SNP (Single Nucleotide Polymorphism) molecular marker closely related to beef quality traits
By developing SNP molecular markers closely related to beef meat quality traits, utilizing the G/C mutation at 88 bp of the ChREBP gene, and designing specific primer pairs for PCR amplification and sequencing, the problem of low efficiency in meat quality trait selection in beef cattle breeding was solved, and efficient meat quality trait improvement was achieved.
Patent Information
- Application Number
- CN202510989242.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-09-19
AI Technical Summary
Existing technologies lack molecular markers that are closely linked to meat quality traits in beef cattle breeding, resulting in low efficiency and accuracy of traditional phenotypic selection, making it difficult to achieve efficient improvement of meat quality traits.
SNP molecular markers closely related to beef quality traits were developed. The G/C mutation at 88 bp of the ChREBP gene was used to design specific primer pairs for PCR amplification and sequencing to screen cattle herds with high meat brightness or low cooking loss.
Through SNP molecular marker screening, the accuracy and efficiency of meat quality trait selection have been significantly improved, achieving the breeding goal of high-quality beef cattle.
Smart Images
Figure CN120666049A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biological detection, and in particular relates to a SNP molecular marker, a primer pair, a kit and applications thereof that are closely related to beef quality traits. Background Art
[0002] Beef is rich in protein, iron, zinc, B vitamins, and essential polyunsaturated fatty acids, making it a high-quality source of nutrition for humans. With the rapid growth of per capita beef consumption in China, the domestic consumption gap is also widening. This trend is driving a growing demand for diverse beef cattle breeds and high-quality, premium beef.
[0003] Single nucleotide polymorphisms (SNPs) refer to alleles at the same locus that differ by only a few nucleotides, or by small insertions or deletions. By detecting differences in single nucleotides at the molecular level, SNP markers can help distinguish genetic differences between two individuals. Their abundance, wide distribution, high stability, high throughput, and ease of automated detection enable more precise mapping of genetic diversity between individuals. SNP molecular markers are a highly effective and widely used molecular genetic marker in animal genetics and breeding.
[0004] Beef quality traits are controlled by multiple genes with small effects, and these traits are quantitative traits. Traditional phenotypic selection in animal breeding suffers from low efficiency and limited accuracy. Therefore, candidate gene methods have become crucial for the use of genetic markers in livestock selection, helping to understand the genetic basis of growth traits. However, most genes are ineffective in assisting breeding selection, and there is still a lack of molecular markers that are tightly linked to different meat quality traits and are highly operational to assist in beef cattle quality breeding. Therefore, further development of SNP molecular markers that regulate beef quality traits is needed. Summary of the Invention
[0005] In view of the above technical problems, the present invention provides a SNP molecular marker closely related to beef meat quality traits, which can be used to selectively breed high-quality beef cattle.
[0006] The specific technical solutions provided by the present invention are as follows: In a first aspect, the present invention provides a SNP molecular marker closely related to beef quality traits. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide shown in SEQ ID NO.1 undergoes a G / C mutation at the 88th bp.
[0007] In a second aspect, the present invention provides a primer pair for specifically amplifying the molecular marker according to claim 1, comprising a forward primer and a reverse primer. Forward primer: 5′-GTCACCGGTAAGACAGC-3′; Reverse primer: 5′-GTCACCGGTAAGACAGC-3′.
[0008] In a third aspect, the present invention provides a kit for detecting the molecular marker according to claim 1, comprising the primer pair, a premixed Taq enzyme system, and deionized water.
[0009] In a fourth aspect, the present invention provides a use of the molecular marker, the primer pair or the kit in screening beef quality traits.
[0010] As a preferred embodiment of the present invention, the meat quality trait is beef color brightness trait or beef cooking loss trait.
[0011] As a preferred embodiment of the present invention, when the genotype of the molecular marker at position 88 from the 5' end is GG, the meat color brightness of the beef is higher and the cooking loss is lower than when the genotype of the site is GC.
