Method for improving freezing resistance of saccharomyces cerevisiae
By constructing recombinant brewer's yeast and using the ARO9 gene and the recombinant expression vector S.cry-EGFP-KanMX, the frost resistance of brewer's yeast was significantly improved, solving the problem of the survival rate of brewer's yeast in low temperature environments. It is suitable for the preparation of highly frost-resistant foods, medicines and cosmetics.
Patent Information
- Application Number
- CN202511191824.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-25
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-08-25
AI Technical Summary
The poor freeze resistance of brewer's yeast limits its application in frozen foods, frozen medicines and frozen cosmetics, affecting the quality and efficacy of the products.
By constructing recombinant Saccharomyces cerevisiae, using the ARO9 gene and the recombinant expression vector S.cry-EGFP-KanMX, the expression of ARO9 protein was induced to improve the freezing resistance of Saccharomyces cerevisiae.
The frost resistance of brewer's yeast has been significantly improved, and its survival rate in a -20°C environment has been significantly increased, making it suitable for the preparation of highly frost-resistant foods, medicines and cosmetics.
Smart Images

Figure CN120665907A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial technology and more specifically relates to a method for improving the frost resistance of brewer's yeast. Background Art
[0002] The freezing resistance of brewer's yeast is poor, mainly due to the following reasons: (1) Ice crystal damage: During the freezing process, the water inside the brewer's yeast cells will form ice crystals, which will directly pierce the cell wall and cell membrane, causing the cell contents to leak out; (2) Metabolic activity stagnation: Low temperature (<0 ℃) will completely stop the metabolism of brewer's yeast, and long-term freezing will cause the loss of organelle function. Even if thawed, it is difficult to restore normal fermentation capacity; (3) Osmotic pressure imbalance: Freezing will cause a drastic change in the water distribution inside and outside the brewer's yeast cells, resulting in osmotic pressure imbalance, which will then cause cell dehydration or swelling and rupture.
[0003] Moreover, the low frost resistance of brewer's yeast will directly or indirectly affect its application in frozen foods, frozen medicines, and frozen cosmetics. For example: (1) in the frozen food field, it may lead to a decrease in the fermentation performance of the dough, affecting the volume, texture, and taste of finished products such as bread and steamed buns; (2) in the frozen medicine field, it may lead to a decrease in the survival rate of brewer's yeast cells, or a decrease in the beneficial ingredients that can be produced, thereby affecting the stability and efficacy of the medicine; (3) in the frozen cosmetic field, it may lead to a decrease in the active ingredients that can be produced by yeast cells, thereby reducing the yield or efficacy of the cosmetics.
[0004] Therefore, finding a method to improve the frost resistance of brewer's yeast is quite necessary for frozen products such as food, medicine, and cosmetics. Summary of the Invention
[0005] The present invention addresses the deficiencies of the existing technology and aims to provide a method for improving the frost resistance of brewer's yeast. By using specific biological materials to construct recombinant brewer's yeast and then inducing expression in the recombinant brewer's yeast, the frost resistance of brewer's yeast can be effectively improved. The method is suitable for preparing high-freeze-resistant foods, medicines, cosmetics and other products.
[0006] The first object of the present invention is to provide a method for improving the frost resistance of brewer's yeast.
[0007] The second object of the present invention is to provide a method for constructing recombinant Saccharomyces cerevisiae.
[0008] The third object of the present invention is to provide the recombinant Saccharomyces cerevisiae constructed by the above method.
[0009] The fourth object of the present invention is to provide the use of the recombinant Saccharomyces cerevisiae in preparing products with high frost resistance.
[0010] A fifth object of the present invention is to provide a use of the ARO9 gene or ARO9 protein in improving the freezing resistance of Saccharomyces cerevisiae.
[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions: The present invention provides a method for improving the frost resistance of Saccharomyces cerevisiae, namely: first constructing a recombinant Saccharomyces cerevisiae, and then inducing expression of the recombinant Saccharomyces cerevisiae; Among them, one or more of the following biological materials are used to construct recombinant Saccharomyces cerevisiae: (1) ARO9 gene (nucleotide sequence shown in SEQ ID NO: 11); (2) an expression cassette containing (1); (3) A recombinant expression vector containing (1) and / or (2).
[0012] Preferably, the recombinant expression vector is S.cry-EGFP-KanMX.
[0013] Preferably, the cerevisiae yeast is cerevisiae ( Saccharomyces cerevisiae ) LKF-01 strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with the deposit number GDMCC No: 66058, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0014] Based on this, the present invention also provides a method for constructing recombinant Saccharomyces cerevisiae, namely: first constructing a recombinant plasmid containing the ARO9 gene, and then transferring the recombinant plasmid into Saccharomyces cerevisiae for induced expression.
