Kit for detecting methylation of SHOX2, PTGER4, SEPTIN9 and HOXA9 genes in pleural cavity or seroperitoneum
By designing a kit for detecting methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusions, using a specific primer pair and fluorescent probe combination, combined with PCR technology, the problems of low sensitivity and misdiagnosis in existing effusion diagnostic methods are solved, and efficient and accurate identification of effusions is achieved.
Patent Information
- Application Number
- CN202510902847.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-09-19
AI Technical Summary
Existing diagnostic methods for effusions, such as cytological diagnosis, have low sensitivity and are difficult to accurately distinguish between benign and malignant effusions. There is a lot of experience-based reliance and misdiagnosis, which leads to uncertainty in clinical treatment strategies.
A kit was designed to detect methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusions. Specific primer pairs and fluorescent probe combinations were combined with PCR technology to detect benign and malignant effusions through fluorescence quantitative PCR.
The sensitivity and specificity of effusion detection have been improved, which can more accurately identify the benign or malignant nature of the effusion, reduce false positives and nonspecific amplification, and provide more objective diagnostic results.
Smart Images

Figure CN120666018A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of nucleic acid detection, and in particular relates to a kit for detecting methylation of SHOX2, PTGER4, SEPTIN9 and HOXA9 genes in pleural or peritoneal effusion. Background Art
[0002] Under normal circumstances, there is a trace amount of fluid in the pleural and abdominal cavities (about 5-15 ml in the pleural cavity and about 50-100 ml in the abdominal cavity), which acts as a lubricant. However, when the amount of fluid exceeds the normal range, effusion is formed, which may indicate an underlying disease. The causes of pleural effusion include infectious factors, heart failure or malignant tumors: for example, infections such as bacteria, viruses, and tuberculosis can cause pleurisy, leading to pleural effusion; or when the left heart fails, the pulmonary circulation is congested, the capillary pressure increases, and the fluid exudation increases, which can form pleural effusion; or malignant tumors such as lung cancer and breast cancer can directly invade the pleura, or metastasize to the pleura through the lymphatic or bloodstream, causing pleural effusion. Ascites can be caused by various factors, including hepatic, renal, and malignant tumors. For example, cirrhosis is a common cause of ascites. In cirrhosis, factors such as portal hypertension and hypoproteinemia lead to the accumulation of fluid in the peritoneal cavity. In nephrotic syndrome, hypoproteinemia reduces plasma colloid osmotic pressure, increasing fluid exudation and causing ascites. Malignant tumors such as liver cancer and ovarian cancer can directly invade the peritoneum or metastasize to the peritoneum via the lymphatic or hematogenous pathways, causing ascites. Infection, heart failure, hepatic, and renal causes are considered "benign," while malignant tumors are considered "malignant." Clinically, distinguishing the source of an effusion is known as "benign-malignant differentiation." Timely and accurate differentiation is crucial for developing treatment strategies.
[0003] Existing effusion diagnosis usually takes the following measures: When a patient is suspected of having pleural effusion or peritoneal effusion, the clinician can first find the location of the effusion through percussion, and then guide the patient to undergo imaging examinations, such as X-rays, B-ultrasound, CT, etc., to preliminarily determine the location, range and amount of the effusion. At this point, it can only be determined whether the patient actually has pleural effusion or peritoneal effusion. To determine whether the effusion is benign or malignant, it is necessary to perform a puncture and drainage of the effusion and perform a "cytological diagnosis" on the effusion. Cytological diagnosis can be used to determine the benign or malignant nature of the effusion as much as possible. Cytological diagnosis usually involves flattening and fixing the patient's cell sample on a glass slide, staining the cells with chemical reagents, and then observing them under a microscope. The shape of the stained cells, the size of the cell nucleus, the state of the connection between cells, and other information are used to determine whether there are cancer cells in the sample. However, cytology has several drawbacks: some atypically shaped cells can be difficult to determine whether they are cancerous, requiring considerable experience; its sensitivity is low, making it easy to miss some atypical cells; and when the pathological stage is uncertain but the clinician is urged to pay more attention to the patient, reports often include statements such as "atypia present," "severe atypical hyperplasia," or "suspected..., please consider clinical findings," resulting in numerous "gray zone" pathology reports. Therefore, alongside cytological diagnosis, there is an urgent need for more objective, accurate, and sensitive testing methods to help clinicians make more accurate judgments. Summary of the Invention
[0004] To address the above issues, the present invention provides a kit for detecting methylation of the SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusions. Primer pairs and probes targeting these gene methylation are also designed. This kit exhibits excellent sensitivity and specificity and can be used as an auxiliary diagnosis for differentiating benign from malignant pleural and peritoneal effusions. In clinical diagnosis of effusions, infection, heart failure, hepatic, and renal origins are all considered "benign sources," while malignant tumors are considered "malignant sources." Clinically, distinguishing the source of effusions is referred to as "differentiation of benign from malignant."