[0012] A fifth aspect of the present invention provides a method for screening beef color brightness traits, comprising the following steps: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The amplified products were sequenced and then genotyped. The meat color brightness of individuals with GG genotype was higher than that of individuals with GC genotype.
[0013] A sixth aspect of the present invention provides a method for screening beef cooking loss traits, comprising the following steps: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The amplified products were sequenced and then genotyped. The boiling loss of individuals with GC genotype was higher than that of individuals with GG genotype.
[0014] As a preferred embodiment of the present invention, the PCR reaction program is: pre-denaturation at 94-95°C for 5 min to 5 min 30 s; denaturation at 94°C for 30 s, annealing at 55-57°C for 30-45 s, extension at 70-75°C for 30-45 s, 30-40 cycles, and holding at 70-75°C for 10 min.
[0015] As a preferred embodiment of the present invention, the PCR amplification system is 25 μL: 2×Taq PCR Master mix 12.5 μL, DNA template 2 μL, upstream and downstream primers 1 μL each (100 ng / μL), and deionized water 8.5 μL.
[0016] As a preferred embodiment of the present invention, the beef comes from Wandong cattle, Wannan cattle, Dabie Mountain cattle, Dongliu buffalo or Jianghuai buffalo.
[0017] More preferably, the beef comes from Dabie Mountain cattle.
[0018] Compared with the prior art, the beneficial effects of the present invention are: The present invention uses DNA sequencing technology to analyze the genetics of five local cattle breeds in Anhui Province. ChREBP Gene polymorphism analysis revealed that: ChREBP The SNP site screened at exon 9 of the gene is g.52468G>C 。 The least squares linear model was further used to fit the Dabie Mountain cattle. ChREBP The association analysis between gene polymorphic sites and meat quality traits showed that: ChREBP The GG genotype had a significantly higher meat color brightness (L*) than the GC genotype at the gene g.52468G>C locus, and the cooking loss of the GC genotype was significantly higher than that of the GG genotype, indicating that the g.52468G>C locus can be used as a molecular marker for breeding cattle with high meat color brightness traits or low cooking loss traits. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is the result of genomic DNA extraction; Figures 2 - 5 They are ChREBP Results of 1.5% agarose gel electrophoresis of the PCR amplification products of the gene with 8 primer pairs; Figure 6 yes ChREBP Gene sequencing analysis results. DETAILED DESCRIPTION
[0020] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.
[0021] Meat quality evaluation indicators include color, pH, water holding capacity, drip loss, marbling, and cooking loss. Color is a key factor influencing the sales of fresh beef. Consumers typically consider bright red or cherry red colors to be indicative of freshness. Cooking loss, on the other hand, affects the taste of beef. Therefore, color and cooking loss are crucial indicators for determining meat quality.
[0022] The present invention provides a SNP molecular marker closely associated with beef quality traits. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1. The nucleotide sequence shown in SEQ ID NO. 1 undergoes a G / C mutation at bp 88. When the genotype at the mutation site is GG, the meat color brightness of the individual is significantly higher than that of the genotype GC. Furthermore, when the genotype GC is present, the cooking loss of the individual is significantly higher than that of the genotype GG.
[0023] Example 1 Anhui local breed cattle ChREBP Genetic diversity analysis 1. Test materials 1.1 Experimental Animals A total of 286 individuals from five local cattle breeds in Anhui Province (Wandong cattle, Wannan cattle, Dabieshan cattle, Dongliu buffalo, and Jianghuai buffalo) were sampled using a random representative sampling method. Detailed information is shown in Table 1.
