Real-time fluorescent PCR (polymerase chain reaction) kit for rapidly detecting lip flagellates and application of real-time fluorescent PCR kit

Abstract

The invention discloses a real-time fluorescent PCR (polymerase chain reaction) kit for rapidly detecting lip flagellates and application thereof, and relates to the technical field of biology, the kit comprises a forward primer, a reverse primer and a Taqman probe for detecting the specificity of the lip flagellates, a positive control, a negative control, Premix Ex Taq and PCR water; the sequence of the forward primer is as shown in SEQ ID No. 1, and the forward primer is 5 '-CGGAAGGAGATCACACCTC-3'; the sequence of the reverse primer is as shown in SEQ ID No. 2; the sequence of the reverse primer is as shown in SEQ ID No.2, and the sequence of the reverse primer is 5 '-GTGGTGCCTTCCGTCAATTCC-3'; the sequence of the probe is as shown in SEQ ID No.3, and the sequence of the probe is 5 '-CAGGTTACGGGGGGAGTATGG-3'; through standard sample nucleic acid extraction, accurate reaction system preparation, a reasonable fluorescent PCR amplification procedure and a strict result judgment and report process, the accuracy and reliability of a detection result are ensured, timely and effective technical support is provided for experimental animal health monitoring and the like, lip flagellate infection can be found and controlled in time, and the method is suitable for clinical application and popularization. The quality of experimental animals and the smooth proceeding of related researches are ensured.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a real-time fluorescent PCR kit for rapidly detecting Labioflagellate genus and application thereof. Background Art

[0002] In the fields of biomedical research and experimental animal husbandry, accurate detection of pathogenic microorganisms is a key link in ensuring the reliability of experimental results and animal health. As a common parasitic protozoan, Giardia spp. mainly parasitizes the cecum of rodents. Its infection may not only have a significant impact on the behavioral patterns and immune status of experimental animals, especially in immunocompromised animals, but also may cause pathological symptoms such as diarrhea, thereby interfering with the accuracy and reproducibility of experimental data. With the continuous improvement of the quality standards of experimental animals, the national standard SPF-level experimental animals have listed flagellates as a mandatory inspection item, highlighting the importance of rapid and accurate detection of Giardia spp.

[0003] Although real-time fluorescence PCR technology has shown great potential in pathogen detection, specific detection methods for the genus Labialegles have long been blank. Traditional microscopy, as the current main detection method, can directly observe the morphological characteristics of pathogens, but has disadvantages such as cumbersome procedures, complex operations, and long time consumption. In addition, the genus Labialegles has a high morphological similarity with other genera of the family Spirochaetaceae, which makes traditional microscopy face huge challenges in distinguishing different genera and species, and easily leads to misdiagnosis or missed diagnosis. In addition, the sensitivity of microscopy is relatively low, and its ability to detect low-concentration infected samples is limited, which makes it difficult to meet the high requirements of modern biomedical research for detection accuracy and efficiency.

[0004] Therefore, it is particularly urgent to develop a rapid, specific and sensitive real-time fluorescence PCR detection method for the genus Labialegles. Summary of the Invention

[0005] The purpose of the present invention is to make up for the deficiencies of the existing technology and provide a real-time fluorescent PCR kit for rapid detection of the genus Labialegles and its application. The kit can specifically identify the nucleic acid sequence of Labialegles through carefully designed specific primers and probes, thereby ensuring the accuracy of detection. In terms of the composition of the kit, in addition to specific primers and probes, it also contains key components such as positive controls and negative controls, which provide a reliable basis for the determination of experimental results. At the same time, the present invention also elaborates on the application method of the kit, including specific technical solutions such as sample nucleic acid extraction, reaction system preparation, fluorescent PCR amplification, result validity determination, and result determination and reporting. These technical solutions cooperate with each other to form a complete and standardized detection process, ensuring the efficiency of the detection process and the reliability of the results.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions: On the one hand, a real-time fluorescent PCR kit for rapid detection of Labialegles, the kit comprising the following components: a forward primer, a reverse primer and a Taqman probe specific for detecting Labialegles, a positive control, a negative control, Premix Ex Taq and PCR water;

