Application of combined haplotype molecular marker of late rice grain cadmium content related genes CAL1 and LCd31

Abstract

The invention discloses application of combined haplotype molecular markers of genes CAL1 and LCd31 related to the cadmium content of late rice grains, belongs to the technical field of biology, and particularly relates to application of two combined haplotype molecular markers Multi-CL of the genes CAL1 and LCd31 related to the cadmium content of the late rice grains. The cadmium content of rice grains is identified or assisted to be identified by detecting polymorphic or genotype substances of two SNPs of a late rice variety of rice, and the cadmium content of the late rice grains of the low-cadmium combined haplotype Multi-CL1 is remarkably lower than that of Multi-CL2, Multi-C3, Multi-CL4 and Multi-CL5, so that the combined haplotype Multi-CL1 can be used for early prediction and screening of cadmium accumulation of the late rice grains; the method is used for rice breeding and breeding of low-cadmium rice.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of a combined haplotype molecular marker of late rice grain cadmium content-related genes CAL1 and LCd31. Background Art

[0002] Cadmium, a Class I carcinogen, is a heavy metal that is extremely harmful to the human body. Long-term exposure to cadmium can cause a variety of health problems.

[0003] Research has shown that different rice varieties vary significantly in their ability to accumulate cadmium in their grains, with concentrations varying by as much as tenfold, and this trait is highly heritable. Cadmium content in rice grains is a quantitative trait (QTL), and several associated genes have been identified through genome-wide association analysis and genetic population studies.

[0004] Single nucleotide polymorphisms (SNPs) refer to variations in a single nucleotide in the genome, including substitutions, inversions, insertions, or deletions. As the smallest unit of genetic variation, SNP markers offer advantages such as high stability, large numbers, wide distribution, and ease of detection, making them particularly suitable for large-scale testing and analysis. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an application of a combined haplotype molecular marker of late rice grain cadmium content-related genes CAL1 and LCd31. The present invention belongs to the field of biotechnology and specifically relates to the application of two combined haplotype molecular markers Multi-CL of late rice grain cadmium content-related genes CAL1 and LCd31; the cadmium content of rice grains is identified or assisted in the identification by detecting the polymorphism or genotype of two SNPs of late rice varieties; the cadmium content of late rice grains of the low-cadmium combined haplotype Multi-CL1 is significantly lower than that of Multi-CL2, Multi-CL3, Multi-CL4 and Multi-CL5, indicating that the combined haplotype Multi-CL1 can be used for early prediction and screening of cadmium accumulation in late rice grains, and for rice breeding and selection of low-cadmium rice.

[0006] In order to achieve the above technical effects, the following technical solutions are adopted: A combined haplotype molecular marker for the late rice grain cadmium content-related genes CAL1 and LCd31, wherein the combined haplotype molecular marker consists of CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648, and is recorded as a combined haplotype molecular marker Multi-CL; the combined haplotype molecular marker Multi-CL is a polymorphic combination of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 on the rice chromosome; Wherein, the CAL1-TagSNP-25190881 is a SNP in the rice genome, and the sequence list is SEQ ID NO.1; it is the 308th nucleotide in the sequence list SEQ ID NO.1, which is C or G; Wherein, the LCd31-TagSNP-9949648 is a SNP in the rice genome, and the sequence list is SEQ ID NO.2; it is the 32nd nucleotide in SEQ ID NO.2, which is C or T; The cadmium content in the grains of late rice having the genotype GGTT of the two SNPs is lower than or is candidate lower than that of late rice having the genotype CCCC, CCTT, CCH or HTT of the two SNPs. The late rice of the genotype GGTT is a combined genotype of the two SNPs of CAL1-TagSNP-25190881, which is GG, and LCd31-TagSNP-9949648, which is TT; The late rice with the genotype CCCC is a combined genotype of two SNPs, namely, CAL1-TagSNP-25190881, which has a genotype of CC, and LCd31-TagSNP-9949648, which has a genotype of CC; The late rice of the genotype CCTT is a combined genotype of two SNPs, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is TT; The late rice of genotype CCH is a combined genotype of two SNPs, namely, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is H / CT; The late rice of the genotype HTT has a genotype of H / CG for CAL1-TagSNP-25190881 and a combined genotype of two SNPs of TT for LCd31-TagSNP-9949648.