[0005] First, the present invention provides a composition of primer pairs and probes for detecting methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusion, comprising a primer pair and a probe set, wherein the primer pair comprises nucleotide sequences shown in SEQ ID NOs: 1-2, SEQ ID NOs: 4-5, SEQ ID NOs: 7-8, and SEQ ID NOs: 10-11; and the probe set comprises nucleotide sequences shown in SEQ ID NOs: 3, SEQ ID NOs: 6, SEQ ID NOs: 9, and SEQ ID NOs: 12.
[0006] The probe set is labeled with a fluorescent group.
[0007] The fluorescent group is selected from one or more of FAM, VIC, CY5, HEX, CY3, ROX, NED, and JOE.
[0008] In the probe group, the probe sequence shown in SEQ ID NO: 3 is labeled with a FAM fluorescent group; the probe sequence shown in SEQ ID NO: 6 is labeled with a VIC fluorescent group; the probe sequence shown in SEQ ID NO: 9 is labeled with a FAM fluorescent group; and the probe sequence shown in SEQ ID NO: 12 is labeled with a VIC fluorescent group.
[0009] The present invention further provides a kit for detecting methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusion, comprising a combination of the above primers and probes.
[0010] The kit also includes a primer pair and an internal reference quality control product for the probe. The primer pair for the internal reference quality control product has a nucleotide sequence as shown in SEQ ID NO: 13-14, and the probe for the internal reference quality control product has a nucleotide sequence as shown in SEQ ID NO: 15.
[0011] The kit also includes a PCR reaction mixture, which includes dNTP, PCR reaction buffer, Mg 2+ , spermidine and BSA.
[0012] The kit of the present invention also includes a DNA pretreatment reagent, which includes the following main components: 1. Proteinase K, 2. Lysis solution: SDS, sodium chloride, EDTA, 3. Binding solution: guanidine hydrochloride, ethanol, Tris-HCl, PEG and sodium ions, 4. Magnetic beads specially used for DNA extraction, and 5. Elution solution: Tris-EDTA.
[0013] The kit of the present invention also comprises a sulfite conversion reagent, the main components of which are as follows: bisulfite, a binding solution comprising guanidine hydrochloride, ethanol, Tris-HCl, PEG and sodium ions, a desulfonation solution comprising Tris-HCl and sodium hydroxide, an eluent and a purification column.
[0014] The present invention also provides use of the above composition or the above kit in preparing products for detecting SHOX2, PTGER4, SEPTIN9, and HOXA9 gene methylation in pleural or peritoneal effusion.
[0015] Use of the above composition or the above kit in preparing a reagent for assisting in distinguishing clinical benign or malignant pleural or peritoneal effusion.
[0016] Beneficial effects
[0017] 1. The combination of the primer pair and the probe of the present invention has an overall low Ct value for detecting SHOX2 gene methylation in pleural or peritoneal effusion, and significantly less nonspecific amplification; for detecting PTGER4 gene methylation, it is less affected by inflammatory factors and has better detection specificity; for detecting SEPTIN9 gene methylation, it can reduce the problem of false positive tailing after the increase in the circulating Ct value, thereby enhancing the specificity of the detection; for detecting HOXA9 gene methylation, it can also effectively avoid the influence of nonspecific amplification.
[0018] 2. The present invention selects to use multiple indicators for joint detection. The positive results between different detection indicators can complement each other, avoiding the difference in diagnostic efficacy of different indicators, and has excellent detection sensitivity and specificity.
