Application of TaGLO3 gene or encoded protein TaGLO3 in regulation and control of drought tolerance of wheat
Knocking out the wheat TaGLO3 gene through the CRISPR/Cas9 method solved the problem of regulating wheat drought tolerance in existing technologies, significantly improved the drought tolerance of wheat, enhanced its resistance to drought, increased the fresh weight of the aboveground part after drought rehydration, and reduced the water loss rate of leaves.
Patent Information
- Application Number
- CN202510942332.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-08
- Publication Date
- 2025-09-19
AI Technical Summary
Existing technologies make it difficult to construct precise, spatiotemporal-specific expression regulation methods to improve wheat drought tolerance, and the functional mechanism of the TaGLO3 gene has not yet been applied, affecting wheat yield and quality.
The wheat TaGLO3 gene was knocked out or silenced using the CRISPR/Cas9 method, reducing the expression of the encoding protein TaGLO3. The CRISPR/Cas9 system was used to target and knock out specific nucleotide sequences of the TaGLO3 gene, including target site 1 and target site 2, and gene editing was performed using the wheat variety Fielder.
It significantly enhances the drought tolerance of wheat, improves its resistance to drought, increases the aboveground fresh weight of wheat after drought rehydration and reduces the water loss rate of leaves, proving that the TaGLO3 gene plays an important role in improving wheat drought tolerance.
Smart Images

Figure CN120665940A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of TaGLO3 gene or encoded protein TaGLO3 in regulating drought resistance of wheat. Background Art
[0002] Wheat, as a staple food crop, is a major source of protein and carbohydrates for humans. However, drought stress severely impacts wheat yield and quality, especially as global warming and water scarcity increase the frequency of drought stress. Therefore, identifying key drought-tolerant genes in wheat and utilizing genetic engineering techniques to enhance its drought tolerance are crucial for ensuring food security.
[0003] The wheat TaGLO3 gene encodes glycolate oxidase, a key enzyme involved in the photorespiration pathway, catalyzing the oxidation of glycolate to glyoxylate and H₂O₂. Its activity directly affects intracellular ROS levels. Drought tolerance in wheat is a highly complex trait, influenced by a combination of environmental factors (such as drought severity, duration, and temperature) and genetic factors (numerous genes and their interactions). This makes it extremely difficult to develop precise, spatiotemporally specific expression control strategies to improve wheat drought tolerance. While there are no reported applications of the TaGLO3 gene, elucidating its functional mechanisms will provide genetic resources and new insights for improving wheat drought tolerance. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide the use of the TaGLO3 gene or the encoded protein TaGLO3 in regulating the drought tolerance of wheat, so as to accurately improve the drought tolerance of wheat.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides an application of a TaGLO3 gene or an encoded protein TaGLO3 in regulating drought tolerance of wheat. The nucleotide sequence of the TaGLO3 gene is shown in SEQ ID NO.1.
[0007] Preferably, the amino acid sequence of the encoded protein TaGLO3 is shown as SEQ ID NO.2.
[0008] Preferably, the drought tolerance of wheat is improved by knocking out, silencing or inhibiting the TaGLO3 gene.
[0009] Preferably, the drought tolerance of wheat is improved by reducing the expression of the encoded protein TaGLO3.
[0010] The present invention also provides a method for improving drought resistance of wheat, comprising the following steps: knocking out the TaGLO3 gene in wheat.
[0011] Preferably, the knockout method includes the CRISPR / Cas9 method.
[0012] Preferably, the target sites of the gRNA in the CRISPR / Cas9 method include target site 1 whose nucleotide sequence is shown in SEQ ID NO.3 and target site 2 whose nucleotide sequence is shown in SEQ ID NO.4.
[0013] Preferably, the nucleotide sequence of the knockout primer is shown as SEQ ID NO.5 to SEQ ID NO.8.
[0014] Preferably, the wheat comprises wheat Fielder.