[0007] The sequence of the forward primer is shown in SEQ ID No. 1, which is 5'-CGGAAGGAGATCAGACACCTC-3'; the sequence of the reverse primer is shown in SEQ ID No. 2, which is 5'-GTGGTGCCCTTCCGTCAATTCC-3';

[0008] The sequence of the Taqman probe is shown in SEQ ID No. 3, which is 5'-CAGGTTACGGGGGGAGTATGG-3', and the 5' end is connected to a fluorescent light-emitting group, and the 3' end is labeled with a quenching group;

[0009] The positive control is a recombinant plasmid, and the plasmid sequence is shown in SEQ ID No. 4, which is cggaaggagatcagacacctccgtattcccaaccataaacgatgccatctagggattgggcgagcccatatttc ctagaactccctcaggacctttcgagaaatcataagaattcaggttacggggggagtatggtcgcaaggcagaaacttaaaggaattgacggaagggcaccac;

[0010] The negative control was ddH2O.

[0011] Furthermore, the 5'-end-connected fluorescent light-emitting group includes one of FAM, VIC, HEX, JOE, ROX, Texas-Red, and Cy5; and the fluorescent quenching group includes one of DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, and BHQ-3.

[0012] On the other hand, a real-time fluorescent PCR kit for rapid detection of Labialegles is provided, wherein the method for using the kit is as follows:

[0013] Sample nucleic acid extraction: Using clinical sample nucleic acid extraction technology, through cell lysis, nucleic acid isolation and purification steps, to obtain high-quality DNA template;

[0014] Reaction system preparation: In an ice bath, accurately mix the DNA template, specific primers, Taqman probe, DNA polymerase, and reaction buffer components in a specific ratio to construct the reaction system;

[0015] Fluorescence PCR amplification: Place the prepared reaction system in a real-time fluorescence PCR instrument, perform temperature cycling to achieve exponential amplification of the target nucleic acid, and monitor the changes in the fluorescence signal in real time;

[0016] Validity of the results: Based on the amplification curve characteristics of the positive and negative controls, establish judgment criteria to ensure that the experimental process is free of contamination and the reaction system is operating normally, and to exclude false positive or false negative results;

[0017] Result determination and reporting: Based on the cycle threshold and fluorescence intensity changes of the sample amplification curve, determination rules are formulated to distinguish positive, negative and suspicious results, and suspicious samples are repeatedly verified, and a standardized test report is issued.

[0018] Furthermore, in the sample nucleic acid extraction step, a column extraction method is used for DNA extraction of fecal and environmental swab samples. The sample is mixed with a lysate to destroy the cell structure and release the nucleic acid. The nucleic acid is adsorbed on a silica gel membrane by centrifugation or vacuum filtration. The protein and salt impurities are then removed by washing solution, and the DNA is eluted from the silica gel membrane with an eluent. After the extraction is completed, a micro-spectrophotometer is used to measure the nucleic acid concentration and purity at wavelengths of 260nm and 280nm, so that the OD260 / OD280 ratio is between 1.8-2.0. The extracted DNA is stored at -20°C for future use.

[0019] Furthermore, in the reaction system preparation step, a 20 μL reaction system is prepared under ice bath conditions. Specifically, 5 μL of extracted DNA template is added to a reaction tube, and 10 μL of 2×Premix Ex Taq, 0.2 μL of a forward primer with a concentration of 20 μmol / L, 0.2 μL of a reverse primer with a concentration of 20 μmol / L, and 0.2 μL of a Taqman probe with a concentration of 20 μmol / L are added in sequence, and ddH2O is used to make up to 20 μL. During the preparation process, a pipette is used to accurately measure each component, and after adding, the components are thoroughly vortexed and mixed. The reaction solution is then centrifuged briefly to allow the liquid to accumulate at the bottom of the tube. The reaction solution is then dispensed into fluorescent quantitative PCR reaction tubes, and the tube caps are tightly closed to prevent liquid evaporation during the reaction.