[0019] Figures in the specification
[0020] Figure 1 Ct values of positive detection results of two primer-probe combinations for SHOX2
[0021] Figure 2 Fluorescence quantitative PCR curve of the optimal primer-probe combination for SHOX2
[0022] Figure 3 Amplification curve of positive samples of SEPTIN9 gene original system and primer-probe combination used in the present invention
[0023] Figure 4 Amplification curves of negative samples of SEPTIN9 gene original system and primer-probe combination used in the present invention
[0024] Figure 5 The ability of HOXA9 gene methylation to distinguish benign from malignant samples at the optimal cut-off value
[0025] Figure 6 Detection process of the present invention
[0026] Figure 7 Comparison of the diagnostic effects of methylation detection and cytology in effusion
[0027] Figure 8 Diagnostic sensitivity of different indicators for pleural effusion and peritoneal effusion
[0028] Figure 9 Comparison of detection performance of the kit of the present invention and reference reagents DETAILED DESCRIPTION
[0029] Example 1
[0030] 1. Primer and probe design
[0031] According to the sequence information of SHOX2, PTGER4, SEPTIN9, HOXA9 and β-ACTIN genes, the present invention designs corresponding primer pairs and fluorescent probes for each gene.
[0032] Optimization of primer-probe system Optimization of primer-probe system for SHOX2 gene methylation
[0033] First, the entire SHOX2 gene segment was sequenced, followed by secondary sequencing of the sulfite-converted SHOX2 gene segment. This allowed the identification of potential primer design regions, and preliminary primer designs were developed. After comparing various primer sets, including annealing temperature, primer length, potential hairpin structures, and dimers, the primers F:CGAGTTTAGGAGCGGTTGCA and R:AACTTTTCT CCTCCTCCAATT were discarded due to their high risk for hairpin formation. Ultimately, two primer probe sets were selected for experimental testing.
[0034] Pleural effusion and peritoneal effusion of patients with confirmed malignant tumors were selected as the validation group, and pleural effusion and peritoneal effusion of patients with pulmonary tuberculosis and liver cirrhosis were selected as the control group. The patients were treated with combination 1:
[0035] The primer-probe system of F-TTAGGATAGTTAGCTAATTTTCG, R-CGTACAGGCCTATACTCGAACG, P-CCCCCATCGAACGAACGAAAC and combination 2: F-TTTGGATACTTAGTAATTTTCG, R-CGAACACGCGTATACACGTACG, P-GGTTCACGCCTAAACTCGTAGG was used for the experiment. Figure 1 As shown in Figure 1, the Ct value of the primer-probe system of combination 1 is lower overall, and non-specific amplification is significantly less. At the same time, the amplification efficiency of the primer-probe system of combination 1 is higher. Figure 2 It can be seen that the Ct value of the positive validation sample is within 29, and the amplification of the gray zone sample with low methylation signal abundance is all after the Ct value of 35. The difference in the amplified Ct values is very obvious, so it is more suitable for the detection of a small amount of free DNA in the effusion. Therefore, the present invention finally selected combination 1 as the primer probe system for practical application. Optimization of the PTGER4 gene methylation primer probe system
[0036] Usually, the ideal length of the primer sequence is about 18-27 nucleotides. When the PTGER4 primers (hereinafter referred to as comparative example 1) F-TTTCGTTGTTTTTTTAGTTTTGTCG and R-AATAAATAAAATAACCATCTAAATC given in patent CN201710054973.7 were verified, it was found that the primer lengths were close to the ideal length upper limit, so that it needed to match a higher extension temperature. The present invention re-performed gene sequencing, and after screening and designing, a more suitable forward primer sequence of 20 nucleotides and a reverse primer sequence of 22 nucleotides (F-ACTTCGGAGTTAATCGTCCG, R-ATTATATCGCACTTCGTCTACC) were found. The PCR reaction solution was configured using the PCR reaction system mentioned above in the present invention, and after collecting pleural effusion and ascites from 17 patients diagnosed with malignant tumors and pleural effusion and ascites from 12 patients with inflammation and infectious diseases, PTGER4 gene methylation detection was performed on all samples. Comparative experimental results showed that the new system was less affected by inflammatory factors and had better detection specificity (Table 1, 91.7% VS. 75.0%).