[0015] Beneficial effects of the present invention:
[0016] This invention proposes for the first time that the TaGLO3 gene is related to wheat drought resistance. By knocking out the TaGLO3 gene in wheat, the drought resistance of wheat can be significantly enhanced, proving that the TaGLO3 gene plays an important role in improving wheat drought resistance. The TaGLO3 function can be inhibited by genetic engineering to cultivate new drought-resistant wheat germplasm. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The figure shows the gene editing status of wheat TaGLO3 gene CRISPR mutants, where KO-1 and KO-2 are two independent CRISPR gene-edited lines;
[0018] Figure 2 The phenotypes of wild-type wheat Fielder (WT) and TaGLO3 gene-edited materials after drought stress;
[0019] Figure 3 Statistical results of the aboveground fresh weight of wild-type wheat Fielder (WT) and TaGLO3 gene-edited materials after drought stress, where ** indicates p < 0.01;
[0020] Figure 4 Statistical results of leaf water loss rate of wild-type wheat Fielder (WT) and TaGLO3 gene-edited materials, where ** indicates p < 0.01. DETAILED DESCRIPTION
[0021] The present invention provides the use of TaGLO3 gene or encoded protein TaGLO3 in regulating wheat drought tolerance. The nucleotide sequence of TaGLO3 gene isCTGCAGAAGACACTAGGATTGCCATCGAGTACGGCGCGGCCGGCATCATCGTGTCCAACCATGGCGCTCGGCAGCTGGACTATGTCCCTGCAACCATCAGCTGCCTGGAAGAGGTGGTCAGAGAGGCGAAGGGACGGCTGCCGGTGTTCCTGGACGGCGGCGTCCGGCGTGGCACCGACGTGTTCAAGGCGCTGGCACTCGGAGCCGCGGGAGTGTTCATCGGTAGGCCGGTGCTGTACTCGCTGGCGGTGGACGGCGAGGCGGGGGTGCGGAAGGTGCTGCAGATGCTGCGGGACGAGCTGGAGCTGGCCATGGCGCTCAGCGGGTGCCCGTCGCTCCGGGACATCACCCGCGCCCACGTCGTCACCGACGGCGACAGGATCCGCCGCGCACGCCTCTAG(SEQ IDNO. 1).
[0022] In the present invention, the amino acid sequence encoding the protein TaGLO3 is MGMEMITNVSEYERLAKEKLPKMVYDYYASGAEDQWTLNENREAFSRILFRPRVLIDVSHINMATNILGFDVSMPIMIAPTAMQKMAHPEGELATARAAASAGTIMTLSSWATSSVERVNSVGPGIRFFQLYVYKDRNIVRQLVKRAEMAGFKAIALTVDTPRLGRREADIKNRFNLPPHLVLENFAALDLGKMDKTDDSGLASYVASQVDQSLCWEDVKWLQTITSLPILVKGVMTAEDTRIAIEYGAAGIIVSNHGARQLDYVPATISCLEEVVREAKGRLPVFLDGGVRRGTDVFKALALGAAGVFIGRPVLYSLAVDGEAGVRKVLQMLRDELELAMALSGCPSLRDITRAHVVTDGDRIRRARL(SEQ ID NO. 2).
[0023] The TaGLO3 gene described in the present invention negatively regulates the drought tolerance of wheat, provides a new gene resource for wheat drought-tolerant breeding, and has broad application prospects. In the present invention, it is preferred to improve the drought tolerance of wheat by knocking out, silencing or inhibiting the TaGLO3 gene, or to improve the drought tolerance of wheat by reducing the expression of the encoded protein TaGLO3. The knockout method described in the present invention preferably includes the CRISPR / Cas9 method. The present invention is not particularly limited to the specific method of silencing or inhibiting the TaGLO3 gene, and the conventional method of silencing or inhibiting genes in the art can be used. In the present invention, the variety of wheat is preferably wheat Fielder, and the present invention is not particularly limited to the specific source of wheat Fielder.
