Application of PRR5 gene in regulation and control of high-temperature early blossoming of soybeans

By knocking out the soybean PRR5a and PRR5b genes through CRISPR/Cas9 gene editing technology, a PRR5a prr5b double mutant was constructed, which solved the problem of early flowering of soybeans under high temperatures, achieved stability of flowering time under high temperatures, and promoted the development of soybean breeding.

CN120665931AActive Publication Date: 2025-09-19GUANGZHOU UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510833982.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-09-19
Estimated Expiration
2045-06-20

AI Technical Summary

Technical Problem

The genes that regulate early flowering of soybeans under high temperatures have not yet been identified in the existing technology, resulting in the flowering time of soybeans being affected by high temperature stress, increasing the difficulty of production management.

Method used

Using CRISPR/Cas9 gene editing technology, specific gRNA sequences were designed to knock out the soybean PRR5a and PRR5b genes, construct a PRR5a prr5b double mutant, and transfer it into soybean through Agrobacterium-mediated method, delaying the flowering time under high temperature.

Benefits of technology

The successful delay of soybean flowering time under high temperature conditions ensured that the flowering time was consistent with that under normal temperature, provided new ideas and biological materials for regulating soybean early flowering under high temperature, and promoted the development of soybean breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665931A_ABST
    Figure CN120665931A_ABST
Patent Text Reader

Abstract

The invention discloses application of a PRR5 gene in regulation and control of high-temperature early blossoming of soybeans, and belongs to the field of gene engineering. According to the invention, aiming at a soybean PRR5 gene, a double mutant prr5a prr5b of which the nucleotide sequences are knocked out, such as PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2, is constructed by utilizing a CRISPR (clustered regularly interspaced short palindromic repeats) technology. Experimental results show that the flowering time of the double mutant at a high temperature (30 DEG C) is consistent with the flowering time at a normal temperature (25 DEG C), and the response mechanism that the flowering time of soybeans is advanced at the high temperature is relieved by knocking out the PRR5 gene. The invention provides a new thought, a technical means and a biological material for changing the early blossoming of the soybeans at high temperature and enhancing the production management of the soybeans at high temperature. The method has a wide application prospect in research on high-temperature stress response of soybeans and high-yield breeding, and is beneficial to promoting the development of the soybean breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to the application of PRR5 gene in regulating soybean early flowering under high temperature. Background Art

[0002] Global warming poses a serious threat to plant growth and crop production. Soybean (Glycine max), an important crop, is extremely sensitive to temperature fluctuations in its flowering time. Under high temperatures, soybeans accelerate flowering to quickly complete their reproductive cycle and thus escape heat stress. For example, in Guangdong Province, the average daily maximum temperature is greater than or equal to 25°C for eight months of the year. Except in extreme weather conditions, the average daily maximum temperature rarely reaches 35°C. This means that, compared to extreme temperatures above 35°C, high temperatures around 30°C are more common in South China. Soybean flowering time determines the transition from vegetative growth to reproductive growth. Fluctuations in soybean flowering time with temperature inevitably add a burden to soybean production management. Therefore, studying the mechanisms of soybean early flowering mediated by 30°C is crucial for soybean production in Guangdong.

[0003] Regarding the fact that high temperatures can cause early flowering in plants, studies in Arabidopsis thaliana have shown that phytochrome B (phyB) acts as a heat sensor in thermomorphogenesis. High temperatures promote the conversion of phyB from its active Pfr form to its inactive Pr form, thereby relieving the inhibition of the Phytochrome-Interacting Factor 4 (PIF4) transcription factor and accelerating thermomorphogenesis. Furthermore, PIF4 promotes transcriptional activation of FT by improving chromatin accessibility at the FT promoter, thereby influencing flowering time. However, the genes involved in early flowering under high temperature in soybean have not yet been identified, and there are no reports on how flowering time is regulated under high temperature conditions.