[0037] Table 1 Optimization of the TGER4 gene methylation primer-probe system
[0038]
[0039]
[0040] Optimization of the SEPTIN9 gene methylation primer and probe system
[0041] After synthesizing and verifying the primer probes given in patent CN201710754697, it was found that (F-CCCACCAGCCATCATGT, R-CCACCTTCGAAGTCCGAAAT, P-CCATCCAGCTGCGCGTTGAC) the primer probe system ( Figure 3 、 4 The SEPTIN9 amplification curve (shown as the original system) exhibited a low starting height during amplification, and the curve was prone to tailing when the cycle number exceeded 35. A new primer-probe system was developed by resequencing the SEPTIN9 gene before and after sulfite conversion. Clinical samples from patients diagnosed with malignant tumors and a control group of benign diseases were tested. Figure 3 As shown, the PCR system of the present invention has a higher amplification efficiency for the methylated region of SEPTIN9 gene of positive samples, and the curve shows a perfect "S" shape ( Figure 3 Blue curve), it improves the problem of the original system amplification curve falling. For negative samples ( Figure 4), the system of the present invention also reduces the problem of false positive tailing after the cycle Ct value increases, and enhances the specificity of detection.
[0042] Optimization of primer-probe system for HOXA9 gene methylation
[0043] The optimization of the HOXA9 gene methylation detection system is mainly reflected in the setting of the Cut-off value. Existing studies have shown that HOXA9 gene methylation has a high signal abundance in gynecological malignancies and blood tumors. The present invention found in the verification that HOXA9 gene methylation will also show a certain degree of amplification signals in some inflammatory diseases and benign tumors, which may overlap with the detection results of malignant tumor patients, but the HOXA9 amplification signal Ct value of patients with inflammation and benign tumors is relatively lagging. After analysis, it was found that ( Figure 5 ), when the cut-off value of HOXA9 was set at △Ct≤9, the detection specificity of HOXA9 could be greater than 95%, and the 95% confidence interval was 0.7575-1.000, which effectively avoided the influence of nonspecific amplification.
[0044] The final primer-probe system
[0045] The primer pairs and probes are named according to the genes being detected. “F” represents the forward primer, “R” represents the reverse primer, and “P” represents the fluorescent probe. The primers and probes are shown in Table 2 .
[0046] Table 2 Primer pairs and probe nucleotide sequences
[0047]
[0048]
[0049] The detection kit of the present invention also includes a PCR amplification system for detecting SHOX2, PTGER4, SEPTIN9, and HOXA9 methylation, including a main reaction solution: dNTP, PCR reaction buffer, Mg 2+ , spermidine, BSA.
[0050] The detection kit of the present invention includes a primer-probe mixture, a main reaction solution, an internal reference quality control product (a primer pair and a fluorescent probe corresponding to the βACTIN gene), and purified water, as shown in Table 3.
[0051] Table 3 Reaction system of PCR reagent preparation
[0052] Components concentration volume βACTIN-F 30uM 0.5μL βACTIN-R 30uM 0.5μL SHOX2-F 30uM 0.5μL SHOX2-R 30uM 0.5μL SEPTIN9-F 30uM 0.5μL SEPTIN9-R 30uM 0.5μL HOXA9-F 30uM 0.5μL HOXA9-R 30uM 0.5μL PTGER4-F 30uM 0.5μL PTGER4-R 30uM 0.5μL βACTIN-P 30uM 0.15μL SHOX2-P 30uM 0.15μL SEPTIN9-P 30uM 0.15μL HOXA9-P 30uM 0.15μL PTGER4-P 30uM 0.15μL dNTP 4mM 2μL PCR buffer 10* 2μL Mg2+ 30mM 2.5 μL Spermidine 15mM 1 μL BSA 5% 0.5μL water 6.5 μL
[0053] The present invention also uses a DNA pretreatment reagent, which is usually derived from a commercial product on the market and specifically includes the following main components: 1. Proteinase K, 2. Lysis solution: SDS, sodium chloride, EDTA, 3. Binding solution: guanidine hydrochloride, ethanol, Tris-HCl, PEG and sodium ions, 4. Magnetic beads specifically for DNA extraction, 5. Elution solution: Tris-EDTA.
