maturity and popularization of transgenic and gene editing technologies, it has become increasingly urgent to crack the problem of genotype dependence.

[0003] The complex process of plant genetic transformation usually covers two key stages: precise delivery of genetic elements and effective regeneration of plant bodies. Among them, the delivery of genetic elements is the primary challenge of genetic transformation, which directly restricts the efficiency of the entire transformation process. Traditional genetic element delivery is mainly mediated by Agrobacterium and gene gun, which is mature in technology and widely used, but also has low efficiency, small carrying capacity and species restriction and other restricting factors. By optimizing Agrobacterium strains, the binary, superbinary and ternary vector system with additional Vir gene auxiliary plasmid can improve the efficiency of genetic element delivery and genetic transformation. The T3SS gene can be normally expressed in Agrobacterium, which can be used to deliver T3Es or plant protein H2A-1 into plant cells, thereby improving the efficiency of Agrobacterium-mediated plant genetic transformation. Plant regeneration is a research hotspot in recent years and is also the main technical means for expanding the genotype range of plant genetic transformation receptors. Corteva (formerly DuPont Pioneer) first used plant stem cell development key genes Bbm ( Baby boom )and Wus2 ( Wuschel2 )to successfully improve the genetic transformation efficiency of multiple commercial corn inbred lines and expand the genotype range of corn genetic transformation. At the same time, the company also uses Bbm and Wus2Gene establishes a method of obtaining transgenic and gene edited plants using leaves, and is verified in 9 kinds of gramineous plants such as barley, corn, rice, ryegrass, etc. Jorge Dubcovsky of University of California, Davis, found that the GRF-GIF fusion protein can greatly improve the regeneration efficiency of monocotyledonous and dicotyledonous plants such as wheat, rice and citrus. The research team of Wang Ke of the Institute of Crop Science, Chinese Academy of Agricultural Sciences has been committed to the establishment of wheat genetic transformation technology system and regeneration gene mining, and found that TaWOX5 Gene can greatly improve the genetic transformation efficiency of wheat, and expand the genotype range of wheat genetic transformation. Using this gene can also significantly improve the genetic transformation efficiency of monocotyledonous plants such as barley, triticale, rye, cultivated einkorn and corn. The gene has been granted patents in China, the United States and Australia, and has been successfully authorized to Japan Tobacco Company / Zhonghua Company, France Limagrain Company and domestic Quanmai Agricultural Technology Co., Ltd. (Shandong) and other units. The team of Li Chuan-you of Shandong Agricultural University first identified the primary wound signal molecule that induces plant regeneration-REF1, and systematically revealed the signal transduction network of REF1 regulating tissue repair and organ regeneration. By externally applying REF1, the regeneration capacity and genetic transformation efficiency of tomato, soybean, wheat and corn can be significantly improved. In addition, studies have shown that TaDOF5.6 、 TaDOF3.4 and TaLAX1 Genes such as can also greatly improve the genetic transformation efficiency of plants. SUMMARY

[0004] The purpose of the present application is to provide TaIMPA1 Gene and its application in improving the genetic transformation efficiency of plants.

[0005] A TaIMPA1 Gene, the polynucleotide of the TaIMPA1 Gene is as shown in (a), (b), (c) or (d):

[0006] (a) the polynucleotide as shown in the sequence table SEQ ID No: 1; or

[0007] (b) a polynucleotide capable of hybridizing to the complement of SEQ ID No: 1 under stringent hybridization conditions, the protein encoded by the polynucleotide still has the function of improving the genetic transformation efficiency of plants;

[0008] (c) a polynucleotide having at least 90% or more homology with the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) a polynucleotide mutant obtained by deletion, substitution or insertion of one or more bases in the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of improving the genetic transformation efficiency of plants.