[0004] Therefore, there is an urgent need to provide a method for regulating soybean early flowering under high temperature so that the flowering time of soybean is not affected by high temperature stress, so as to facilitate the production management of soybean under high temperature. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of the PRR5 gene in regulating early flowering of soybeans under high temperature to solve the problems existing in the above-mentioned prior art. The present invention provides new ideas, technical means and biological materials for changing the early flowering of soybeans under high temperature and enhancing soybean production management. It has broad application prospects in the research on soybean response to high temperature stress and high-yield breeding, and is conducive to promoting the development of the soybean breeding industry.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of soybean PRR5 protein in any of the following:

[0008] (1) Application in regulating flowering time of soybean in response to high temperature stress;

[0009] (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress;

[0010] The coding gene of the soybean PRR5 protein includes a nucleotide sequence of PRR5a as shown in SEQ ID NO.1 and a nucleotide sequence of PRR5b as shown in SEQ ID NO.2.

[0011] The present invention also provides an application of a PRR5 gene expressing soybean PRR5 protein in any of the following:

[0012] (1) Application in regulating flowering time of soybean in response to high temperature stress;

[0013] (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress;

[0014] The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2.

[0015] Furthermore, the PRR5 gene is knocked out in soybean, delaying the flowering time of soybean in response to high temperature stress.

[0016] The present invention also provides a use of a knockout vector targeting the PRR5 gene described above in any of the following:

[0017] (1) Application in regulating flowering time of soybean in response to high temperature stress;

[0018] (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress.

[0019] The present invention also provides a use of an engineered bacterium comprising the above-mentioned knockout vector in any of the following:

[0020] (1) Application in regulating flowering time of soybean in response to high temperature stress;

[0021] (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress.

[0022] The present invention also provides a method for delaying flowering time of soybean in response to high temperature stress, comprising the steps of knocking out the PRR5 gene in soybean;

[0023] The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2.

[0024] Furthermore, the knockout of the PRR5 gene in soybean comprises the following steps: constructing a knockout vector with the PRR5a and the PRR5b as targets respectively;

[0025] The knockout vector is transferred into soybeans through Agrobacterium-mediated method to obtain a double mutant in which the PRR5a and PRR5b are knocked out, thereby completing the knockout of the PRR5 gene.

[0026] The present invention also provides a method for cultivating soybeans that do not flower early under high temperature stress, comprising the steps of knocking out the PRR5 gene in soybeans;

[0027] The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2.

[0028] Furthermore, the knockout of the PRR5 gene in soybean comprises the following steps: constructing a knockout vector with the PRR5a and the PRR5b as targets respectively;

[0029] The knockout vector is transferred into soybeans through Agrobacterium-mediated method to obtain a double mutant in which the PRR5a and PRR5b are knocked out, thereby completing the knockout of the PRR5 gene.

[0030] The present invention discloses the following technical effects:

[0031] The present invention targets the soybean PRR5 gene and uses CRISPR technology to construct a double mutant prr5a prr5b in which the nucleotide sequences of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2 are simultaneously knocked out. The experimental results show that the flowering time of the double mutant at high temperature (30°C) is consistent with the flowering time at normal temperature (25°C), and knocking out the PRR5 gene eliminates the response mechanism of soybean to advance the flowering time under high temperature. The present invention provides new ideas, technical means and biological materials for changing the early flowering of soybean under high temperature and enhancing the production management of soybean under high temperature. The present invention has broad application prospects in the research and breeding of soybean response to high temperature stress, and is conducive to promoting the development of the soybean breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0033] Figure 1 Figure 3 shows the experimental results of flowering time of W82, prr5a, prr5b and prr5a prr5b mutant plants at different temperatures; A is the phenotypic observation result of flowering time of different plants; B is the statistical result of flowering time of different plants; different letters indicate significant differences (P<0.05) through Student's t test; flowering time is expressed as the mean ± standard deviation (SD) of four biological replicates. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] 1) Clear molecular mechanism:

[0040] This study reveals for the first time the key regulatory role of PRR5a and PRR5b genes in soybean flowering under high temperatures, providing an important molecular basis for understanding the regulation of flowering time in soybeans under high temperature conditions. Using gene editing technology, the specific functions of PRR5a and PRR5b in high-temperature-induced early flowering were clarified, filling a gap in existing research.