[0024] The present invention also provides a method for improving drought resistance of wheat, comprising the following steps: knocking out the TaGLO3 gene in wheat.
[0025] In the present invention, the knockout method preferably includes the CRISPR / Cas9 method, and the target site of the gRNA in the CRISPR / Cas9 method preferably includes the nucleotide sequence of target site 1 shown in SEQ ID NO.3 and the nucleotide sequence of target site 2 shown in SEQ ID NO.4. When the target site provided by the present invention is used to knock out the TaGLO3 gene, the nucleotide sequence of the knockout primer is preferably as shown in SEQ ID NO.5 to SEQ ID NO.8. In the present invention, the wheat variety preferably includes wheat Fielder.
[0026] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0027] In the following examples, unless otherwise specified, all methods are conventional.
[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0029] The data in the following examples were processed using GraphPad Prism 10 software. The experimental results are expressed as mean ± standard deviation, and a two-tailed student's t-test was used. p < 0.05 (*) indicates a significant difference, and p < 0.01 (**) indicates a very significant difference.
[0030] Example 1
[0031] Cloning of the wheat TaGLO3 gene
[0032] Using wheat cultivar Fielder leaves as template, RNA was extracted and reverse transcribed into cDNA as follows:
[0033] (1) Take an appropriate amount of Fielder blades and place them in a mortar. Add liquid nitrogen and grind them into powder. Take 100 mg of sample and place it in a pre-cooled centrifuge tube. (2) Add 1 mL of Trizol (Thermo Fisher Scientific, Cat. No. 15596026CN), shake and mix, and let it stand at room temperature for 5 minutes. (3) Centrifuge at 12000 rpm and 4°C for 10 minutes, take the supernatant, and transfer it to a new centrifuge tube. (4) Add 200 μL of chloroform, shake at room temperature for 10 seconds, let it stand for 3 minutes, and then centrifuge at 12000 rpm and 4°C for 10 minutes. pm, centrifuge at 4℃ for 10 minutes; transfer the supernatant to a new centrifuge tube; (5) add an equal volume of pre-cooled isopropanol, mix by inversion, and let it stand for 10 minutes, centrifuge at 12000rpm, 4℃ for 10 minutes; (6) discard the supernatant, add 1mL of 75% ethanol solution diluted with DEPC water to wash the precipitate; (7) repeat the previous step; (8) centrifuge at 7500rpm, 4℃ for 5 minutes, discard the supernatant; (9) dry at room temperature for 8 minutes, add appropriate amount of DEPC water to dissolve; (10) take 1-2μg RNA, make up to 12μL with RNase-free ddH2O, add 4μL 4×gDNAwiperMix (Norway, product number: R222-01) and mix by pipetting, and react on a PCR instrument at 42℃ for 2 minutes. (11) Add 4 μL of 5×HiScriptII qRT SupermixII (Norway, Cat. No.: R222-01), pipette to mix, and set the temperature gradient to 50°C for 15 min, 85°C for 5 min, and 4°C for 5 min; (12) Add 80 μL of RNase-free ddH2O, pipette to mix, and obtain wheat cDNA.
[0034] The TaGLO3 gene sequence was obtained from the WheatOmics 1.0 database, and specific primers (F: ATGGGCATGGAGATGATCA (SEQ ID NO. 15), R: CTAGAGGCGTGCGCGGCG (SEQ ID NO. 16)) were designed using the coding region of TaGLO3. PCR amplification was performed using these primers. The PCR reaction conditions included a pre-denaturation at 94°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 60°C for 15 seconds, and 68°C for 1 minute, followed by an extension at 68°C for 5 minutes. After sequencing and alignment, the TaGLO3 nucleotide sequence was obtained, as shown in SEQ ID NO. 1, and the encoded amino acid sequence is shown in SEQ ID NO. 2.