[0010] A TaIMPA1 protein, the amino acid sequence of which is shown in (a), (b) or (c):

[0011] (a) the amino acid sequence shown in SEQ ID No: 2; or

[0012] (b) an amino acid having at least 90% or more homology with the amino acid shown in SEQ ID No: 2; or

[0013] (c) a protein mutant obtained by deletion, substitution or insertion of one or more amino acids in the protein shown in SEQ ID No: 2, and the protein still has the function of improving the genetic transformation efficiency of plants.

[0014] The plant is a wheat or an Avena plant; the wheat plant is wheat, and the Avena plant is oat. Preferably, the wheat is Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22 or Jing 411; and the oat is Mofeng, Zhongyan No. 1 or Galileo.

[0015] A recombinant vector comprising the TaIMPA1 gene.

[0016] An engineered bacterium comprising the TaIMPA1 recombinant vector of the gene.

[0017] A transgenic plant cell line comprising the TaIMPA1 gene.

[0018] A primer for detecting any fragment of the TaIMPA1 gene.

[0019] The TaIMPA1 gene for use in improving the genetic transformation efficiency of plants.

[0020] A method for improving the transformation efficiency of a nucleic acid molecule in transforming plants, comprising introducing the TaIMPA1 gene into plants via a plant expression vector.

[0021] The plant expression vector is a pWMB110 vector.

[0022] A novel method for improving the genetic transformation efficiency of plants, characterized in that the method comprises simultaneously introducing a gene for improving delivery efficiency and a gene for improving regeneration capacity into plants via a plant expression vector; the gene for improving delivery efficiency isTaIMPA1 Gene; the gene that enhances regenerative capacity is TaWOX5 Gene.

[0023] Beneficial effects of the present invention: The present invention constructs pWMB110- TaIMPA1 pWMB110- TaIMPA1-TaWOX5 pWMB110- Ruby pWMB111- TaWOX5 pWMB110-SpCas9- TaIMPA1 Gene editing vectors were used to transform the aforementioned vectors into Agrobacterium C58C1, respectively. The pWMB110-SpCas9- TaIMPA1 Gene editing vectors were created by Fielder. TaIMPA1 Mutants of the gene. Then pWMB110- Ruby Agrobacterium, pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1 pWMB110- Ruby Agrobacterium and pWMB111- TaWOX5 and pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1-TaWOX5 Mixed bacteria introduced into wheat and TaIMPA1 The mutants were identified, and the transient infection efficiency was statistically analyzed. Finally, transgenic positive plants were obtained, and the transformation efficiency was statistically analyzed. The results showed that... TaIMPA1 Among the mutants of the gene, pWMB110- Ruby The transient infection efficiency of Agrobacterium was significantly reduced when using pWMB110- TaIMPA1 or pWMB110- TaIMPA1-TaWOX5 At that time, the instantaneous infection efficiency could be restored to the control level, therefore TaIMPA1 Genes significantly impact transient infection efficiency. In Fielder, pWMB110 -Ruby Compared to Agrobacterium C58C1 infection, pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1 The transient and genetic transformation efficiency of wheat was significantly improved after infection with mixed bacteria, pWMB110- Ruby Agrobacterium and pWMB110- TaIMPA1-TaWOX5 The mixed bacteria exhibited the highest transient infection efficiency and final genetic transformation efficiency. This indicates that... TaIMPA1 Genes can improve the final transformation efficiency of plants by increasing delivery efficiency. Furthermore, pWMB110- Ruby Vector / Agrobacterium C58C1 and pWMB110- TaIMPA1-TaWOX5Agrobacterium infection of oats showed that, compared with pWMB110- Ruby Compared to infection with Agrobacterium C58C1, infection with pWMB110- TaIMPA1-TaWOX5 The genetic transformation efficiency of oats infected with Agrobacterium was significantly improved. These results indicate that... TaIMPA1 Genes can improve the final transformation efficiency of plants by increasing delivery efficiency; TaIMPA1 Gene delivery solution TaWOX5 Genes solve regeneration TaIMPA1 and TaWOX5 The best results are achieved when used simultaneously. This method can be used to address the problem of genotypic limitations in plant transformation, especially in cereals, with oats and wheat being the most prominent examples. TaIMPA1 and TaWOX5 Genes can be mixed with target genes in different vectors and then transformed to improve the transformation efficiency of target genes and expand the range of genotypes. Attached Figure Description

[0024] Figure 1 pWMB110- TaIMPA1 Schematic diagram of the carrier.