[0015] Preferably, the brewer's yeast is the brewer's yeast LKF-01 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with a deposit number of GDMCC No: 66058, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0016] The present invention, for the first time, discovered that the recombinant Saccharomyces cerevisiae yeast, when transformed with a recombinant plasmid containing the aromatic amino acid transaminase (ARO9) gene, exhibited significantly improved frost tolerance compared to Saccharomyces cerevisiae, making it suitable for the preparation of high-freeze-tolerance foods, pharmaceuticals, cosmetics, and other products. Therefore, the recombinant Saccharomyces cerevisiae yeast constructed by the above method, its use in the preparation of high-freeze-tolerance products, and the use of the ARO9 gene or ARO9 protein (amino acid sequence set forth in SEQ ID NO:12) to enhance the frost tolerance of Saccharomyces cerevisiae are all within the scope of protection of the present invention.
[0017] Preferably, the product is one or more of food, medicine, and cosmetics.
[0018] Preferably, the brewer's yeast is the brewer's yeast LKF-01 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with a deposit number of GDMCC No: 66058, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0019] The present invention has the following beneficial effects: The present invention discovered for the first time that the recombinant plasmid containing the ARO9 gene was transferred into brewer's yeast. The recombinant brewer's yeast constructed has significantly improved frost resistance compared to brewer's yeast, and is suitable for the preparation of high-freeze-resistant foods, medicines, cosmetics and other products. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is an agarose electrophoresis diagram of the plasmid S.cry-EGFP-KanMX used in Example 1. 1 is the PCR product band, and M is the marker band.
[0021] Figure 2 This is an agarose electrophoresis diagram of the plasmid S.cry-TEF1-ARO9-EGFP-KanMX used in Example 1. 1 represents the PCR product band, and M represents the marker band.
[0022] Figure 3 This is the agarose electrophoresis diagram of Example 2, where 1 is the PCR product band and M is the marker band.
[0023] Figure 4 This is a fluorescence microscope image of Example 2. DETAILED DESCRIPTION
[0024] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0025] Unless otherwise specified, all reagents and materials used in the following examples were commercially available.
[0026] Example 1 Construction of recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX (1) Using the genomic DNA of Saccharomyces cerevisiae LKF-01 strain (deposited in Guangdong Provincial Microbial Culture Collection Center on March 26, 2025, with the deposit number GDMCC No: 66058) as a template, primers F1 / R1 were used to amplify the upstream rDNA homologous sequence, primers F2 / R2 were used to amplify the downstream rDNA homologous sequence, primers F3 / R3 were used to amplify the ARO9 gene, and primers F4 / R4 were used to amplify the promoter TEF1.
[0027] The primers are shown in Table 1.
[0028] Table 1
[0029] The nucleotide sequence of the upstream rDNA homologous sequence is shown in SEQ ID NO:9:
[0030] The nucleotide sequence of the downstream rDNA homologous sequence is shown in SEQ ID NO: 10:
[0031] The nucleotide sequence of the ARO9 gene is shown in SEQ ID NO: 11, and the amino acid sequence encoded by it is shown in SEQ ID NO: 12.
[0032] SEQ ID NO: 11: SEQ ID NO:12: MTAGSAPPVDYTSLKKNFQPFLSRRVENRSLKSFWDASDISDDVIELAGGMPNERFFPIESMDLKISKVPFNDNPKWHNSFTTAHLDLGSPSELPIARSFQYAETKGLPPLLHFVKDFVSRINRPAFSDETESNWDVILSGGSNDSMFKVFETICDESTTVMIEEFTFTPAMSNVEATGAKVIPIKMNLTFDRESQGIDVEYLTQLLDNWSTGPYKDLNKPRVLYTIATGQNPTGMSVPQWKREKIYQLAQRHDFLIVEDDPYGYLYFPSYNPQEPLENPYHSSDLTTERYLNDFLMKSFLTLDTDARVIRLETFSKIFAPGLRLSFIVANKFLLQKILDLADITTRAPSGTSQAIVYSTIKAMAESNLSSSLSMKEAMFEGWIRWIMQIASKYNHRKNLTLKALYETESYQAGQFTVMEPSAGMFIIIKINWGNFDRPDDLPQQMDILDKFLLKNGVKLVLGYKMAVCPNYSKQNSDFLRLTIAYARDDDQLIEASKRIGSGIKEFFDNYKS。
[0033] The nucleotide sequence of the promoter TEF1 is shown in SEQ ID NO:13: ccacacaccatagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagc atactaaattccccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcg aaaaaggcaataaaaatttttatcacgtttctttttcttgaaaatttttttttttgatttttttctctttcgatgacctcccattgatatttaagttattaa atggtcttcaatttctcaagtttcagtttcatttttcttgttctattacaactttttttacttcttgctcattagaaagaaagcatagcaatctaatctaa.