[0035] Example 2
[0036] Acquisition of TaGLO3 CRISPR knockout wheat
[0037] Based on the conserved regions of the three partially homologous genes of TaGLO3, sequences containing the PAM domain of NGG were selected and two were selected as targets, of which target site 1 was: CTGGAGAACTTTGCGGCGCTGG (SEQ ID NO.3) and target site 2 was: CCATGCCGATCATGATCGCTCCC (SEQ ID NO.4). Knockout primers were designed:
[0038] TaGLO3-P411-F:AATAATGGTCTCAAGCGCTGGAGAACTTTGCGGCGC (SEQ ID NO.5);
[0039] TaGLO3-P411-F0:GCTGGAGAACTTTGCGGCGCGTTTTAGAGCTAGAAA TAGC (SEQ IDNO.6);
[0040] TaGLO3-P411-R0: TGCCGATCATGATCGCTCCCGCTTCTTGGTGCC (SEQ ID NO.7);
[0041] TaGLO3-P411-R:ATTATTGGTCTCTAAACTGCCGATCATGATCGCTCC (SEQ ID NO. 8);
[0042] The pMT1T2 plasmid (disclosed in Chinese patent CN118931942A) was amplified by PCR using the above four primers to obtain a fragment containing the target site and the linker of the pBUE411 vector (disclosed in Chinese patent CN118931942A). The target fragment was then recovered by agarose gel electrophoresis.
[0043] The pBUE411 vector was digested with BsaI restriction endonuclease and the digested product was ligated with the gel-recovered fragment from the previous step using T4 ligase at 37°C for 5 h. The ligated product was transformed into competent E. coli, and the positive plaques were identified and the plasmids were extracted for sequencing.
[0044] The E. coli transformation method is as follows:
[0045] Add the above plasmid to the thawed competent E. coli, pipette and mix thoroughly, then place on ice for 30 minutes. Place the centrifuge tube in a 42°C constant temperature water bath for 45 seconds, then place on ice for 3 minutes. Add 400 μL of sterile LB liquid medium in a clean bench, place in a 37°C shaker, and incubate at 200 rpm for 45 minutes. Aspirate 100 μL of the bacterial solution and evenly spread it on an LB plate containing kanamycin in a clean bench using a spreader. Incubate at 37°C for 12 hours. Pick single clones in a clean bench, extract the plasmid, and perform PCR identification and sequencing identification.
[0046] The correctly sequenced plasmid was transferred into Agrobacterium (EHA105) and transformed into the wheat variety Fielder using Agrobacterium-mediated gene transformation. After obtaining gene-edited wheat materials, specific primers were designed near the target sites of the three partial homologous genes of TaGLO3. The detection primers are: TaGLO3-KOAF: GAATTTTTGGGCATGGACTAG (SEQ ID NO.9), TaGLO3-KOAR: GATTTCTGCGATACGATTGG (SEQ ID NO.10), TaGLO3-KOBF: GACCCATATCAACATGGCG (SEQ ID NO.11), TaGLO3-KOBR: AGGCGATTTCTGCTATACGATC (SEQ ID NO.12), TaGLO3-KODF: CGACCACGCGTACTGATC (SEQ ID NO.13), and TaGLO3-KODR: TCTACTTAGGCAATTCCTGCG (SEQ ID NO.14). Sanger sequencing was used to identify the editing type of gene-edited wheat materials, and finally two independent knockout lines (KO-1, KO-2) with different mutation types were screened out. The mutation types are as follows: Figure 1 shown.
[0047] The gene editing types of the two knockout strains are as follows:
[0048] Editing type of KO-1 strain:
[0049] The TaGLO3A subgenomic target site is missing 1bp; the TaGLO3B subgenomic target site is missing 1bp; and the TaGLO3D subgenomic target site is missing 1bp.
[0050] Editing type of KO-2 strain:
[0051] The TaGLO3A subgenomic target site has an insertion of 1 bp; the TaGLO3B subgenomic target site has a deletion of 1 bp; and the TaGLO3D subgenomic target site has a deletion of 1 bp.