[0025] Figure 2 pWMB110- TaIMPA1-TaWOX5 Carrier schematic diagram 。

[0026] Figure 3 pWMB110-SpCas9- TaIMPA1 Schematic diagram of the carrier.

[0027] Figure 4 The sequence is a homozygous mutant sequence that generates frameshift mutations simultaneously in the A, B, and D genomes.

[0028] Figure 5 TaIMPA1 Comparison of regeneration capacity between gene mutants and controls.

[0029] Figure 6 TaIMPA1 The impact of genes on instantaneous delivery efficiency. Detailed Implementation

[0030] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0031] The experimental methods in the following examples are all routine methods, unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0032] The plasmids and strains cited in the following examples are only used to further illustrate the present application and do not limit the essential content of the present application. If the specific experimental conditions are not specified, they are according to the conventional conditions well known to those skilled in the art, such as the conditions described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or according to the conditions recommended by the manufacturer.

[0033] The plasmids and strains cited in the experimental examples are as follows: The plant expression vectors pWMB110 and pWMB110-Cas9 are described in Liu et. al 2020 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium -mediated CRISPR system. Journal of Experimental Botany, 71:1337-1349. The name of the plasmid pWMB110 in this document is pWMB110-Cas9. It can also be purchased through conventional channels.

[0034] Plant expression vector pWMB110-Ruby, pMB110-GUS and Zhongyan No. 1 are described in Shi K, Huang WH, Zhu MX, Teng SZ, Zhang JL, Duan ZZ, Zhu CC, Hu T, Wang K, Wang Z. Efficient genetic transformation and genome editing via an Agrobacterium -mediated CRISPR system in commercial oat (Avena sativa L.) cultivars. Journal of Integrative Plant Biology, 2025, 67(7): 1697-1699. Avena sativa

[0035] Escherichia coli TOP10: a commercially available product of Beijing City Full-time Gold Company; Escherichia coli PRK2013 and preserved by the laboratory, are commercially available products.​

[0036] Plant expression vector pWMB111-TaWOX5 and Zhengmai 7698, Dwarf 58, Kenong 199, Jimai 22 and Jing 411 are all described in Wang et. al 2022 The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nature Plants, 8:110-117, Zhengmai 7698, Dwarf 58, Kenong 199, Jimai 22 and Jing 411 are also available for purchase through conventional routes.

[0037] pWMB123 vector and helper bacteria PRK2013 are described in Wang et. Al 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties Plant biotechnology journal 15:614-623, the name of the pWMB123 vector in this document.

[0038] Agrobacterium rhizogenes C58C1 is described in Wang et. al 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties Plant biotechnology journal 15:614-623, and is also available for purchase through conventional routes. Agrobacterium

[0039] Example 1, Wheat TaIMPA1 Functional verification of the gene in wheat

[0040] I. Wheat TaIMPA1 Gene cloning and transgenic vector construction

[0041] Design primers:

[0042] TaIMPA1 ​F: TGCAGGTCGACTCTAGAGGATCCATGCCGCAGACGC CATC (SEQ ID No: 4);

[0043] TaIMPA1 R: ACGATCGGGGAAATTCGAGCTCCTAGTTTGTGGAGGTGG AGCAAG (SEQ ID No: 5).

[0044] Genomic DNA was extracted from the wheat variety CB037 as a template, and the above primers were used. TaIMPA1 F and TaIMPA1 R was used for AS-PCR amplification to obtain the PCR product (SEQ ID No: 3), which was then used for later use; BamH I and Sac The pWMB110 vector was digested with restriction endonuclease I to obtain a linearized vector.