[0020] Furthermore, in the fluorescent PCR amplification step, the packaged reaction tubes are placed in a fluorescent quantitative PCR instrument and pre-denatured at 95°C for 30 seconds to fully unwind the double-stranded DNA and enter the cycling stage. Each cycle includes denaturation at 95°C for 5 seconds to unwind the double-stranded DNA into a single strand, and annealing and extension at 60°C for 34 seconds. At this time, the primers bind to the single-stranded DNA template, and the Taq enzyme synthesizes a new DNA chain using dNTP as a raw material. At the same time, the probe hybridizes with the template. Under the action of the 5'-3' exonuclease activity of the Taq enzyme, the probe is cut, the fluorescent light-emitting group is separated from the quenching group, and a fluorescent signal is released. The instrument collects fluorescence at this stage. This cycle is repeated 40 times to complete the entire amplification process.

[0021] Furthermore, in the step of determining the validity of the results, the amplification results of the positive control and the negative control are analyzed. The amplification curve of the positive control should be "S"-shaped, and the Ct value (cycle threshold) should be less than 35, indicating that the target nucleic acid in the positive control is effectively amplified and the reaction system and conditions are normal. The negative control and the blank control have no amplification curve, that is, the Ct value is not displayed or is greater than 40, indicating that the reaction system is not contaminated and there is no nonspecific amplification. When the results of the positive control and the negative control meet the determination conditions at the same time, the experimental results are judged to be valid. Otherwise, the experimental process needs to be checked and the experiment needs to be repeated.

[0022] Furthermore, in the result determination and reporting step, for the test sample, the result is determined according to the Ct value. If the Ct value of the sample is less than 35, it is directly determined that the lip flagellate nucleic acid is detected, and the result is positive. If the Ct value is greater than 35.0 and less than or equal to 40.0, it is determined to be a suspicious result. At this time, the experiment needs to be repeated, or the sample is re-extracted for repeated well detection. If the Ct value is still less than or equal to 40.0 after repeated detection, it is determined that the lip flagellate nucleic acid is detected, and the result is positive. If the Ct value is greater than 40.0 after repeated detection, it is determined that the lip flagellate nucleic acid is not detected, and the result is negative. For samples determined to be positive, the amplification product is further sequenced, and the sequencing results are compared with the known lip flagellate sequences to verify the accuracy of the test results.

[0023] Compared with the existing technology, the real-time fluorescent PCR kit for rapid detection of Labialegles and its application have the following beneficial effects:

[0024] 1. The present invention ensures the accuracy and reliability of the test results through standardized sample nucleic acid extraction, precise reaction system preparation, reasonable fluorescence PCR amplification procedure, and strict result judgment and reporting process, providing timely and effective technical support for experimental animal health monitoring, etc., helping to timely detect and control labial flagellate infection, ensuring the quality of experimental animals and the smooth progress of related research.

[0025] 2. The present invention sets strict requirements for positive controls and negative controls. Only when the results of both meet specific conditions at the same time, the experimental results are judged to be valid, which effectively avoids the occurrence of false positive or false negative results. In the result judgment and reporting process, suspicious results are repeatedly tested and verified by sequencing to further ensure the accuracy of the test results. In addition, repeatability tests show that the intra-batch and inter-batch coefficients of variation of this detection method are small, indicating that the method has good repeatability and high stability, and can provide a reliable detection means for research and application in related fields.

[0026] Other advantages, objects and features of the present invention will be described in part in the following description and, in part, will be apparent to those skilled in the art based on an examination of the following or may be learned from the practice of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.

[0028] Figure 1 This is a schematic diagram of the real-time fluorescence PCR amplification of Labial Flagellates;

[0029] Figure 2 Schematic diagram of the fluorescence quantitative amplification curve (top) and the standard curve (bottom) of 10-fold serial dilution standard nucleic acid;

[0030] Figure 3 The figure is a flow chart of the application method of a real-time fluorescence PCR kit for rapid detection of Labioflagellate genus. DETAILED DESCRIPTION

[0031] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0032] Example 1

[0033] A real-time fluorescent PCR kit for rapid detection of Labialegles, comprising the following components: a forward primer, a reverse primer and a Taqman probe specific for detecting Labialegles, a positive control, a negative control, Premix Ex Taq and PCR water;