[0007] The invention relates to an application method of the combined haplotype molecular marker of the late rice grain cadmium content-related genes CAL1 and LCd31, which is an application of a substance detecting the polymorphism or genotype of the combined haplotype molecular marker Multi-CL in identifying or assisting in identifying the cadmium content of rice grains.

[0008] The invention relates to an application method of the combined haplotype molecular marker of the late rice grain cadmium content-related genes CAL1 and LCd31, and an application of a substance for detecting the polymorphism or genotype of the combined haplotype molecular marker Multi-CL in the preparation of a product for identifying or assisting in identifying the cadmium content of rice grains.

[0009] The invention relates to an application method of the combined haplotype molecular marker of the genes CAL1 and LCd31 related to the cadmium content in late rice grains, and is used to detect the polymorphism or genotype of the combined haplotype molecular marker Multi-LCL in rice breeding or the preparation of rice breeding products. The purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

[0010] Furthermore, the substance is the following D1, D2 or D3: D1: containing PCR primers for amplifying a rice genomic DNA fragment including CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 as claimed in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

[0011] Furthermore, the PCR forward primer sequence of the CAL1-TagSNP-25190881 is: F1: ACCAAGGTGGCGGAGGC, which is SEQ ID NO.3; the PCR reverse primer sequence of the CAL1-TagSNP-25190881 is: R1: AGCCGACGAGCAATGCG, which is SEQ ID NO.4; the PCR forward primer sequence of the LCd31-TagSNP-9949648 is: F1: 5'-GCGATAATTGCAATGAGTGTCTTGA-3', which is SEQ ID NO.5; the PCR reverse primer sequence of the LCd31-TagSNP-9949648 is: R1: 5'-CCTTTGCTTGAAAAAAACTGGG-3', which is SEQ ID NO.6.

[0012] The product contains the substance for detecting the polymorphism or genotype of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in the rice genome, and can be any one of the following G1-G3: G1: A product for detecting single nucleotide polymorphisms or genotypes related to cadmium content in rice grains; G2: Products for identifying or assisting in identifying the cadmium content in rice grains; G3: Products for rice breeding, the purpose of which is to cultivate rice with low cadmium content in grain or to select grain Rice varieties with low cadmium content.

[0013] Furthermore, the substance is the following D1, D2 or D3: D1: containing PCR primers for amplifying a rice genomic DNA fragment including CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 as claimed in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

[0014] A method for identifying or assisting in identifying the cadmium content in rice grains, comprising: Detecting the polymorphism combination or genotype of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in the rice genome of claim 1 in the rice to be tested, and identifying or assisting in identifying the cadmium content of rice grains based on the genotype of the rice to be tested: The cadmium content in the grains of late rice having the genotype GGTT of the two SNPs is lower than or is candidate lower than that of late rice having the genotype CCCC, CCTT, CCH or HTT of the two SNPs. The late rice of the genotype GGTT is a combined genotype of the two SNPs of CAL1-TagSNP-25190881, which is GG, and LCd31-TagSNP-9949648, which is TT; The late rice with the genotype CCCC is a combined genotype of two SNPs, namely, CAL1-TagSNP-25190881, which has a genotype of CC, and LCd31-TagSNP-9949648, which has a genotype of CC; The late rice of the genotype CCTT is a combined genotype of two SNPs, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is TT; The late rice of genotype CCH is a combined genotype of two SNPs, namely, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is H / CT; The late rice of the genotype HTT has a genotype of H / CG for CAL1-TagSNP-25190881 and a combined genotype of two SNPs of TT for LCd31-TagSNP-9949648.

[0015] The method is used in rice breeding, wherein the purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains; the rice breeding method is specifically: The polymorphism combination or genotype of the two SNPs, CAL1-TagSNP-25190881 and the LCd31-TagSNP-9949648, in the rice genome to be tested is detected, and the late rice with the genotype of the two SNPs being GGTT is selected as the parent for breeding. The late rice with the genotype GGTT is a combined genotype of the two SNPs, in which the genotype of CAL1-TagSNP-25190881 is GG and the genotype of LCd31-TagSNP-9949648 is TT.