[0045] The PCR product and the linearized vector were ligated using infusion. The reaction solution was then transformed into *E. coli* Top10, and after antibiotic selection and sequencing, the plasmid with correct sequencing was named pWMB110- TaIMPA1 carrier ( Figure 1 ). Containing pWMB110- TaIMPA1 The strain was named pWMB110- TaIMPA1 / Top 10 E. coli, for future reference.

[0046] TaIMPA1 The coding region of the gene is 1605 bp long, encoding 534 amino acids. The amino acid sequence of the protein encoded by this gene is shown in SEQ ID No: 2, and the protein is named... TaIMPA1 protein.

[0047] according to TaIMPA1 The gene sequence was designed as a template, and primers (UBIF: AAACGACGGCCAGTGCCAAGCTTGCAGCGTGACCCGGTCGTG; SEQ ID No: 6) were used. Nos R: CTGCACTGCAGGCATGCAAGCTTGATCTAGTAACATAGATGA; SEQ ID No: 7), the entire UBI-TaWOX5-NOS was amplified and combined with... Hind pWMB110- digested with restriction endonuclease III TaIMPA1 The vector was infusion-ligated to obtain pWMB110- TaIMPA1-TaWOX5 carrier ( Figure 2Due to the edited SgRNA sequence (AGAGCGAAGCCCTCCAATTGAGG; SEQ ID No: 8), according to Liu et al. 2020 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium -mediated CRISPR system. Journal of Experimental Botany, 71:1337-1349. Gene editing vectors were constructed. First, a first round of PCR was performed: 3 ng of TaU3 plasmid was used as a template, and four primers were used in one reaction: UF (CTCCGTTTTACCTGTGGAATCG; SEQ ID No: 9), gR-R (CGGAGGAAAATTCCATCCAC; SEQ ID No: 10), IMPAF (GAGCGAAGCCCTCCAATTGgttttagagctagaaat; SEQ ID No: 11), and IMPAR (CAATTGGAGGGCTTCGCTCTGCTTCTTGGTGCCGCGCCTCC; SEQ ID No: 12), each at 0.1 μM. Cycles were performed: 94 ℃ for 10 s, 58 ℃ for 15 s, and 68 ℃ for 20 s. Then, a second round of PCR was performed: 1 μl of the first round PCR product was diluted 10-fold with H2O, and 1 μl was used as a template. ZWHind-UF (CTGCACTGCAGGCATGCAAGCTTAGTATGGAATCGGCAGCA AAGG; SEQ ID No: 13) and ZWHindR (AAACGACGGCCAGTGCCAAGCTTACGCGTATCCATCCACTCCAAGCTCTTG; SEQ ID No: 14) were used as primers. Cycles were performed: 94 ℃ for 10 s, 58 ℃ for 15 s, and 68 ℃ for 20 s. The gel was then analyzed, and the product was purified and recovered. Then, it was compared with... Hind The pWMB-110-Cas9 vector, digested with enzyme III, was subjected to infusion to produce pWMB-110-Cas9- TaIMPA1 carrier ( Figure 3 ).

[0048] 2. Recombinant plasmid was transformed into Agrobacterium rhizogenes C58C1

[0049] 1) Agrobacterium rhizogenes C58C1 (abbreviated as Agrobacterium C58C1) was cultured in 4 ml of LB medium containing Rif (rifampicin) and Gen (gentamicin) in a test tube at 180 rpm and 28°C for 40 h to obtain Agrobacterium C58C1 bacterial solution; the above-mentioned E. coli Top10 and helper bacteria PRK2013 were respectively cultured in 4 ml of LB medium containing Kan (kanamycin) in a test tube at 225 rpm and 37°C for 16 h to obtain the above-mentioned E. coli Top10 bacterial solution and helper bacteria PRK2013 bacterial solution;

[0050] 2) 100 μl of the above-mentioned Agrobacterium C58C1 bacterial solution, the above-mentioned E. coli Top10 and the above-mentioned helper bacteria PRK2013 bacterial solution were added to a 1.5 ml centrifuge tube, mixed, and a mixed bacterial solution (target bacteria) was obtained;