[0041] 2) Efficient gene editing technology:

[0042] Using CRISPR / Cas9 gene editing technology and designing specific guide RNA sequences, they successfully generated double mutants of PRR5a and PRR5b. This technology is highly efficient and specific, enabling precise editing of target genes while avoiding off-target effects, thereby improving the success rate and reliability of gene editing.

[0043] 3) Accurate phenotypic analysis:

[0044] By observing phenotypes and recording flowering times at 25°C and 30°C, researchers analyzed the flowering time of the double mutant PRR5a and PRR5b in detail. The results showed that flowering time was unaffected by high temperatures, indicating that PRR5a and PRR5b are key regulators of heat-induced early flowering. This precise phenotypic analysis provides important data support for subsequent breeding and application.

[0045] 4) Broad application prospects:

[0046] This invention is not only of great significance in basic research but also has broad application prospects in practical applications. The editing sites of the PRR5a and PRR5b genes can be used to regulate early flowering in soybeans under high temperatures. Furthermore, these gene editing sites can also be applied to soybean varietal improvement, breeding, and variety improvement, providing new means and ideas for cultivating new soybean varieties that adapt to different environmental conditions.

[0047] Example 1

[0048] 1. Gene Editing

[0049] Using CRISPR / Cas9 gene editing technology, specific guide RNA (gRNA) was designed for soybean PRR5a and PRR5b genes to obtain double mutants.

[0050] Specific steps:

[0051] (1) gRNA design

[0052] We selected conserved regions of the PRR5a gene (SEQ ID NO. 1) and the PRR5b gene (SEQ ID NO. 2) to design specific gRNA sequences. This ensured that the gRNA sequences were highly specific and effective, avoiding off-target effects.

[0053] SEQ ID NO.1:

[0054]

[0055] SEQ ID NO.2:

[0056]

[0057] An online tool (CRISPR-PLANT) was used for gRNA design and off-target prediction, and the optimal gRNA sequences were selected, namely gRNA1 (SEQ ID NO. 3) targeting PRR5a knockout and gRNA2 (SEQ ID NO. 4) targeting PRR5b knockout.

[0058] SEQ ID NO.3: AAGGAAGATAGTGGTGGAAGTGG;

[0059] SEQ ID NO. 4: CCTGCAGTGTTAATTAACTTCTC.

[0060] (2) Construction of editing vector

[0061] The designed gRNA sequence was cloned into the CRISPR / Cas9 expression vector (pYLCRISPR / CasPubi-B), and primers were used to construct a co-expression vector containing Cas9 and gRNA.

[0062] GmPRR5-ATU3d-F1: GTCAAGGAAGATAGTGGTGGAAG (SEQ ID NO.5);

[0063] GmPRR5-ATU3d-R1: AAACCTTCCACCACTATCTTCCT (SEQ ID NO.6);

[0064] GmPRR5-ATU3b-F2: GTCATGCTGTTCCTGATGGCTTGA (SEQ ID NO.7);

[0065] GmPRR5-ATU3b-R2: AAACTCAAGCCATCAGGAACAGCA (SEQ ID NO. 8);

[0066] GmPRR5-ATU6-1-F3:ATTGTGAGAGTGTTGCACAACAGA (SEQ ID NO.9);

[0067] GmPRR5-ATU6-1-R3: AAACTCTGTTGTGCAACACTCTCA (SEQ ID NO. 10);

[0068] GmPRR5-ATU6-29-F4: ATTGAGAAGTTAATTAACACTGC (SEQ ID NO. 11);

[0069] GmPRR5-ATU6-29-R4: AAACGCAGTGTTAATTAACTTCT (SEQ ID NO. 12).

[0070] The 35S promoter was selected to drive the expression of Cas9 and gRNA to ensure efficient expression in soybean plants.