[0016] In the above-mentioned applications and methods, the substance for detecting the polymorphism or genotype of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in late rice, or the substance for detecting the combined haplotype, can be used to determine the nucleotide types of the two sites CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in the late rice genome by at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single-stranded conformation polymorphism, denaturing high-performance liquid chromatography and SNP chip.

[0017] In the above applications and methods, the product may be a reagent, kit, or system. The system may include a combination of a reagent or kit, an instrument, and analytical software, such as a product consisting of PCR primers, Phanta® Mix reagent, a microplate reader, and online software SNP decoder (http: / / www.snpway.com / snpdecoder / ), or a combination product consisting of PCR primers, Phanta® Mix reagent, online software SNP decoder, and fluorescent quantitative PCR. The product includes the above-mentioned substance for detecting the polymorphism or genotype of the two SNPs, CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648, in the late rice genome.

[0018] The beneficial effects of the present invention are: Disclosed is the application of a combined haplotype molecular marker of genes CAL1 and LCd31 related to cadmium content in late rice grains, belonging to the field of biotechnology, and specifically involving the application of two combined haplotype molecular markers Multi-CL of genes CAL1 and LCd31 related to cadmium content in late rice grains; by detecting the polymorphism or genotype of two SNPs of late rice varieties to identify or assist in the identification of cadmium content in rice grains, the cadmium content in late rice grains of the low-cadmium combined haplotype Multi-CL1 is significantly lower than that of Multi-CL2, Multi-CL3, Multi-CL4 and Multi-CL5, indicating that the combined haplotype Multi-CL1 can be used for the early prediction and screening of cadmium accumulation in late rice grains, and for rice breeding and the selection of low-cadmium rice.

[0019] The present invention provides a method for joint haplotype identification or assisted identification of cadmium content in late rice grains using two rice grain cadmium accumulation-related genes. Molecular marker-assisted selection breeding can be used to select for target traits at the DNA level. Not only is the result stable, but selection can also be performed at the seedling stage, reducing the cost of phenotypic evaluation and improving breeding efficiency. DETAILED DESCRIPTION

[0020] The present invention is further described below, and the protection scope of the present invention is not limited to the following: Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0021] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0022] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0023] The 37 late rice materials in the following examples were all provided by the College of Agriculture of Jiangxi Agricultural University and the laboratory of Jiangxi Academy of Agricultural Sciences, and their germplasm resources were obtained from the National Rice Data Center (https: / / www.ricedata.cn / variety / index.htm).

[0024] Example 1: Discovery of low-cadmium combined haplotypes of two late rice grain cadmium accumulation genes A joint haplotype analysis was performed on SNP molecular markers of two genes related to cadmium content in late rice grains, including CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648. Each SNP site was divided into two genotypes (detailed genotypes are shown in Table 1).

[0025] The sequence of CAL1-TagSNP-25190881 is shown in SEQ ID NO.1; the sequence of LCd31-TagSNP-9949648 is shown in SEQ ID NO.2; 1. The CAL1 gene is located at nucleotide position 25190881 on rice chromosome 2. TagSNP-25190881 is a C / G polymorphic SNP site in the rice genome. Two genotypes exist: genotype CC, which is homozygous for C in CAL1-TagSNP-25190881; genotype GG, which is homozygous for G in CAL1-TagSNP-25190881; and genotype CG, which is heterozygous for both C and G in CAL1-TagSNP-25190881. Genomic DNA was extracted from leaves of late rice varieties, and PCR amplification was performed using the specific primer pairs shown in SEQ ID No. 3 and SEQ ID No. 4. The specific sequences are as follows: forward primer F1: ACCAAGGTGGCGGAGGC, which is SEQ ID No. 3, and reverse primer R1: AGCCGACGAGCAATGCG, which is SEQ ID No. 4. The PCR products were sequenced to determine the identity of the TagSNP-25190881 nucleotide. The TagSNP-25190881 genotype of each late rice variety was determined based on the identity of the TagSNP-25190881 nucleotide.