[0034] The sequence of the forward primer is shown in SEQ ID No. 1, which is 5'-CGGAAGGAGATCAGACACCTC-3'; the sequence of the reverse primer is shown in SEQ ID No. 2, which is 5'-GTGGTGCCCTTCCGTCAATTCC-3';

[0035] The sequence of the Taqman probe is shown in SEQ ID No. 3, which is 5'-CAGGTTACGGGGGGAGTATGG-3', and the 5' end is connected to a fluorescent light-emitting group, and the 3' end is labeled with a quenching group;

[0036] The positive control is a recombinant plasmid, and the plasmid sequence is shown in SEQ ID No. 4, which is cggaaggagatcagacacctccgtattcccaaccataaacgatgccatctagggattgggcgagcccatatttc ctagaactccctcaggacctttcgagaaatcataagaattcaggttacggggggagtatggtcgcaaggcagaaacttaaaggaattgacggaagggcaccac;

[0037] The negative control was ddH2O.

[0038] The performance of the kit was tested for specificity, sensitivity and repeatability.

[0039] For specific detection:

[0040] The four standard strains tested were Salmonella CICC21484, Pseudomonas aeruginosa CMCC(B)10104, Staphylococcus aureus CMCC(B)26003, and Escherichia coli CMCC44102. The five parasites with positive nucleic acids were Trichomonas, Giardia lamblia, Giardia lamblia, Hexaflagellate umbilical cord, and Giardia spp.

[0041] The developed real-time fluorescence PCR kit and detection method were used to test nucleic acids of four standard strains and five parasites to verify the specificity of the detection method.

[0042] For sensitivity testing:

[0043] The concentration of the standard nucleic acid of the recombinant plasmid of Labioflagellate was measured using a micro-spectrophotometer (20 ng / μL). The nucleic acid of Labioflagellate with known concentration was serially diluted to 5.78×10 9 -5.78×10 3The optimized reaction system and reaction procedure were used to determine the Ct values ​​of each dilution gradient. A standard curve was plotted with the Ct value as the ordinate and the logarithm of the starting template concentration as the abscissa. 5780 copies / mL and 2890 copies / mL standards were used as templates, and 20 aliquots of each were taken for qPCR detection. If the target nucleic acid was detected in more than 95% of the samples, this dilution was the detection limit of the real-time fluorescent PCR kit for Labioflagellate spp.

[0044] For reproducible experiments:

[0045] Test standard nucleic acid 5.78*10 6 copies / mL and 5.78*10 4 The determination of 10 copies / mL was repeated 10 times in the same reaction, and the Ct values ​​of each dilution gradient were statistically analyzed to calculate the intra-assay coefficient of variation (CV%) of each sample. The above samples diluted between batches were tested on 5 days, and the inter-group repeatability was evaluated in 5 different experiments. 5 replicates were performed in the same reaction, and the inter-assay coefficient of variation (CV%) of each measurement result for the same sample was calculated.

[0046] The standard nucleic acid of Labialis was used as a template, and specific primers and probes were used for amplification. A fluorescence quantitative kit (probe method) was used. The reaction system was 10 μL: 5 μL DNA template, 10 μL 2×Probeq PCRmix (containing Mg2+, dNTP, Taq enzyme), 0.2 μL upstream primer (20 μmol / L), 0.2 μL downstream primer (20 μmol / L), 0.2 μL probe (20 μmol / L), and H2O was added to 20 μL. The reaction conditions were: 95°C for 30 s, 95°C for 5 s, and 60°C for 34 s, for a total of 40 cycles. The analysis results showed that the amplification standard curve was "S-shaped" and no abnormalities such as tailing were observed (such as Figure 1 , thick lines are for flagellates).

[0047] The kit and detection method were used to identify the nucleic acids of 4 standard strains and 5 parasite samples. The results showed that except for the positive detection of the flagellate sample, the other bacteria and parasite items were negative, indicating that the real-time fluorescence PCR kit method has good specificity.