[0024] Table 1 Sample information of five local cattle breeds in Anhui Province 1.2 Preparation of main reagents and solutions (1) Main reagents Chloroform, isoamyl alcohol, double-distilled water (ddH2O), anhydrous ethanol, and ultrapure water (DI) were all provided by the university laboratory. DNA Marker (DL2000), 6x Loading Buffer, and 2× Taq PCR Master Mix were purchased from Sangon Biotech (Shanghai) Co., Ltd.; agarose was purchased from Mona Biotechnology Co., Ltd.; nucleic acid stain was purchased from Sevier Biotechnology Co., Ltd.; and a blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.
[0025] (2) Preparation of reagents A: PBS buffer: NaCl 8 g, KCl 0.2 g, Na2HPO4·12H2O 3.58 g, KH2PO4 0.27 g, add ddH2O to 1 L, adjust the pH to 7.4, sterilize by autoclaving, and store at 4°C.
[0026] B: 50× TAE: Place 242 g of Tris and 100 mL of 0.5 mol / L EDTA in a 1 L beaker. Add 800 mL of ddH2O and stir thoroughly. Then, add 57.1 mL of glacial acetic acid and continue stirring. Finally, add enough deionized water to bring the total volume to 1 L.
[0027] C: 1×TAE electrode buffer: 20 mL 50×TAE, dilute to 1 L with 980 mL distilled water.
[0028] D: 1.5% agarose gel electrophoresis: Add 1.5g agarose to 100mL 1×TAE and heat in a microfuge until melted. When it cools to the touch, add 5µL nucleic acid dye and mix well.
[0029] 1.3 Main instruments The main instruments and equipment required for the present invention are shown in Table 2 below.
[0030] Table 2 Main instruments and equipment 2. Test methods 2.1. Blood sample collection Jugular vein blood was collected from five breeds of cattle in Anhui Province and placed in EDTA anticoagulant tubes. The blood was placed in an insulated box with crushed ice and brought back to the laboratory for storage at -20°C.
[0031] 2.2 Extraction of genomic DNA Genomic DNA was extracted from the blood of 286 cattle using an animal blood genomic DNA extraction kit. Specific steps were followed according to the kit instructions.
[0032] 2.3. Genomic DNA concentration and purity detection The DNA concentration was detected by Nanodrop one ultra-micro spectrophotometer. 260 : A 280 The range was 1.7 to 1.9, and then its integrity was further verified. 2 μL of DNA template was mixed with 3 μL of 6× Loading Buffer and tested by 1.5% agarose gel electrophoresis. If qualified, it was stored at -20°C until use.
[0033] 2.4 Primer design and synthesis According to the NCBI database ChREBP The gene (ID: 788534) sequence was analyzed. Primerpremier 5.0 software was used to design eight pairs of primers (C1–C8) targeting the exon and partial intron regions of the gene. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Details are shown in Table 3.
[0034] Table 3 Anhui local cattle breeds ChREBP Gene primer information Note: E: exon; i: intron 2.5 PCR amplification and sequencing The PCR amplification system consisted of 25 μL of the following: 12.5 μL of 2× Taq PCR Master Mix, 2 μL of DNA template, 1 μL of each upstream and downstream primer (100 ng / μL), and 8.5 μL of deionized water. Amplification conditions were as follows: 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing for 30 s (see Table 3 for annealing temperatures), and extension at 72°C for 30 s; a total extension at 72°C for 10 min, and storage at 4°C until use. PCR amplification products were checked by 1.5% agarose gel electrophoresis and sent to Universal Biosystems (Anhui) Co., Ltd. for sequencing.
[0035] 3. Data Analysis 3.1 Genotype frequency and allele frequency Genotype frequency = number of genotyped individuals / total number of measured populations Allele frequency = allele frequency in a population divided by allele frequency Pi: frequency of the i-th allele; i: homozygous multiple allele i1, j2, ... jn: the 1st to nth alleles codominant with i 3.2 Hardy-Weinberg equilibrium test Hardy-Weinberg equilibrium is the genotypic frequency state of the two alleles at an autosomal gene locus after random mating in an infinite population.
