SNP (Single Nucleotide Polymorphism) molecular marker related to laying number of chicken and application of SNP molecular marker

By using the SNP molecular marker at position 1141 of exon 6 of the chicken ERα gene for early selection in chicken breeding, the problem of slow genetic progress in egg production performance in breeding was solved, the number of eggs produced by chickens was increased and the breeding cost was reduced.

CN120666032AActive Publication Date: 2025-09-19JIANGSU INST OF POULTRY SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510692114.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-09-19
Estimated Expiration
2045-05-27

AI Technical Summary

Technical Problem

Existing technologies have made slow progress in the genetics of egg-laying performance in chicken breeding, resulting in high breeding costs and insufficient market competitiveness.

Method used

A SNP molecular marker at position 1141 of exon 6 of the chicken ERα gene was used for early breeding selection. By detecting the CC genotype population and eliminating the TT and CT genotype populations, PCR amplification and Sanger sequencing were performed using primers F and R to achieve early selection of chicken egg production.

Benefits of technology

It increases the average egg production of the flock, reduces breeding costs, and achieves rapid and efficient genetic progress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666032A_ABST
    Figure CN120666032A_ABST
Patent Text Reader

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to the laying number of chickens and application of the SNP molecular marker, and belongs to the technical field of molecular genetics and animal breeding, the SNP molecular marker is located at the 1141 site of a cDNA (Complementary Deoxyribonucleic Acid) sequence of an ERalpha gene of a chicken genome and corresponds to the 136bp site in the sequence shown in SEQ ID NO.1, and the basic group at the site is C or T. The SNP molecular marker can be used for early breeding selection of the laying number of chickens, effectively improves the average laying number of chicken flocks, reduces the breeding cost, and provides a convenient technical means for establishing molecular marker-assisted breeding for selection of the laying number of chickens.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular genetics and animal breeding, and particularly relates to a SNP molecular marker related to the number of eggs produced by chickens and an application thereof. Background Art

[0002] my country's egg-laying chicken industry is the world's largest producer and consumer market, providing a high-quality protein source for improving the national diet. Genetic improvement of egg production during breeding remains a core goal of provenance innovation in the egg-laying chicken industry. Egg production, the most important economic trait in chickens, has a heritability parameter of only 0.18-0.22. Under current breeding conditions, many breeding institutions still use traditional phenotypic selection techniques, resulting in less than 1.5 genetic gains per year. This slows genetic progress and severely restricts the market competitiveness of my country's independently developed varieties. Summary of the Invention

[0003] In order to genetically improve the egg production of laying hens, the present invention provides a SNP molecular marker related to the egg production of chickens. The SNP molecular marker is located in the ERα gene and can be used for early breeding selection of the egg production of chickens, effectively increasing the average egg production of the flock and reducing breeding costs.

[0004] The present invention also provides an application of a SNP molecular marker related to the number of chicken eggs in genetic breeding for improving the egg-laying performance of chickens.

[0005] The present invention is achieved through the following technical solutions:

[0006] The present invention provides a SNP molecular marker related to the number of chicken eggs. The SNP molecular marker is located at the 1141th position of the cDNA sequence of the ERα gene in the chicken genome, corresponding to the 136th bp position in the sequence shown in SEQ ID NO.1, where the base is C or T.

[0007] Based on the same inventive concept, the present invention provides an application of a SNP molecular marker related to the number of eggs produced by chickens in genetic breeding to improve the egg-laying performance of chickens.

[0008] Based on the same inventive concept, the present invention provides an early selection method for the chicken egg production trait, which includes early selection of the chicken egg production trait based on the genotype of the above-mentioned SNP molecular marker related to the chicken egg production number.

[0009] Furthermore, the early selection method specifically includes:

[0010] Detecting the genotype of the SNP molecular marker in the chicken genome to be tested;

[0011] Performing early selection on the egg production trait of the chicken to be tested based on the genotype of the SNP molecular marker;

[0012] The number of eggs laid by the CC genotype group marked by the SNP molecule is greater than that of the TT or CT genotype group. The CC genotype group is retained during the early selection process, and the TT and CT genotype groups are eliminated.

[0013] Furthermore, the detecting of the genotype of the SNP molecular marker in the chicken genome to be tested specifically includes:

[0014] PCR amplification of the chicken genomic DNA was performed using primers F and R;

[0015] Sequencing the PCR amplification product to obtain the genotype of the SNP molecular marker in the chicken genome to be tested;

[0016] The nucleotide sequence of the primer F is shown in SEQ ID NO.2, and the nucleotide sequence of the primer R is shown in SEQ ID NO.3.

[0017] Based on the same inventive concept, the present invention provides a detection primer for a SNP molecular marker related to the number of chicken eggs for use in genetic breeding to improve the egg-laying performance of chickens.

[0018] Furthermore, the detection primers include primer F and primer R, the nucleotide sequence of primer F is shown as SEQ ID NO.2, and the nucleotide sequence of primer R is shown as SEQ ID NO.3.