[0071] (3) Genetic transformation

[0072] The constructed CRISPR / Cas9 vector was transferred into the callus tissue of soybean Williams 82 variety (hereinafter referred to as W82, which has been disclosed in the literature Wang, Longfei et al. "A telomere-to-telomere gap-free assembly of soybean genome." Molecular plant vol. 16, 11 (2023): 1711-1714.) using the Agrobacterium-mediated transformation method.

[0073] Positive transformants were screened by selecting marker genes to obtain transgenic callus.

[0074] (4) Regenerated plants

[0075] The positive callus tissue screened out is regenerated and cultured to induce the formation of complete plants.

[0076] The genotype of the mutant was verified by PCR and sequencing to ensure double mutation of PRR5a and PRR5b genes.

[0077] 2. Phenotypic Observation and Analysis

[0078] (1) Phenotypic observation

[0079] Mutant plant culture: W82 plants, the obtained prr5a or prr5b single mutant plants, and prr5a prr5b double mutant plants were cultured under standard growth conditions (12 h light / 12 h dark) to ensure consistent environmental conditions.

[0080] Two temperature treatment groups were set up: 25°C (normal temperature) and 30°C (high temperature), with 8 plants in each treatment group.

[0081] (2) Flowering time record

[0082] Starting from sowing, observe the growth of the plant every day and record the flowering time (based on the opening of the first flower).

[0083] The flowering time of all plants in each treatment group was recorded, and the average flowering time was calculated.

[0084] (3) Observation results

[0085] The flowering time of prr5a prr5b double mutant plants was observed at different temperatures. Figure 1 As shown, the flowering time of the mutant was about 20 days regardless of whether it was under 25℃ or 30℃, indicating that the flowering time of the double mutant plants was not sensitive to high temperature.

[0086] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a soybean PRR5 protein in any of the following: (1) Application in regulating flowering time of soybean in response to high temperature stress; (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress; The coding gene of the soybean PRR5 protein includes a nucleotide sequence of PRR5a as shown in SEQ ID NO.1 and a nucleotide sequence of PRR5b as shown in SEQ ID NO.

2.

2. Use of a PRR5 gene expressing soybean PRR5 protein in any of the following: (1) Application in regulating flowering time of soybean in response to high temperature stress; (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress; The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.

2.

3. The use according to claim 2, characterized in that Knocking out the PRR5 gene in soybean delays the flowering time of the soybean in response to high temperature stress.

4. Use of a knockout vector targeting the PRR5 gene according to claim 2 or 3 in any of the following: (1) Application in regulating flowering time of soybean in response to high temperature stress; (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress.

5. Use of an engineered bacterium comprising the knockout vector according to claim 4 in any of the following: (1) Application in regulating flowering time of soybean in response to high temperature stress; (2) Application in breeding soybean varieties that do not flower earlier under high temperature stress.

6. A method for delaying flowering time of soybean in response to high temperature stress, characterized in that: including steps for knocking out the PRR5 gene in soybean; The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.

2.

7. The method according to claim 6, wherein Knockout of the PRR5 gene in soybean The method comprises the following steps: constructing a knockout vector with the PRR5a and the PRR5b as targets respectively; The knockout vector is transferred into soybeans through Agrobacterium-mediated method to obtain a double mutant in which the PRR5a and PRR5b are knocked out, thereby completing the knockout of the PRR5 gene.

8. A method for cultivating soybeans that do not flower earlier under high temperature stress, characterized in that: including steps for knocking out the PRR5 gene in soybean; The PRR5 gene consists of PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.

2.

9. The method according to claim 8, wherein The method of knocking out the PRR5 gene in soybean comprises the following steps: The PRR5a and PRR5b are respectively used as targets to construct knockout vectors; The knockout vector is transferred into soybeans through Agrobacterium-mediated method to obtain a double mutant in which the PRR5a and PRR5b are knocked out, thereby completing the knockout of the PRR5 gene.

Citation Information

Patent Citations

  • Application of coding sites of soybean PRR5a and PRR5b genes in regulation and control of salt tolerance

    CN119351459A