[0048] The Ct value of each dilution was determined using the optimal reaction system and conditions of the kit. The Ct value was plotted as the vertical axis and the logarithm of the initial template concentration as the horizontal axis to draw a standard curve. It can be seen that the Ct values ​​between each gradient are basically equal. The logarithm of the copy number of the standard dilution was used as the horizontal axis and the threshold cycle (Ct) was used as the vertical axis to establish a standard curve for fluorescent real-time quantitative PCR. The standard nucleic acid was at 5.78×10 4 -5.78×109 There is a good linear relationship between the copies / mL. The results of the gradient dilution amplification curve and the standard curve are shown in Figure 2 The linear regression equation of the kit method is y = -3.288x + 48.480, the slope of the standard curve is -3.288, the amplification efficiency is 101.4%, and the correlation coefficient R 2 =0.99, indicating that the efficiency of PCR amplification of the standard product is high and the linear relationship is good. The detection limit of the real-time fluorescence PCR method of the kit for testing the recombinant plasmid is 5.78×10 3 copies / mL, as shown in Table 1.

[0049] Table 1 Detection limit of recombinant plasmids tested by real-time fluorescence PCR method of the kit

[0050]

[0051]

[0052] By performing repeatability tests on standard nucleic acids of two dilution gradients of Labialegles, the coefficient of variation of the intra-batch repeat tests was less than 2%, as shown in Table 2, and the coefficient of variation of the inter-batch repeat tests was less than 1%, as shown in Table 3, indicating that the real-time fluorescence PCR detection method for Labialegles has good repeatability and is stable.

[0053] Table 2 Intra-batch repeatability test data and coefficient of variation of the detection method for Labioflagellate

[0054]

[0055] Table 3 Inter-batch repeatability test data and coefficient of variation of the detection method for Labioflagellate

[0056]

[0057]

[0058] Example 2

[0059] Twenty fecal samples of experimental animals (numbered 1-20) and two swab samples from the feeding environment (numbered 21-22) were collected. Column extraction was used for DNA extraction. The samples were mixed with lysis buffer to destroy the cell structure and release nucleic acids. The nucleic acids were adsorbed on the silica gel membrane by centrifugation or vacuum filtration. Protein and salt impurities were then removed with washing buffer, and the DNA was eluted from the silica gel membrane with eluent. After extraction, the nucleic acid concentration and purity were measured at wavelengths of 260 nm and 280 nm using a microspectrophotometer to keep the OD260 / OD280 ratio between 1.8 and 2.0. The extracted DNA was stored at -20°C for future use. After soaking, the environmental swab samples were subjected to DNA extraction according to the same process. All templates passed the nucleic acid concentration and purity tests and were used for future use.

[0060] Prepare a 20 μL reaction system under ice bath conditions. Specifically, take 5 μL of extracted DNA template and add it to the reaction tube. Then add 10 μL of 2×Premix Ex Taq, 0.2 μL of forward primer with a concentration of 20 μmol / L, 0.2 μL of reverse primer with a concentration of 20 μmol / L, and 0.2 μL of Taqman probe with a concentration of 20 μmol / L in sequence, and make up to 20 μL with ddH2O. During the preparation process, use a pipette to accurately measure each component. After adding, vortex thoroughly to mix. Centrifuge briefly to allow the liquid to accumulate at the bottom of the tube. Then, dispense the reaction solution into fluorescent quantitative PCR reaction tubes and cover the tubes tightly to prevent liquid evaporation during the reaction.

[0061] Place the packaged reaction tubes into a fluorescent quantitative PCR instrument and pre-denature at 95°C for 30 seconds to fully unwind the double-stranded DNA and enter the cycling stage. Each cycle includes denaturation at 95°C for 5 seconds to unwind the double-stranded DNA into a single strand, and annealing and extension at 60°C for 34 seconds. At this time, the primers bind to the single-stranded DNA template, and the Taq enzyme uses dNTP as raw material to synthesize a new DNA chain. At the same time, the probe hybridizes with the template. Under the action of the 5'-3' exonuclease activity of the Taq enzyme, the probe is cut, the fluorescent light-emitting group is separated from the quenching group, and the fluorescent signal is released. The instrument collects fluorescence at this stage. This cycle is repeated 40 times to complete the entire amplification process.