[0019] Based on the same inventive concept, the present invention provides an application of a detection kit for SNP molecular markers related to the number of chicken eggs in genetic breeding for improving the egg-laying performance of chickens.

[0020] Furthermore, the detection kit comprises primer F and primer R, the nucleotide sequence of primer F is shown as SEQ ID NO.2, and the nucleotide sequence of primer R is shown as SEQ ID NO.3.

[0021] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0022] 1. The present invention discloses a single-nucleotide polymorphism (SNP) molecular marker associated with egg production in chickens. The SNP molecular marker is a C / T mutation at position 1141 of the cDNA sequence of the ERα gene in the chicken genome. This SNP is associated with egg production in chickens and can be used for early breeding selection of the egg production trait in chickens, effectively increasing the average egg production in a flock and reducing breeding costs.

[0023] 2. The present invention provides an application of a SNP molecular marker associated with the number of chicken eggs in genetic breeding to improve the egg-laying performance of chickens. The SNP molecular marker is associated with the number of chicken eggs. The SNP molecular marker and its detection primer can be used to establish a fast, efficient and accurate molecular marker-assisted breeding technology using the Sanger sequencing method, so that early selection of egg production can be performed, which can accelerate genetic progress and provide a convenient technical means for establishing molecular marker-assisted breeding for selecting the number of chicken eggs. It has the advantages of simple operation and high reliability, can achieve early selection, and greatly reduce breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 This is a gel image of the PCR amplification product of the chicken ERα gene containing exon 6.

[0026] Figure 2 This is the reference peak map for the base mutation at position 1141 in the CDS region of the chicken ERα gene. DETAILED DESCRIPTION

[0027] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0028] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0029] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0030] The overall idea of ​​the present invention is as follows:

[0031] ERα is the estrogen receptor gene. Estrogen binds to ERα to form a complex. As a nuclear transcription factor, ERα promotes or inhibits the transcription of target genes by binding to the estrogen response element (ERE) of the target gene, thereby regulating the changes in cell functions affected by the target gene. Based on the important regulatory role of ERα in reproduction, the inventors designed primers capable of amplifying eight exon regions for the coding sequence of ERα (Gene ID: 396099). Using mixed pool sequencing technology, they unexpectedly discovered for the first time that ERα had a mutation in its sixth exon, namely position 1141 in the CDS region, in the specialized green-shell laying hen breed L3. Based on this, primers capable of completely amplifying the sixth exon were designed, and PCR was performed to amplify a 326bp PCR product. All individual PCR products were subjected to Sanger sequencing, and the mutation position at 136bp of the PCR product was genotyped and identified. The general linear model was used to analyze the association between its different genotypes and egg production traits. It was found that the different genotypes of this site were closely related to the number of eggs produced by chickens at 40 weeks of age, and it has great development prospects as a molecular marker.

[0032] The mutation is located in exon 6 of the chicken ERα gene (nucleotide sequence as SEQ ID. NO. 1), at position 1141 of the CDS region with GenBank accession number NM_205183.2, where a C→T base mutation occurs.

[0033] Based on this, the present invention provides a SNP molecular marker associated with egg production in chickens and its application in genetic breeding to improve egg production performance in chickens. The SNP molecular marker in exon 6 of the ERα gene is used for early breeding selection of the egg production trait in chickens, effectively increasing the average egg production of the flock and reducing breeding costs.

[0034] The following will describe in detail a SNP molecular marker related to the number of eggs produced in chickens and its application in combination with examples and experimental data.

[0035] Example 1

[0036] This embodiment provides a method for early selection of the egg production trait of chickens, which is as follows:

[0037] 1. Experimental materials, reagents and instruments

[0038] (1) Experimental materials: The fifth generation of green-shelled laying hens from the Jiangsu Poultry Science Research Institute were used as the material. All hens had a record of laying eggs at 40 weeks of age. 155 hens were randomly selected and their blood was collected.

[0039] (2) Main reagents: Proteinase K solution (Sangon Biotechnology); 2×Accurate Taq premix (containing dye, Acrylic Biologicals); agarose (Sangon Biotechnology); DNA marker (Acrylic Biologicals).

[0040] (3) Main instruments: PCR amplification instrument (Bio-Rad), gel imaging analysis system (WD-9413B, Beijing Liuyi).

[0041] 2. Detection Method

[0042] (1) Chicken blood collection: Blood is collected from the wing vein of laying hens in breeding lines or breed selection groups, and anticoagulated with ACD.

[0043] (2) Genomic DNA extraction: Take the chicken blood sample in step (1) and extract the genomic DNA using the phenol imidazole method to determine the DNA concentration and purity.