[0051] 3) The supernatant was discarded, and the remaining supernatant was sucked dry with a pipette gun. 50 μl of LB medium without antibiotics was added to resuspend the bacterial cells, and the resuspended bacterial cells of the target bacteria were obtained;

[0052] 4) The resuspended bacterial cells of the target bacteria were added to LB solid medium without antibiotics without shaking the plate, and the bacterial cells were formed into a mass. After the plate was dried, it was sealed with a sealing film, and cultured at 28°C for 24 h to obtain Agrobacterium bacterial cells of the target bacteria. A small amount of bacterial cells was taken from the Agrobacterium bacterial mass of the target bacteria with an inoculation needle, and streaked on LB solid medium containing Rif (50 mg L -1 ), Gen (50 mg L -1 ), and Kan (50 mg L -1 ) at 28°C for 48 h to obtain a three-parent hybrid plate.

[0053] 6) Single colonies were picked from the three-parent hybrid plate, and PCR was used to verify positive Agrobacterium strains, i.e., the target vector / Agrobacterium C58C1 (using the genomic DNA of the target vector as a template, and using the above-mentioned detection primers of each vector to perform PCR, and screening for positive Agrobacterium strains).

[0054] 3. Agrobacterium-mediated transformation of wheat

[0055] The detailed steps and methods are referred to Wang et al., 2022, as follows:

[0056] 1) Four days before infection, Agrobacterium containing the target gene was inoculated into LB medium containing Gent (gentamicin), 50 mg L -1 , Kana 50 mg L -1 , Rif (rifampicin), and 50 mg L -1on YEP solid medium, 28℃ in dark for 3 days. Single colony was picked up in 10 ml YEP liquid medium containing Gent 50 mg L -1 , Kana 50 mg L -1 , Rif 50 mg L -1 , 200 rpm, 28℃ in dark overnight, and the concentration of Agrobacterium containing target gene was adjusted to OD 600 =0.6.

[0057] 2) The Agrobacterium was collected by centrifugation at 3,500 rpm for 10 min at room temperature, and the supernatant was discarded. The bacterial pellet was resuspended in MS resuspension solution [1 / 10 MS basic medium (Beijing Ximeijie Technology Co., Ltd., Catalog No.: M519, glucose 10 g L -1 ], and the resuspension solution of Agrobacterium containing target gene was obtained (the mixed bacterial solution was mixed at a ratio of 1:1).

[0058] 3) The wheat immature embryos of different varieties at about 14 days after flowering were infected with the resuspension solution of Agrobacterium containing target gene, and then plated on AS basic co-culture medium (1 / 10 MS basic medium, glucose 10 g L -1 , agar 8 g L -1 ) and cultured at 25℃ for 3 days.

[0059] 4) The immature embryos after co-culture were transferred to recovery medium WLS-RES (MS basic medium, 2,4-D 0.5 mg L -1 , picloram 2.2 mg L -1 , Cb (carbenicillin) 400 mg L -1 , Cef (cefotaxime) 100 mg L -1 ) and cultured in dark for 5 days.

[0060] 5) The immature embryos after recovery culture were transferred to the first screening medium WLS-P5 (MS basic medium, 2,4-D 0.5 mg L -1 , picloram 2.2 mg L -1 , PPT (phosphinothricin) 5 mg L -1 , Cb 400 mg L -1 , Cef 100 mg L -1 ) and cultured in dark for 14 days.

[0061] 6) Then transfer the callus to the first screening medium WLS-P10 (MS basal medium, 2,4-D 0.5 mg / L). -1 picloram 2.2 mg L -1 PPT 10 mg L -1 Cb 400 mg L -1 Cultivate in darkness for 21 days.

[0062] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basal medium, PPT 5 mg / L). -1 ), and cultured under light for 2 weeks.