[0036] Where: Ei represents the theoretical value, Oi represents the actual observed value, and n represents the number of alleles.
[0037] 3.3 Genetic homozygosity Ho ) Ho Indicates the degree of purity of a specific allele in a population. Its calculation formula is:
[0038] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.
[0039] 3.4. Heterozygosity He ) He It is the proportion of heterozygotes in a population at a certain locus, which measures the information content of the marker method. The calculation formula is:
[0040] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.
[0041] 3.5. Effective number of alleles Ne ) Ne It is also an indicator of the size of the genetic variation in a population and is expressed as the reciprocal of homozygosity. If the alleles in a population are more evenly distributed, the effective number of alleles will be closer to the actual number of alleles detected.
[0042] Where: i is the i-th allele; pi is the frequency of the i-th allele; n is the number of alleles.
[0043] 3.6、Polymorphic Information Content( PIC ) Polymorphism Information Content PIC ) value is calculated based on the frequency of its allele in a population, indicating the high or low polymorphism of the site.
[0044] Where: pi and pj are the frequencies of the ith and jth alleles respectively; n is the number of alleles. PIC >0.5, highly polymorphic; 0.25< PIC When <0.5, it is moderately polymorphic; PIC When <0.25, it is low polymorphism.
[0045] 3.7 Data Analysis Software Sequencing results were compared with reference sequences using DNAman software to screen for SNPs. Chromas software was used to analyze peaks in the sequencing results and further verify the identified SNPs.
[0046] 4. Results and Analysis 4.1. Genomic DNA quality testing The quality of the extracted genomic DNA was detected by NanoDrop One ultra-micro spectrophotometer, and the ratio A260 / A 280 The DNA was analyzed by 1.5% agarose gel electrophoresis. The results are shown in Figure 1. The bands were bright and clear, with no tailing, and the integrity of the bands was good. These results indicate that the extracted DNA quality meets the requirements of subsequent experiments.
[0047] 4.2. Anhui local cattle breeds PPARG Genetic diversity analysis of genes 4.2.1、 ChREBP Quality testing of gene PCR amplification products ChREBP The results of agarose gel electrophoresis of the PCR amplified products were shown in Figures 2 - 5 Amplification ChREBP The eight pairs of primers for the gene had good specificity, no dimers, and the amplified bands were bright, clear, and single. The fragment sizes were in line with expectations and could be sequenced directly.
[0048] 4.2.2、 ChREBP Analysis of gene sequencing results The expanded population of five local cattle breeds in Anhui ChREBP Sequencing of some exons of the gene ChREBP The gene sequencing results were compared with the cattle sequence published by NCBI. As shown in Figure 6, the SNP site discovered is g.52468G>C in exon 9.
[0049] The nucleotide sequence of the molecular marker containing the SNP site is shown in SEQ ID NO.1: GTCACCGGTAAGACAGCGGGCACTGGGAGGTGGGACTGCACCCCAGGCCTTCACCCCGACTCTCTGCCCTTCTCCACCTCAGCAGGASACTCTCCCCGAGTTCCCCTGCACCTTCTTTCCCCCGACCCCGGCC CCCACAACCACCCCGACTGCCTCCGGGCTCGGCCACCCCGGCCCCTCCCAGGCCCCTGATTGTCCCCAAAGTGGAGCGGCTCTCGCCCCCAGCGCCCAGCGGTAAAGAGGGGTTGAAGGAGC, where S is base G or base C.
[0050] 4.2.3 Anhui Local Cattle Breeds ChREBP Analysis of population genetic structure of genes (1) ChREBP Genetic polymorphism analysis of exon 9 Five local cattle breeds in Anhui ChREBP The gene and genotype frequencies of the variant site in exon 9 of the gene were analyzed (Table 4). Three genotypes were detected at the g.52468G>C locus: GG, GC, and CC. The CC genotype was not detected in any of the three common cattle populations. In all three common cattle populations, the GG genotype was the dominant genotype, with the G allele frequency exceeding that of the C allele, making it the dominant allele. In the two buffalo populations, the CC genotype frequency was slightly higher than that of the GG and GC genotypes, making CC the dominant genotype, and the C allele frequency exceeding that of the G allele, making it the dominant allele.