[0062] The positive control (recombinant plasmid) had a Ct value of 32.5, and the amplification curve showed a typical "S" shape; the negative control (ddH2O) had no amplification signal, and the experimental results were valid, as shown in Table 4:

[0063] Table 4 Application of the kit in clinical samples

[0064]

[0065]

[0066] For stool samples, 12 out of 20 were positive (numbers 1, 2, 3, 5, 6, 9, 12, 14, 15, 16, 17, and 21), with Ct values ​​ranging from 22.0 to 34.1. Among them, samples numbered 1, 5, 6, 9, 12, 15, 16, 17, and 21 were confirmed to be Chilomastix mesnili or Chilomastix caulleryi by sequencing.

[0067] For the environmental swab samples, one of the two samples was positive (No. 21, Ct=31.4), and the sequencing result was Chilomastix mesnili, while the other sample (No. 22) had no Ct value.

[0068] The total positive rate was 63.6% (14 / 22), of which the positive rate of stool samples was 65% (13 / 20) and the positive rate of environmental swabs was 50% (1 / 2).

[0069] Sanger sequencing was performed on 9 positive products (stool samples No. 1, 5, 6, 9, 12, 15, 16, 17 and environmental swab No. 21), and the sequences were aligned by NCBI Blast and showed:

[0070] Numbers 1, 5, 6, 9, 15, 16, 17, and 21 have a sequence identity of >92% with the Chilomastix mesnilismallsubunit ribosomalRNA gene;

[0071] The sequence identity of No. 12 and Chilomastix caulleryi was 92.2%, which was completely consistent with the test results of the kit.

[0072] In summary, the kit of the present invention showed high sensitivity and specificity in clinical sample detection, and could accurately distinguish different species of the genus C. mesnili (such as C. caulleryi). The positive detection of environmental swab samples showed that it is suitable for pollution monitoring of animal breeding environments, providing a reliable technical means for the prevention and control of parasites in experimental animals.

[0073] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents disclosed above. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A real-time fluorescent PCR kit for rapid detection of Labialegles, characterized in that: The kit includes the following components: a forward primer, a reverse primer and a Taqman probe specific for detecting labial flagellates, a positive control, a negative control, Premix Ex Taq and PCR water; The sequence of the forward primer is shown in SEQ ID No. 1, which is 5'-CGGAAGGAGATCAGACACCTC-3'; the sequence of the reverse primer is shown in SEQ ID No. 2, which is 5'-GTGGTGCCCTTCCGTCAATTCC-3'; The sequence of the Taqman probe is shown in SEQ ID No. 3, which is 5'-CAGGTTACGGGGGGAGTATGG-3', with a fluorescent light-emitting group connected to the 5' end and a quenching group labeled at the 3' end; The positive control is a recombinant plasmid, and the plasmid sequence is shown in SEQ ID No. 4, which is cggaaggagatcagacacctccgtattcccaaccataaacgatgccatctagggattgggcgagcccatatttcc tagaactccctcaggacctttcgagaaatcataagaattcaggttacggggggagtatggtcgcaaggcagaaacttaaaggaattgacggaagggcaccac; The negative control was ddH2O.

2. A real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 1, characterized in that: The 5'-end connected fluorescent light-emitting group includes one of FAM, VIC, HEX, JOE, ROX, Texas-Red, and Cy5; the fluorescent quenching group includes one of DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, and BHQ-3.

3. An application of a real-time fluorescent PCR kit for rapid detection of Labialegles, characterized in that: The application method of the kit is as follows: Sample nucleic acid extraction: Using clinical sample nucleic acid extraction technology, through cell lysis, nucleic acid isolation and purification steps, to obtain high-quality DNA template; Reaction system preparation: In an ice bath, accurately mix the DNA template, specific primers, Taqman probe, DNA polymerase, and reaction buffer components in a specific ratio to construct the reaction system; Fluorescence PCR amplification: Place the prepared reaction system in a real-time fluorescence PCR instrument, perform temperature cycling to achieve exponential amplification of the target nucleic acid, and monitor the changes in the fluorescence signal in real time; Validity of the results: Based on the amplification curve characteristics of the positive and negative controls, establish judgment criteria to ensure that the experimental process is free of contamination and the reaction system is operating normally, and to exclude false positive or false negative results; Result determination and reporting: Based on the cycle threshold and fluorescence intensity changes of the sample amplification curve, determination rules are formulated to distinguish positive, negative and suspicious results, and suspicious samples are repeatedly verified, and a standardized test report is issued.