[0054] The present invention also uses a sulfite conversion reagent, which is usually derived from a commercial product on the market, and its main components are as follows: bisulfite, a binding solution: guanidine hydrochloride, ethanol, Tris-HCl, PEG and sodium ions, a desulfonation solution: Tris-HCl and sodium hydroxide, an eluent, and a purification column.
[0055] Example 2 Detection method
[0056] The main process of the test is as follows:
[0057] 1. Sample Pretreatment
[0058] After collecting the patient's effusion sample, remove 10 ml and transfer it to a clean container. The remaining sample undergoes cytological diagnosis according to normal procedures. First, centrifuge the 10 ml effusion. After centrifugation, the lower layer contains the cell pellet and the upper layer is a clear liquid. Transfer the supernatant to a new container for subsequent testing.
[0059] 2. Sample DNA Extraction
[0060] Take an appropriate amount of the supernatant and extract DNA using a DNA pretreatment reagent. First, add proteinase K to dissolve proteins bound to the DNA and improve the purity of the extraction. Then, add lysis buffer to further denature the proteins and better release the free DNA. Next, add binding buffer, which contains guanidine hydrochloride, ethanol, Tris-HCl, PEG, and sodium ions to fully dehydrate and concentrate the DNA, enhancing its surface negative charge. Next, add magnetic beads specifically designed for DNA extraction, allowing the negatively charged DNA to adsorb to the bead surface via ionic bridges. Then, repeatedly wash the beads to remove impurities. Finally, add elution buffer containing Tris-EDTA and heat at 56°C for 5 minutes to elute the free DNA from the beads. Transfer the eluted free DNA to a new container for storage.
[0061] 3. Sulfite modification of DNA
[0062] Sulfite modification is an important step in DNA methylation detection. The main process is as follows:
[0063] Add an appropriate amount of CT conversion reagent (mainly bisulfite) to the free DNA extracted in the previous step, transfer it to a polymerase chain reaction (PCR) instrument, treat at 98°C for 8 minutes, and then at 64°C for 3.5 hours. Transfer the treated free DNA to a purification column and add a binding solution containing guanidine hydrochloride, ethanol, Tris-HCl, PEG, and sodium ions. Centrifuge at 12,000 rpm for 30 seconds, and discard the centrifuged liquid. At this point, the free DNA is attached to the purification membrane of the purification column. Then, add a wash solution and a "desulfonation solution" containing Tris-HCl and sodium hydroxide, and centrifuge again at 12,000 rpm for 30 seconds. Finally, add an elution solution to elute the sulfite-modified free DNA from the purification membrane for subsequent experiments.
[0064] 4. Gene methylation detection
[0065] Add sulfite-modified free DNA, DNA polymerase, and PCR reaction solution to a PCR reaction tube. Place the tube in a fluorescent quantitative polymerase chain reaction (RT-PCR) instrument and run the specified test program. After the program completes, the program automatically generates the test results.
[0066] The detection procedures are set as follows:
[0067] Stage 1: 95°C, 10 minutes, 1 cycle;
[0068] The second stage: 95 °C, 15 seconds, 60 °C, 30 seconds, 5 cycles;
[0069] Stage 3: 95°C, 15 seconds, 57°C, 30 seconds, 40 cycles;
[0070] In the third stage, the fluorescence signal of the RT-PCR instrument was collected at 57°C.
[0071] 5. Determination of test results
[0072] The present invention sets a formula for determining the results. By inputting the test results of SHOX2, PTGER4, SEPTIN9 and HOXA9 into the formula, the formula automatically generates three different results: negative, positive or strongly positive. Among them, "negative" means that the effusion is more likely to be caused by a benign disease, "positive" means that the effusion is more likely to be caused by a malignant tumor, and "strongly positive" means that the possibility of a malignant tumor is extremely high. The test results output by the RT-PCR instrument will be presented in the form of Ct values, including Ct SHOX2 , Ct PTGER4 , Ct SEPTIN9 , Ct HOXA9 , Ct β-Actin First, calculate the ΔCt values of the four indicators, ΔCtSHOX2 =Ct SHOX2 -ΔCt β-Actin ;ΔCt PTGER4 =Ct PTGER4 -ΔCt β-Actin ;ΔCt SEPTIN9 =Ct SEPTIN9 -ΔCt β-Actin ;ΔCt HOXA9 =Ct HOXA9 -ΔCt β-Actin The subsequent results were determined based on the ΔCt value.