[0063] 8) Isolate the wheat shoots and place them on MSF-P5 rooting medium (MS medium, PPT 5 mg / L). -1 IBA 0.5mg / L -1 The seedlings were cultured for 21 days. Once the roots had developed, the seedlings were transplanted into soil to obtain transgenic plants carrying the target gene. Transgenic testing was then performed, and the number of positive plants was counted.

[0064] 4. TaIMPA1 Obtaining gene-edited mutants and TaIMPA1 Effects on plant regeneration ability

[0065] Design the genomes of A, B, and D respectively TaIMPA1 Gene-specific primers were used, and PCR-RE detection and sequencing were performed, ultimately obtaining three plants with simultaneous mutations in the A, B, and D genomes. Since some mutants have a 3bp deletion that does not lead to frameshift mutations, we ultimately screened for a homozygous mutant with frameshift mutations simultaneously in the A, B, and D genomes. Figure 4 ).

[0066] We conducted a comparative experiment on the regeneration capacity of the immature embryos of Fielder wheat and its mutants. Figure 5 a). Results showed that during the callus induction phase, the control (CK) and TaIMPA1 The callus induction rates of the mutant embryos were 91.2% and 92.3%, respectively. Figure 5 b) After 3 weeks of culture, the callus tissue was transferred to differentiation medium, Fielder and TaIMPA1 The plant regeneration efficiencies of the mutants were 86.4% and 89.1%, respectively. Figure 5 c). Statistical analysis showed no significant difference between Fielder and the mutant in either callus induction efficiency or plant regeneration efficiency. Therefore, we conclude that: TaIMPA1 The gene mutation did not affect the regenerative capacity of wheat tissue.

[0067] TaIMPA1 Effect of genes on transient delivery efficiency

[0068] Immature embryos of wheat variety Fielder and its three mutant edited lines (Fielder-1, Fielder-2 and Fielder-3) were used as control and experimental materials. Four groups of vector treatments were set up: 1) pWMB110- Ruby as control; 2) pWMB110- Ruby, pWMB110- Ruby, pWMB110- Ruby and pWMB110- Ruby were co-transformed into immature embryos of Fielder at a ratio of 1:1:1:1, respectively; 3) pWMB110- Ruby, pWMB110- Ruby, pWMB110- Ruby and pWMB110- Ruby were co-transformed into immature embryos of Fielder-1 at a ratio of 1:1:1:1, respectively; 4) pWMB110- Ruby, pWMB110- Ruby, pWMB110- Ruby and pWMB110- Ruby were co-transformed into immature embryos of Fielder-2 at a ratio of 1:1:1:1, respectively; 5) pWMB110- Ruby, pWMB110- Ruby, pWMB110- Ruby and pWMB110- Ruby were co-transformed into immature embryos of Fielder-3 at a ratio of 1:1:1:1, respectively. The delivery efficiency of each gene was calculated by counting the number of red embryos on the recovery medium after 5 days of culture. TaIMPA1-abd Ruby Ruby TaWOX5 TaIMPA1 TaIMPA1-TaWOX5 Figure 6

[0069] In Fielder, the delivery efficiency of pWMB110- Ruby was 61.4 ± 1.0%. When the three genes were used together, the delivery efficiency of the genes decreased slightly to 58.7 ± 1.2%, which might be related to the dilution of the Ruby vector concentration in Agrobacterium. Notably, the use of the Ruby gene increased the delivery efficiency to 65.4 ± 1.2%, and co-expression with Ruby and Ruby significantly improved the delivery efficiency to 84.5 ± 0.8%, indicating that the two genes have a synergistic effect (Table 1). Ruby TaWOX5 Ruby TaIMPA1 TaIMPA1 TaWOX5

[0070] In mutants, the delivery efficiency of pWMB110- Ruby decreased significantly to 40.6 ± 2.0%, but it was restored to more than 60% by introducing the Ruby gene, reaching the efficiency level of Fielder, confirming that Ruby is a key factor affecting gene delivery efficiency (Table 1). TaIMPA1 TaIMPA1 Table 1