4. The use of a real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 3, characterized in that: In the sample nucleic acid extraction step, a column extraction method is used to extract DNA from feces and environmental swab samples. The sample is mixed with a lysis solution to destroy the cell structure and release the nucleic acid. The nucleic acid is adsorbed on a silica gel membrane by centrifugation or vacuum filtration. Protein and salt impurities are then removed by a washing solution, and the DNA is eluted from the silica gel membrane with an eluent. After the extraction is completed, the nucleic acid concentration and purity are measured at wavelengths of 260 nm and 280 nm using a microspectrophotometer to ensure that the OD260 / OD280 ratio is between 1.8 and 2.

0. The extracted DNA is stored at -20°C for future use.

5. The use of a real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 3, characterized in that: In the reaction system preparation step, a 20 μL reaction system was prepared under ice bath conditions. Specifically, 5 μL of extracted DNA template was added to a reaction tube, and 10 μL of 2×Premix Ex Taq, 0.2 μL of a forward primer with a concentration of 20 μmol / L, 0.2 μL of a reverse primer with a concentration of 20 μmol / L, and 0.2 μL of a Taqman probe with a concentration of 20 μmol / L were added in sequence, and the volume was supplemented to 20 μL with ddH2O.

6. The use of a real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 3, characterized in that: In the fluorescent PCR amplification step, the packaged reaction tubes are placed in a fluorescent quantitative PCR instrument and pre-denatured at 95°C for 30 seconds to fully unwind the double-stranded DNA. The cycle then begins. Each cycle includes denaturation at 95°C for 5 seconds to unwind the double-stranded DNA into single strands, and annealing and extension at 60°C for 34 seconds. At this time, the primers bind to the single-stranded DNA template, and the Taq enzyme synthesizes a new DNA chain using dNTPs as raw materials. At the same time, the probe hybridizes with the template. Under the action of the 5'-3' exonuclease activity of the Taq enzyme, the probe is cleaved, the fluorescent luminescent group is separated from the quenching group, and a fluorescent signal is released. The instrument collects fluorescence at this stage. This cycle is repeated 40 times to complete the entire amplification process.

7. The use of a real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 3, characterized in that: In the step of determining the validity of the results, the amplification results of the positive control and the negative control are analyzed. The amplification curve of the positive control should be "S"-shaped, and the Ct value should be less than 35, indicating that the target nucleic acid in the positive control is effectively amplified and the reaction system and conditions are normal. The negative control and the blank control have no amplification curve, that is, the Ct value is not displayed or is greater than 40, indicating that the reaction system is not contaminated and there is no non-specific amplification. When the results of the positive control and the negative control meet the determination conditions at the same time, the experimental results are determined to be valid. Otherwise, the experimental process needs to be checked and the experiment needs to be repeated.

8. The use of a real-time fluorescent PCR kit for rapid detection of Labialegles according to claim 3, characterized in that: In the result determination and reporting step, for the test sample, the result is determined according to the Ct value. If the Ct value of the sample is less than 35, it is directly determined that the lip flagellate nucleic acid is detected, and the result is positive. If the Ct value is greater than 35.0 and less than or equal to 40.0, it is determined to be a suspicious result. At this time, the experiment needs to be repeated, or the sample is re-extracted for repeated well detection. If the Ct value is still less than or equal to 40.0 after repeated detection, it is determined that the lip flagellate nucleic acid is detected, and the result is positive. If the Ct value is greater than 40.0 after repeated detection, it is determined that the lip flagellate nucleic acid is not detected, and the result is negative. For samples determined to be positive, the amplification product is further sequenced, and the sequencing result is compared with the known lip flagellate sequence to verify the accuracy of the test result.

Images