[0044] (3) PCR amplification: PCR reaction was performed using the genomic DNA obtained in step (2) as a template. Synthetic primers: F: 5'-CCTGGTTCTCTGGATGCTGT-3' (SEQ ID NO. 2), R: 5'-TCAGAAGCCATCAAATTGTAGCA-3' (SEQ ID NO. 3). The primer positions are shown in bold at the beginning and end of the sequence in SEQ ID NO. 1. The PCR reaction system was: 25 μL of 2×AccurateTaq Master Mix, 1 μL each of 10 μM primers F and R, 2 μL of DNA template (final concentration ≤ 500 ng), and sterile water was added to make up to 50 μL.

[0045] The PCR reaction program was as follows: 30 cycles of pre-denaturation at 94°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute, and post-extension at 72°C for 5 minutes. The PCR product was detected on agarose gel electrophoresis, and a clear amplified band of 326 bp was obtained, which was the target band ( Figure 1 ).

[0046] (4) Sanger sequencing of PCR products: The correctly amplified PCR products were sent to Shanghai Sangon Biotechnology Co., Ltd. for bidirectional sequencing.

[0047] (5) Identification of the mutant sequence in the 6th exon sequence of the individual ERα gene: The sequencing results in step (4) were viewed using SnapGene software and compared with the following Seq ID No: 1 sequence.

[0048] Seq ID No:1:

[0049] CCTGGTTCTCTGGATGCTGTTGTTCCACTTACAAAAGTGGAATATTTTTACTGTCTCCTATTTATTCTTTCAGGA TTTGTGGATTTAACACTCCATGATCAGGTCCATCTGCTGGAATGTGCCTGGTTAGAGATA C / T TGATGATCGGCTTAG TCTGGCGCTCCATGGAACACCCAGGAAAGCTTTTATTTGCACCTAATCTATTACTGGACAGGTCAGTCTGTGTATTGCTGTTAATTATTTAAGTAAATTAATTTGTTTCTACCACAATCAGATTAATTTTTAGTTTTTAGTCATCTCATTGATGCTACAATTTGATGGCTTCTGA

[0050] In Seq ID No:1, the underlined site is the C / T mutation site. The sequencing peaks of CC, TT, and CT genotypes are shown in Figure 1. Figure 2 shown.

[0051] (6) The distribution of egg production of different genotypes at this locus in L3 laying hens was statistically analyzed, and the results are shown in Table 1. As shown in Table 1, the CC homozygous genotype is the dominant genotype, with 95.92 eggs produced at 40 weeks of age, which is 6.72 and 6.07 more than the TT and CT heterozygous genotypes, respectively.

[0052] Table 1 Differences in egg production among different genotypes with mutations at position 1141 in the CDS region of the ERα gene

[0053]

[0054] Note: Different lowercase letters indicate significant differences (P<0.05).

[0055] (7) Egg production selection: During the egg production selection breeding process, the CC genotype is retained and the TT and CT genotypes are eliminated.

[0056] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0057] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0058] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A SNP molecular marker associated with egg production in chickens, characterized in that: The SNP molecular marker is located at the 1141th position of the cDNA sequence of the ERα gene in the chicken genome, corresponding to the 136th bp position in the sequence shown in SEQ ID NO. 1, where the base is C or T.

2. Use of a SNP molecular marker associated with chicken egg production as claimed in claim 1 in genetic breeding for improving chicken egg production performance.

3. A method for early selection of the egg production trait of chickens, characterized in that: The early selection method comprises performing early selection on the chicken egg production trait based on the genotype of a SNP molecular marker associated with the chicken egg production as described in claim 1.

4. The early selection method for the egg production trait of chickens according to claim 3, characterized in that: The early selection method specifically includes: Detecting the genotype of the SNP molecular marker in the chicken genome to be tested; Performing early selection on the egg production trait of the chicken to be tested based on the genotype of the SNP molecular marker; The number of eggs laid by the CC genotype group marked by the SNP molecule is greater than that of the TT or CT genotype group. The CC genotype group is retained during the early selection process, and the TT and CT genotype groups are eliminated.

5. The early selection method for the egg production trait of chickens according to claim 4, characterized in that: The detecting the genotype of the SNP molecular marker in the chicken genome to be tested specifically includes: PCR amplification of the chicken genomic DNA was performed using primers F and R; Sequencing the PCR amplification product to obtain the genotype of the SNP molecular marker in the chicken genome to be tested; Wherein, the nucleotide sequence of the primer F is shown as SEQ ID NO.2, and the nucleotide sequence of the primer R is shown as SEQ ID NO.

3.

6. Use of a detection primer for a SNP molecular marker associated with the egg production number of a chicken as claimed in claim 1 in genetic breeding for improving the egg production performance of chickens.

7. The use according to claim 6, characterized in that The detection primers include primer F and primer R. The nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.

3.

8. Use of a detection kit for SNP molecular markers related to chicken egg production as claimed in claim 1 in genetic breeding for improving chicken egg production performance.

9. The use according to claim 8, characterized in that The detection kit comprises primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) genetic marker for influencing later laying number of chickens and application thereof

    CN116083597A

  • Molecular Marker for Identifying Poultry Laying Traits Based on OVR Gene and Identification Method and Application Thereof

    US20230193404A1