[0051] Ne, He, PIC, and Hardy-Weinberg equilibrium were calculated based on gene and genotype frequencies (Table 5). At the g.52468G>C locus, Ne was highest in Jianghuai buffalo, at 1.600. Homozygosity was higher than heterozygosity in all loci. Polymorphic information content was moderate in Jianghuai buffalo (0.25 < 0.000). PIC <0.5), and the other four populations were all low polymorphic ( PIC <0.25). The g.52468C>T locus was in Hardy-Weinberg equilibrium in all five cattle populations ( P >0.05).
[0052] Table 4 Anhui local cattle breeds ChREBP Gene exon 9 gene and genotype frequencies Table 5 Anhui local cattle breeds ChREBP Genetic variation parameters of exon 9 Example 2 Dabie Mountain Cattle ChREBP Correlation analysis between gene polymorphism and meat quality 1. Experimental materials and methods 1.1 Sample Collection Fifty-six healthy, disease-free, fattened Dabie Mountain cattle of similar weight, aged 24 to 30 months, were selected (Jiuhong Agricultural Comprehensive Development Co., Ltd., Taihu County, Anqing City). They were prohibited from feeding 24 hours before slaughter and underwent a health inspection. A 10 mL blood sample was collected. After slaughter, 500 g of the longissimus dorsi muscle from the 12th and 13th thoracic vertebrae was removed, washed with saline to remove blood, and stored at -20°C until further use.
[0053] 1.2 Determination of beef quality Meat color: The cross-section of the longissimus dorsi muscle was exposed to air oxygenation for 40 minutes. The color difference was measured using a Canon CR-S400w handheld colorimeter. The brightness (L*), redness (a*), and yellowness (b*) of the longissimus dorsi muscle were measured three times for each sample, and the average value was used for analysis.
[0054] Cooking loss: After removing the connective tissue and fat on the surface of the muscle, cut it into slices approximately 2 cm thick and weigh them (recorded as W1). Place the meat in a high-temperature resistant vacuum bag and insert a thermometer into the center of the muscle, seal the bag tightly to avoid contact with the outside world. Subsequently, place the high-temperature resistant vacuum bag in a constant temperature water bath at 80°C and heat it until the core temperature of the meat sample reaches 70°C. Then remove the meat sample from the water bath and let it cool naturally at room temperature. Then use absorbent paper to gently absorb the moisture on the surface of the meat sample and weigh it (recorded as W2). Calculation formula:
[0055] Cooking loss (%) = (W1-W2) / W1×100% Crude fat: The fat content of the longissimus dorsi muscle of Dabie Mountain cattle was determined by Soxhlet extraction according to GB / T5009.6-2003 “Determination of fat in foods”.
[0056] Drip loss: Remove the surrounding sarcolemma from the meat sample and cut it into approximately 5 cm × 3 cm × 2 cm samples along the muscle fibers. Take three pieces of each meat sample and record the weight (m1). Bend a wire into a hook, hook one end, and place it in an air-filled plastic bag to prevent it from falling and contacting the plastic bag. Hang the meat sample in a refrigerator at 4°C for 24 hours. Afterwards, remove the plastic bag, gently wipe the surface of the meat sample with filter paper to remove any liquid, and reweigh it (m2). Calculate using the following formula:
[0057] Drip loss (%) = (m1-m2) / m1×100% Shear force: Cook the meat sample in a water bath preheated to 80°C. Continue heating until the center temperature reaches 70°C. Remove the sample and allow it to cool to room temperature. Ten cylindrical specimens with a diameter of 1.27 cm are removed from the meat along the muscle fiber. Shear force is measured using a tenderizer, and the average shear force value is calculated.