[0073] When the sample is pleural effusion or peritoneal effusion, the specific result determination method is as follows:
[0074] If ΔCt SHOX2 ≤9, regardless of ΔCt PTGER4 , ΔCt SEPTIN9 , ΔCt HOXA9 Whatever the result, it was determined to be strongly positive;
[0075] If ΔCt PTGER4 ≤5, regardless of ΔCt SHOX2 , ΔCt SEPTIN9 , ΔCt HOXA9 Whatever the result, it was determined to be strongly positive;
[0076] If ΔCt SEPTIN9 ≤6, regardless of ΔCt SHOX2 , ΔCt PTGER4 , ΔCt HOXA9 Whatever the result, it was determined to be strongly positive;
[0077] If ΔCt HOXA9 ≤6, regardless of ΔCt SHOX2 , ΔCt PTGER4 , ΔCt SEPTIN9 Whatever the result, it was determined to be strongly positive;
[0078] If 9<ΔCt SHOX2 ≤12,5<ΔCt PTGER4 ≤8, 6<ΔCt SEPTIN9 ≤9, 6<ΔCt HOXA9 ≤9 of the four conditions, any combination of three occurring simultaneously is considered strongly positive regardless of the last ΔCt value;
[0079] If 9<ΔCt SHOX2 ≤12,5<ΔCt PTGER4 ≤8, 6<ΔCt SEPTIN9 ≤9, 6<ΔCt HOXA9≤9 of the four cases, any two combinations appear at the same time, and the other two ΔCt are within the following range: ΔCt SHOX2 >12, ΔCt PTGER4 >8, ΔCt SEPTIN9 >9, ΔCt HOXA9 >9, it is considered weakly positive;
[0080] If 9<ΔCt SHOX2 ≤12,5<ΔCt PTGER4 ≤8, 6<ΔCt SEPTIN9 ≤9, 6<ΔCt HOXA9 ≤9 of the four cases, any one of them occurs, and the other three ΔCt are within the following range: ΔCt SHOX2 >12, ΔCt PTGER4 >8, ΔCt SEPTIN9 >9, ΔCt HOXA9 >9, it is considered weakly positive;
[0081] Except for the above cases, all the cases were judged as negative. Figure 6 .
[0082] Example 3 Sensitivity and specificity of the kit for distinguishing benign and malignant pleural effusions and peritoneal effusions
[0083] To validate the diagnostic efficacy of the present invention, the present invention collected pleural effusions from 261 patients with malignant tumors, including 175 cases of lung cancer, 52 cases of breast cancer, and 34 cases of other cancers such as the esophagus. Ascites were collected from 129 patients with malignant tumors, including 77 cases of gastrointestinal tumors, 34 cases of liver cancer, and 18 cases of other cancers such as the ovary. Pleural effusions were also collected from 105 patients with benign diseases, including 50 cases of tuberculous pleurisy, 40 cases of pneumonia, and 15 cases of heart disease. Ascites were collected from 90 patients with benign diseases, including 62 cases of liver cirrhosis and 28 cases of kidney disease.
[0084] The kit of the present invention was used to perform four-gene methylation detection on the above samples. The above detection method was adopted, and the primers and probes optimized by the present invention were used to perform fluorescence quantitative PCR detection, and the gene methylation status of the samples was evaluated.
[0085] After performing the four-gene methylation test described in this invention, the patient's test results were recorded, along with the patient's cytology test results and the clinician's final clinical diagnosis based on the various test results. The clinician's final clinical diagnosis was used as the gold standard for subsequent statistical analysis.