[0034] (2) Using plasmid pAUR123-EGFP as a template, primers F5 / R5 were used to amplify the EGFP+terminator ADH1 fragment sequence.
[0035] Among them, the primers are: Primer F5 (SEQ ID NO: 14): tctaacccgggtgatatcatggtgagcaagggcgagg; Primer R5 (SEQ ID NO: 15): ctgtcgattcgatactaacg.
[0036] The nucleotide sequence of the EGFP+terminator ADH1 fragment sequence is shown in SEQ ID NO: 16:
[0037] (3) Using plasmid pRCC-k as a template, primers F6 / R6 were used to amplify the promoter TEF1+KanMX+terminator TEF1 fragment sequence, and primers F7 / R7 were used to amplify the Amp+ori fragment sequence.
[0038] The primers are shown in Table 2.
[0039] Table 2
[0040] The nucleotide sequence of the promoter TEF1+KanMX+terminator TEF1 fragment sequence is shown in SEQ ID NO: 21:
[0041] The nucleotide sequence of the Amp+ori fragment is shown in SEQ ID NO: 22:
[0042] (4) The upstream rDNA homologous sequence, EGFP+terminator ADH1 fragment sequence, promoter TEF1+KanMX+terminator TEF1 fragment sequence, downstream rDNA homologous sequence and Amp+ori fragment sequence were recombined to obtain the plasmid S.cry-EGFP-KanMX.
[0043] (5) The plasmid S.cry-EGFP-KanMX obtained in (4) was transformed into Escherichia coli DH5α by heat shock method, and then spread on LB plate containing 100 μg / mL ampicillin (Amp). After culturing at 37 °C for 24 h, a single clone was picked and PCR verification was performed using the single clone as template and primer F1 (SEQ ID NO: 1) and primer R2 (SEQ ID NO: 4) as PCR verification primers. The PCR product was then subjected to agarose electrophoresis. The results were as follows: Figure 1 As shown in the figure, the PCR product band is above 4000 bp, indicating that the plasmid S.cry-EGFP-KanMX was successfully constructed.
[0044] (6) The plasmid S.cry-EGFP-KanMX obtained in (4) was double-digested with SmaI and EcoRV, and then recombined with the promoter TEF1 and ARO9 gene to obtain the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX.
[0045] (7) The recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX obtained in (6) was transformed into Escherichia coli DH5α by heat shock method, and then spread on LB plate containing 100 μg / mL ampicillin (Amp). After culturing at 37 °C for 24 h, a single clone was picked and PCR verification was performed using the single clone as a template and primer F4 (SEQ ID NO: 7) and primer R3 (SEQ ID NO: 6) as PCR verification primers. The PCR product was then subjected to agarose electrophoresis. The results were as follows: Figure 2 As shown in Figure 3, the PCR product band is around 2000 bp, indicating that the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX was successfully constructed.
[0046] Example 2 Construction and screening of recombinant Saccharomyces cerevisiae (1) Using the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX obtained in Example 1 as a template and primer F1 (SEQ ID NO: 1) and primer R2 (SEQ ID NO: 4) as PCR specific primers, rDNA was amplified. up -TEF1-ARO9-EGFP-KanMX-rDNAdown sequence.
[0047] (2) rDNA obtained in (1) up -TEF1-ARO9-EGFP-KanMX-rDNA down The recombinant Saccharomyces cerevisiae was constructed by sequential electroporation into the Saccharomyces cerevisiae LKF-01 strain.
[0048] (3) The recombinant Saccharomyces cerevisiae obtained in (2) was spread on a yeast extract peptone glucose agar medium (YPD plate) containing 400 μg / mL Geneticin (G418) and 1 mol / L sorbitol, and cultured at 30°C for 72 h. The transformants were picked and inoculated into 1 mL yeast extract peptone glucose medium (YPD liquid medium), and cultured at 30°C and 180 rpm for 24 h to obtain a culture solution.
[0049] (4) Take the transformant in (3), extract its genomic DNA, use the genomic DNA as a template, and use primer F4 (SEQ ID NO: 7) and primer R5 (SEQ ID NO: 15) as PCR verification primers to perform PCR verification. Then, perform agarose electrophoresis on the PCR product. The results are as follows: Figure 3 As shown, the PCR product band is around 3000 bp, and sequencing confirmed that it contains the nucleotide sequence shown in SEQ ID NO: 11, indicating that the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX has been successfully transformed into the Saccharomyces cerevisiae LKF-01 strain, and the recombinant Saccharomyces cerevisiae has been successfully constructed.