[0071] Effect of genes on transient infection efficiency in Fielder and mutants TaIMPA1 TaIMPA1-abd

[0072]

[0073] Two, TaIMPA1 Effect of genes on genetic transformation efficiency

[0074] Transformation efficiency = (positive seedlings / embryo number) %

[0075] To further verify the effect of the Ruby gene on genetic transformation efficiency, the following experiments were conducted: TaIMPA1 ​​​​​​​​​​​​​​​​pMB110-TaIMPA1-TaWOX5 vectors into the immature embryos of Zhengmai 7698, Aikang 58, Kenong 199, Jimai 22 and Jing 411, respectively. The results showed that the control vector (pMB110-GUS) had a transformation efficiency of about 18% in the two easily transformed varieties, Zhengmai 7698 and Kenong 199, and the transformation efficiency in the other three difficult-to-transform varieties was extremely low, not more than 5%; while the introduction of TaIMPA1 pMB110-TaIMPA1-TaWOX5 vectors significantly improved the transformation efficiency of the two easily transformed varieties, Zhengmai 7698 and Kenong 199, to more than 45%, and the transformation efficiency of the other three difficult-to-transform varieties was also significantly improved to more than 20%. In addition, when TaIMPA1 pMB110-TaIMPA1-TaWOX5 vectors were combined with TaWOX5 , the transformation efficiency of the two easily transformed varieties was further improved to more than 60%, and the transformation efficiency of the three difficult-to-transform varieties was further significantly improved to 27-30% (Table 2).

[0076] Table 2 TaIMPA1 Effect of gene combination on wheat genetic transformation efficiency

[0077]

[0078] This result fully proves that TaIMPA1 the genetic transformation ability of wheat can be enhanced by improving the gene delivery efficiency, and the synergistic effect of TaIMPA1 and TaWOX5 can simultaneously optimize the delivery and regeneration processes. Therefore, this combination strategy is expected to become a key technical solution to break through the genotype-dependent transformation bottleneck of wheat.

[0079] Example 2, TaIMPA1-TaWOX5 Application of gene combination in oat transgenesis

[0080] 1. Agrobacterium-mediated transformation of oat

[0081] The detailed steps and methods are referred to Shi et al., 2025, as follows:

[0082] 1) 4 days before infection, the above pWMB110- TaIMPA1-TaWOX5 vector / Agrobacterium and pWMB110- Ruby vector / Agrobacterium were inoculated on YEP solid medium containing Gent 50 mg L -1 , Kana 50 mg L -1 , Rif 50 mg L -1 , and recovered at 28°C in the dark for 3 days. Single colonies were picked into 10 ml containing Gent 50 mg L -1Kana 50mg L -1 Rif 50 mg L -1 In YEP liquid medium, the culture was carried out overnight with shaking at 200 rpm and 28°C in the dark to obtain activated bacterial solutions. pWMB110- TaIMPA1-TaWOX5 Vector / Agrobacterium C58C1 and pWMB110- Ruby Adjusting the OD of the vector / Agrobacterium C58C1 bacterial culture to OD 600 =0.6.

[0083] 2) Then, centrifuge at 3,500 rpm for 10 min at room temperature to collect Agrobacterium cells, discard the supernatant, and resuspend in MS resuspending medium [(1 / 10 MS basal medium (Beijing Ximeijie Technology Co., Ltd., catalog number: M519, glucose 10 g L / L)]. -1 Resuspend the bacterial pellet to obtain pWMB110- Ruby Vector / Agrobacterium infection resuspension and obtaining pWMB110- Ruby and pWMB110- TaIMPA1-TaWOX5 A 1:1 mixture of vector and Agrobacterium for infection resuspension.