[0052] Example 3
[0053] Evaluation of drought tolerance phenotype of TaGLO3 knockout plants obtained in Example 2
[0054] The seeds of wild-type Fielder and TaGLO3 knockout plants (KO-1, KO-2) obtained in Example 2 were washed with 1% sodium hypochlorite for 10 min, washed 6 times with distilled water, and then the sodium hypochlorite was washed clean. They were neatly placed in a culture dish, and 2 mL of distilled water was added. They were placed in the dark at room temperature for 24 h. Seedlings with consistent germination were selected and sown neatly in potting soil (12 cm × 12 cm × 10 cm) with 3 biological replicates. They were placed in a light incubator for culture (16 h light + 8 h dark, temperature 16 ° C / 14 ° C, light intensity 600 μmol m -2 s -1 ), watering was stopped after 20 days of culture (two leaves and one heart stage), and watering was resumed after 15 days of drought treatment. Three days after rehydration, photos were taken and fresh weight was measured. At least 6 plants were measured for each replicate, and the significance of differences was analyzed.
[0055] The results showed that compared with the wild type (WT), TaGLO3 knockout plants showed a drought tolerance phenotype ( Figure 2 ), the aboveground fresh weight statistics showed that the aboveground fresh weight of TaGLO3 knockout plants after drought rewatering was significantly higher than that of the wild type ( Figure 3 ).
[0056] Leaf water loss rates were measured from the first leaf of wild-type Fielder and the TaGLO3 knockout mutant (KO-1, also labeled TaGLO3-KO-1) at the two-leaf, one-heart stage. Three biological replicates were set up, with six leaves in each replicate. The initial leaf weight (W1) was recorded, and the leaves were spread flat in a greenhouse (temperature 24°C, humidity 40%). Leaf weights were recorded every hour. The weight of leaves after water loss, measured at different time periods, was designated Wn. The wheat leaf water loss rate was calculated using the following formula:
[0057] Leaf water loss rate (%) = (W1-Wn) / W1×100%.
[0058] The results are as follows Figure 4 As shown in Figure 3, the water loss rate of TaGLO3 knockout mutant leaves was significantly lower than that of the wild type.
[0059] The above results indicate that TaGLO3 negatively regulates wheat drought tolerance, and knocking out this gene can significantly improve wheat drought tolerance, proving that this gene has broad application prospects in breeding high-yield and drought-tolerant wheat.
[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of the TaGLO3 gene or the encoded protein TaGLO3 in regulating drought tolerance in wheat, characterized in that: The nucleotide sequence of the TaGLO3 gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The amino acid sequence of the encoded protein TaGLO3 is shown in SEQ ID NO.
2.
3. The use according to claim 1, characterized in that The drought tolerance of wheat can be improved by knocking out, silencing or inhibiting the TaGLO3 gene.
4. The use according to claim 1, characterized in that It improves wheat drought tolerance by reducing the expression of the encoding protein TaGLO3.
5. A method for improving drought tolerance of wheat, characterized in that: The method comprises the following steps: knocking out the TaGLO3 gene in wheat.
6. The method according to claim 5, characterized in that The knockout method includes the CRISPR / Cas9 method.
7. The method according to claim 6, characterized in that The target sites of the gRNA in the CRISPR / Cas9 method include target site 1 with a nucleotide sequence as shown in SEQ ID NO.3 and target site 2 with a nucleotide sequence as shown in SEQ ID NO.
4.
8. The method according to claim 7, characterized in that The nucleotide sequences of the knockout primers are shown in SEQ ID NO.5 to SEQ ID NO.
8.
9. The use according to any one of claims 1 to 4 or the method according to any one of claims 5 to 8, characterized in that: The wheat includes wheat Fielder.
Citation Information
Patent Citations
Wheat-resistant protein TaNAC034 as well as coding gene and application thereof
CN118931942A