[0050] (5) Take the culture medium obtained in (3) and observe it under a fluorescence microscope (excitation wavelength of 465-495 nm, emission filter wavelength of 512-558 nm, 10x objective lens). The results are as follows: Figure 4 Since the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX is expressed as a fusion with the ARO9 protein, and EGFP is a green fluorescent protein, the green fluorescence in the fluorescence microscopy image proves that the ARO9 protein has been successfully expressed in the recombinant Saccharomyces cerevisiae.
[0051] Example 3 Freeze-tolerance test of recombinant Saccharomyces cerevisiae 1. Reagent Preparation Methylene blue staining solution: Mix 0.025 g methylene blue, 0.048 g calcium chloride hexahydrate, 1.0 g glucose, 0.042 g potassium chloride, and 0.02 g sodium bicarbonate, then add sterile saline to make up to 100 mL.
[0052] 2. Test Method (1) The recombinant Saccharomyces cerevisiae and Saccharomyces cerevisiae LKF-01 strain obtained in Example 2 were inoculated into yeast extract peptone dextrose medium (YPD liquid medium) containing 200 mg / mL Geneticin (G418), respectively. After shaking culture at 30°C and 180 rpm for 24 h, 1 mL of the culture medium was dispensed into each tube, and the tubes were centrifuged at 8000 rpm for 5 min. The supernatant was removed.
[0053] (2) The precipitated bacteria obtained by centrifugation were placed in a -20 ℃ refrigerator for 2, 10, 16, and 20 days, respectively. Then, the cells were taken out and thawed at room temperature (25 ℃). 1 mL of PBS was added to resuspend the bacteria. After 30 minutes, 10 μL was taken and mixed with 990 μL of methylene blue staining solution. After staining for 10 minutes, the number of live cells was determined using a hemocytometer under a microscope based on the principle that living cells can reduce the dye that enters the cells without being stained. Finally, the cell survival rate was determined according to the formula "survival rate / % = number of live cells / (number of live cells + number of dead cells) × 100%".
[0054] 3. Test Results The results showed that the survival rates of the recombinant S. cerevisiae strain after storage at -20°C for 2, 10, 16, and 20 days were 78.0%, 46.8%, 32.4%, and 21.4%, respectively. This compares to the survival rates of the S. cerevisiae LKF-01 strain after storage at -20°C for 2, 10, 16, and 20 days, which were 64.6%, 15.4%, 10.0%, and 4.8%, respectively. This indicates that the recombinant S. cerevisiae strain constructed by transferring the ARO9 gene-containing recombinant plasmid into S. cerevisiae exhibits significantly improved frost tolerance compared to S. cerevisiae, making it suitable for the preparation of high-freeze-resistant foods, pharmaceuticals, cosmetics, and other products.
[0055] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A method for improving the frost resistance of brewer's yeast, characterized in that: First, construct the recombinant Saccharomyces cerevisiae, and then induce the expression of the recombinant Saccharomyces cerevisiae; Among them, one or more of the following biological materials are used to construct recombinant Saccharomyces cerevisiae: (1) ARO9 gene; (2) an expression cassette containing (1); (3) A recombinant expression vector containing (1) and / or (2).
2. The method according to claim 1, characterized in that The recombinant expression vector is S.cry-EGFP-KanMX.
3. The method according to claim 1, wherein The brewer's yeast is a brewer's yeast ( Saccharomyces cerevisiae ) LKF-01 strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with the deposit number GDMCC No: 66058.
4. A method for constructing recombinant Saccharomyces cerevisiae, characterized in that: First, a recombinant plasmid containing the ARO9 gene was constructed, and then the recombinant plasmid was transferred into Saccharomyces cerevisiae for induced expression.
5. The method according to claim 4, wherein: The brewer's yeast is the brewer's yeast LKF-01 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with the deposit number GDMCC No: 66058.
6. The recombinant Saccharomyces cerevisiae constructed by the method of claim 5.
7. Use of the recombinant Saccharomyces cerevisiae according to claim 6 in preparing a product with high frost resistance.
8. The application according to claim 7, characterized in that: The product is one or more of food, medicine, and cosmetics.
9. Application of ARO9 gene or ARO9 protein in improving the freezing resistance of Saccharomyces cerevisiae.
10. The use according to claim 9, characterized in that The brewer's yeast is the brewer's yeast LKF-01 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 26, 2025, with the deposit number GDMCC No: 66058.
Citation Information
Patent Citations
Construction method of over-expressed aromatic amino acid transaminase II Aro9 in beer yeast
CN111690638A
Saccharomyces cerevisiae genetic engineering strain and construction method and application thereof
CN113151028A
Method for enhancing tolerance of saccharomyces cerevisiae to freezing
CN119955840A
Application of MET14 gene or MET14 protein in improving freezing resistance of saccharomyces cerevisiae
CN119979362A
Extracellular production of glycosylated products
WO2022152915A1