[0058] Water loss rate: Cut the meat sample into 2cm chunks, weigh this portion and record it as W1, then wrap it in gauze. Next, place the wrapped meat sample between two layers of filter paper (18 in total). Place the meat sample on a pressure gauge and apply 25kg of pressure for 5 minutes before removing the pressure. Reweigh the meat sample and record it as W2. Subtract the weight after pressure application (W2) from the weight before pressure application (W1). The difference is the water loss of the meat sample. Calculation formula:
[0059] Water loss rate (%) = (W1-W2) / W1 × 100% pH: Insert the electrode of the pH meter into the meat sample and perform three replicate measurements on each meat sample. Calculate the average of these three measurements as the pH value of the meat sample.
[0060] 2. Data Analysis 2.1 Statistical Analysis Model The GLM (General Linear Model) procedure in SAS software, combined with a least squares analysis of variance model, was used to compare the differences in meat quality traits between different genotypes. Finally, significance tests and multiple comparisons were performed on the meat quality traits between different genotypes, and the results are presented as mean ± standard deviation.
[0061] The statistical model is: Yij=μ+GENi+GROj+eij Yij is the phenotypic value of a certain trait of an individual; μ is the population mean; GENi is the genotype effect; GROj is the group effect; and eij is the random error.
[0062] 3. Results and Analysis Using SAS software to ChREBP The correlation analysis between the genotype of the polymorphic loci and nine indicators of Dabieshan cattle, including intramuscular fat, shear force, drip loss, pH, and water holding capacity, was conducted (Table 6). At the g.52468G>C locus, the GG genotype was significantly higher than the GC genotype in meat color brightness (L*). P <0.05), the cooking loss of GC genotype was significantly higher than that of GG genotype ( P <0.05).
[0063] Table 6 ChREBP Association analysis between gene SNPs and beef quality in Dabie Mountains Note: When comparing different genotypes at the same locus, data with different lowercase letters indicate significant differences ( P<0.05), different capital letters indicate extremely significant differences ( P <0.01).
[0064] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. A SNP molecular marker closely related to beef meat quality traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 has a G / C mutation at the 88th bp.
2. A primer pair for specifically amplifying the molecular marker according to claim 1, characterized in that: It includes a forward primer and a reverse primer. Forward primer: 5′-GTCACCGGTAAGACAGC-3′; Reverse primer: 5′- GCTCCTTCAACCCCTCT -3′.
3. A kit for detecting the molecular marker according to claim 1, characterized in that: The method comprises the primer pair according to claim 2, a premixed Taq enzyme system, and deionized water.
4. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in screening for beef quality traits.
5. The use according to claim 4, characterized in that The meat quality trait is the beef color brightness trait or the beef cooking loss trait.
6. The use according to claim 5, characterized in that When the genotype of the molecular marker at position 88 from the 5' end is GG, the brightness of beef color is higher and the cooking loss is lower than when the genotype of the site is GC.
7. A method for screening beef color and brightness traits, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The amplified products were sequenced and then genotyped. The meat color brightness of individuals with GG genotype was higher than that of individuals with GC genotype.
8. A method for screening beef cooking loss traits, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The amplified products were sequenced and then genotyped. The boiling loss of individuals with GC genotype was higher than that of individuals with GG genotype.
9. The method according to claim 7 or 8, characterized in that The PCR reaction program was as follows: pre-denaturation at 94-95°C for 5 min to 5 min 30 s; denaturation at 94°C for 30 s, annealing at 55-57°C for 30-45 s, extension at 70-75°C for 30-45 s, 30-40 cycles, and holding at 70-75°C for 10 min.
10. The method according to claim 7 or 8, characterized in that The beef comes from Wandong cattle, Wannan cattle, Dabie Mountain cattle, Dongliu buffalo or Jianghuai buffalo.