[0086] like Figure 7As shown, the overall diagnostic sensitivity of the present invention for pleural effusion and ascites was 86.2% (261 cases of malignant pleural effusion, 225 cases detected by four-gene methylation) and 85.3% (129 cases of malignant ascites, 110 cases detected by four-gene methylation), respectively. For the same batch of samples, the sensitivity of cytological diagnosis was only 63.6% (261 cases of malignant pleural effusion, 166 cases detected by cytology) and 37.2% (129 cases of malignant pleural effusion, 48 cases detected by cytology), which was significantly lower than that of methylation detection. At the same time, the detection specificity of methylation detection can still be maintained at 95.2% (105 cases of benign pleural effusion, 100 cases of four-gene methylation detection were negative) and 90.0% (90 cases of benign ascites, 81 cases of four-gene methylation detection were negative), effectively avoiding the influence of benign diseases on diagnostic specificity.
[0087] In addition, from Figure 8 It can be seen that the diagnostic sensitivity of different indicators for pleural effusion and peritoneal effusion is different. This is because each methylation indicator plays a different role in the occurrence and development of tumors. For example, SHOX2 gene methylation can interfere with signal transduction pathways related to cell growth, differentiation and apoptosis, thereby leading to abnormal cell proliferation and changes in migration ability. It shows a higher detection positive rate in malignant tumors such as lung cancer and gastrointestinal tumors. For another example, SEPTIN9 plays an important role in cytoskeleton reorganization, cell cycle regulation and DNA repair. Methylation of SEPTIN9 can lead to an imbalance in cell cycle regulation and promote the unlimited proliferation of tumor cells. It may show a higher positive rate in tumors such as gastrointestinal tumors and breast tumors.
[0088] From the research conducted by the present invention, it can be seen that ( Figure 8The diagnostic sensitivity of SHOX2 gene methylation in pleural effusion was 52.1% (SHOX2 gene methylation was detected in 136 of 261 cases of malignant pleural effusion); the diagnostic sensitivity of PTGER4 gene methylation in pleural effusion was 78.1% (PTGER4 gene methylation was detected in 204 of 261 cases of malignant pleural effusion); the diagnostic sensitivity of SEPTIN9 gene methylation in pleural effusion was 20.7% (SEPTIN9 gene methylation was detected in 54 of 261 cases of malignant pleural effusion); and the diagnostic sensitivity of HOXA9 gene methylation in pleural effusion was 61.3% (HOXA9 gene methylation was detected in 160 of 261 cases of malignant pleural effusion). At the same time, the diagnostic sensitivity of SHOX2 gene methylation in ascites was 44.2% (SHOX2 gene methylation was detected in 57 of 129 cases of malignant ascites); the diagnostic sensitivity of PTGER4 gene methylation in ascites was 27.9% (PTGER4 gene methylation was detected in 36 of 129 cases of malignant ascites); the diagnostic sensitivity of SEPTIN9 gene methylation in ascites was 69.0% (SEPTIN9 gene methylation was detected in 89 of 129 cases of malignant ascites); and the diagnostic sensitivity of HOXA9 gene methylation in ascites was 53.5% (HOXA9 gene methylation was detected in 69 of 129 cases of malignant ascites).
[0089] Since the four genes selected in the present invention are all pan-oncogenes (i.e., they are associated with a variety of different tumors), different indicators have different diagnostic performances in different cancer types. However, the present invention chooses to use multiple indicators for joint detection, and the positive results between different detection indicators can complement each other, avoiding differences in diagnostic efficacy between different indicators.
[0090] To further investigate the diagnostic effect of the kit of the present invention, the present invention was compared with existing methylation detection products for SHOX2, RASSF1A, and PTGER4 gene loci. The scope of application described in the product registration certificate is early screening for lung cancer, and the relevant patent corresponding to the primer and probe sequences used in the kit is CN201710054973. And another marketed SEPTIN9 gene methylation detection product, the scope of application described in the product registration certificate is early screening for colorectal cancer, and the relevant patent corresponding to the primer and probe sequences used in the kit is CN201710754697. Using the above two kits as control reagents, the detection performance of the primer-probe system of the SHOX2, PTGER4, SEPTIN9, and HOXA9 kits of the present invention and the control reagent was compared.