[0084] 3) Select oat embryos approximately 14 days after flowering. Under aseptic conditions, surface-sterilize the immature seeds sequentially with 75% ethanol for 1 minute, then treat with 5% sodium hypochlorite for 5 minutes, and finally rinse ten times with sterile water. Separate the plumules from the fresh immature embryos and incubate them with Agrobacterium infection resuspension in a co-culture liquid medium (L3 basal salt and vitamins 4.5917 g / L, inositol 100 mg / L, maltose 30 g / L, L-asparagine 420 mg / L, acetylsuccinone 100 μM, 2,4-D 2.5 mg / L, pH 5.6-5.8) at room temperature for 5 minutes. Then transfer the embryos to a co-culture solid medium (co-culture liquid medium supplemented with 4 g / L plant gel) and co-culture at 25°C in the dark for 2 days.

[0085] 4) After co-cultivation, the remaining embryo tissues were transferred to selection recovery medium plates (L3 basal salts and vitamins 4.5917 g / L, myo-inositol 100 mg / L, maltose 30 g / L, L-asparagine 420 mg / L, 2,4-D 2.5 mg / L, thidiazuron 200 mg / L, phytagel 4 g / L, pH 5.6-5.8), and after 5 days, they were transferred to the first selection medium (L3 basal salts and vitamins 4.5917 g / L, myo-inositol 100 mg / L, maltose 30 g / L, L-asparagine 420 mg / L, 2,4-D 2.5 mg / L, thidiazuron 200 mg / L, glufosinate 5 mg / L, phytagel 4 g / L, pH 5.6-5.8) for 21 days, during which the long shoots were removed and only the callus base was left. Then the glufosinate concentration was increased to 10 mg / L in the second selection medium for 21 days. Subsequently, the embryogenic callus was transferred to fresh differentiation medium (L3 basal salts and vitamins 2.296 g / L, thidiazuron 200 mg / L, glufosinate 5 mg / L, phytagel 3 g / L, pH 5.6-5.8) and induced to differentiate under light intensity of 100 μmol m⁻² s⁻¹ at 25°C. Subculture was performed every two weeks until shoots appeared, and finally the shoots were transferred to culture cups containing rooting medium (L3 basal salts and vitamins 2.296 g / L, sucrose 20 g / L, glufosinate 5 mg / L, phytagel 4 g / L, pH 5.6-5.8) to promote elongation and rooting.

[0086] 5) The seedlings with well-grown roots were transplanted into soil to obtain transgenic seedlings of the target gene.

[0087] 2, Statistical analysis of transformation efficiency

[0088] Transformation efficiency = (positive seedlings / number of immature embryos) *

[0089] The results are shown in Table 3. The transformation efficiency of the control vector pWMB110- Ruby was 8.57% in Mafeng, but no transgenic plants were obtained in Zhanyan No. 1 and Galileo; the transformation efficiency of pWMB110- TaIMPA1-TaWOX5 was significantly improved in Mafeng, Zhanyan No. 1 and Galileo. TaIMPA1-TaWOX5

[0090] Table 3 Comparison of transformation efficiency of control vector and TaIMPA1 pWMB110-

[0091]

[0092] ​The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A kind TaIMPA1 Genes, characterized by, The TaIMPA1 The polynucleotide of the gene is shown in the sequence listing SEQ ID No:

1.

2. A TaIMPA1 protein, characterized in that, The amino acid sequence of the TaIMPA1 protein is shown in SEQ ID No: 2 of the sequence listing.

3. A recombinant vector comprising the gene of claim 1 TaIMPA1 1.

4. An engineered bacterium comprising the recombinant vector of claim 3 TaIMPA1 a gene.

5. A transgenic plant cell line comprising the gene of claim 1. TaIMPA1 5. A transgenic plant cell line comprising the gene of claim 1.

6. The method of claim 1 TaIMPA1 Use of the gene to improve genetic transformation efficiency in wheat or oats.

7. A method of increasing the transformation efficiency of a nucleic acid molecule for transformation of wheat or oats, characterized in that, The method includes the method described in claim 1. TaIMPA1 The gene was introduced into wheat or oats using a plant expression vector, specifically the pWMB110 vector.

Images