[0091] The present invention collected pleural effusions from 97 lung cancer patients and 58 benign disease patients, including 37 tuberculosis patients and 21 pneumonia patients.
[0092] Gene methylation testing was performed using primers and probes from the control reagent. Results showed that among 97 lung cancer patients' pleural effusions, 70 tested positive for methylation using the reference reagent, with a sensitivity of 72.2%. Among 58 patients with benign diseases, 31 tested positive for methylation using the control reagent, with a specificity of only 46.6%.
[0093] Compared with the kit of the present invention, the present invention has carried out a large number of gene sequencing work on samples of malignant tumor patients, and selected gene segments with better specificity for primer design. Specifically, the CpG island region linked to methylation is analyzed from the sequence information, and the gene sequence of the primer probe is further optimized by adjusting the primer length, GC content, and avoiding the formation of secondary structure. The present invention achieves better detection effect by optimizing the primer probe. Figure 9 As shown, the diagnostic sensitivity of this kit for pleural effusion is 86.2%, while the reference reagent is 72.2%. The diagnostic specificity of this kit is 95.2%, while the reference reagent is only 46.6%. In all aspects, the performance is significantly superior to the reference reagent product corresponding to the CN201710054973 patent.
[0094] Validation of the SEPTIN9 methylation assay in patent CN201710754697 revealed a significant tailing phenomenon. Specifically, when the Ct value exceeded 35, samples in the negative control group might show weak amplification signals, thereby reducing the specificity of the assay. This study redesigned the primer-probe system for the SEPTIN9 gene, improving the tailing of the amplification signal and increasing the specificity from 78.1% (25 / 32) to 93.8% (30 / 32).
Claims
1. A combination of primer pairs and probes for detecting methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusion, characterized in that: It includes a primer pair and a probe group, wherein the primer pair includes the nucleotide sequence shown as SEQ ID NO: 1-2, SEQ ID NO: 4-5, SEQ ID NO: 7-8, and SEQ ID NO: 10-11; the probe group includes the nucleotide sequence shown as SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, and SEQ ID NO:
12.
2. The primer and probe combination according to claim 1, wherein The probe set is labeled with a fluorescent group.
3. The primer and probe composition according to claim 2, characterized in that The fluorescent group is selected from one or more of FAM, VIC, CY5, HEX, CY3, ROX, NED, and JOE.
4. The primer and probe combination according to claim 3, characterized in that In the probe group, the probe sequence shown in SEQ ID NO: 3 is labeled with a FAM fluorescent group; the probe sequence shown in SEQ ID NO: 6 is labeled with a VIC fluorescent group; the probe sequence shown in SEQ ID NO: 9 is labeled with a FAM fluorescent group; and the probe sequence shown in SEQ ID NO: 12 is labeled with a VIC fluorescent group.
5. A kit for detecting methylation of SHOX2, PTGER4, SEPTIN9, and HOXA9 genes in pleural or peritoneal effusion, characterized in that: A composition comprising the primer and probe according to any one of claims 1 to 4.
6. The kit according to claim 5, characterized in that The kit also includes internal reference quality control products for primer pairs and probes.
7. The kit according to claim 6, characterized in that The primer pair of the internal reference quality control product has a nucleotide sequence as shown in SEQ ID NO: 13-14, and the probe of the internal reference quality control product has a nucleotide sequence as shown in SEQ ID NO:
15.
8. The kit according to claim 6, characterized in that The kit also includes a PCR reaction mixture, which includes dNTP, PCR reaction buffer, Mg 2+ , spermidine and BSA.
9. Use of the composition according to any one of claims 1 to 4 or the kit according to any one of claims 5 to 7 in preparing a method for detecting SHOX2, PTGER4, SEPTIN9, or HOXA9 gene methylation products in pleural or peritoneal effusion.
10. Use of the composition according to any one of claims 1 to 4 or the kit according to any one of claims 5 to 7 in the preparation of a reagent for assisting in the clinical differentiation of benign or malignant pleural or peritoneal effusions.
Citation Information
Patent Citations
Detection kit for diagnosis of patient with lung cancer based on multiple genes
CN108342477A
Composition and method for detecting methylated DNA (deoxyribonucleic acid) of Septin9 gene
CN109423518A