[0026] 2. The LCd31 gene is located at nucleotide position 9949648 on rice chromosome 9. TagSNP-9949648 is a SNP site in the rice genome and is a C / T polymorphic site. There are two genotypes: genotype CC is the homozygous type in which LCd31-TagSNP-9949648 in the rice genome is C; genotype TT is the homozygous type in which LCd31-TagSNP-9949648 in the rice genome is T; and genotype CT is the heterozygous type in which LCd31-TagSNP-9949648 in the rice genome is C and T. A dCAPS molecular marker was designed using this SNP. PCR amplification was performed on genomic DNA from different late rice varieties. The PCR product was digested with the restriction endonuclease MboI. Two bands of different sizes were detected on electrophoresis: a 171-base-pair band in varieties with high grain cadmium content and a 148-base-pair band in varieties with low grain cadmium content. These two bands showed strong polymorphism on agarose gel electrophoresis. This dCAPS marker can be used to analyze the polymorphism of nucleotides at positions 9949648 of the TagSNP in the LCd31 gene in the tested rice varieties.

[0027] Primer Design: The TagSNP-9949648 primer pair is designed based on dCAPS technology to detect SNP polymorphisms. The TagSNP-9949648 primer pair consists of a forward primer and a reverse primer. The specific sequences are as follows: forward primer F1: 5'-GCGATAATTGCAATGAGTGTCTTGA-3' (SEQ ID NO. 5), reverse primer R1: 5'-CCTTTGCTTGAAAAAAACTGGG-3' (SEQ ID NO. 6). Primers can be synthesized by Qingke Biotechnology.

[0028] Genomic DNA was extracted from leaves of late rice varieties, and PCR amplification products were performed using the specific primer pairs shown in SEQ ID No. 5 and SEQ ID No. 6. The PCR products were digested with the restriction endonuclease MboI, and the digested products were detected by electrophoresis. The late rice varieties with an electrophoretic band of 171 bp had a CC type at the nucleotide position TagSNP-9949648 of the LCd31 gene, the late rice varieties with an electrophoretic band of 148 bp had a TT type at the nucleotide position TagSNP-9949648 of the LCd31 gene, and the late rice varieties with electrophoretic bands of 171 bp and 148 bp had a CT type at the nucleotide position TagSNP-9949648 of the LCd31 gene.

[0029] Table 1. Location information of 2 genes and their SNP sites

[0030] The SNP molecular markers of the two genes obtained in Example 3 were subjected to joint haplotype analysis. The results showed that there were 5 joint haplotypes of the above two SNP molecular markers: 1) The combined haplotype Muiti-CL1 is a combined haplotype of the two SNP molecular markers (CAL1-LCd31) GG-TT in the rice genome. That is, the combined haplotype Muiti-CL1 has a genotype of GGTT, and is a combined genotype of two SNPs: CAL1-TagSNP-25190881 has a genotype of GG, and LCd31-TagSNP-9949648 has a genotype of TT.

[0031] 2) The combined haplotype Muiti-CL2 is a combined haplotype of the two SNP markers (CAL1-LCd31) CC-TT in the rice genome. Specifically, the combined haplotype Muiti-CL2 has a genotype of CCTT, which is a combination of the two SNPs: CAL1-TagSNP-25190881 (CC) and LCd31-TagSNP-9949648 (CC).

[0032] 3) The combined haplotype Muiti-CL3 is a combined haplotype of the two SNP markers (CAL1-LCd31) CC-H in the rice genome. Specifically, the combined haplotype Muiti-CL3 has a genotype of CCH, a combined genotype of two SNPs: CAL1-TagSNP-25190881 (CC), and LCd31-TagSNP-9949648 (H / CT).

[0033] 4) The combined haplotype Muiti-CL4 is a combined haplotype of the two SNP markers (CAL1-LCd31) H-TT in the rice genome. Specifically, the genotype of the combined haplotype Muiti-CL4 is HTT, and the genotype of the two SNPs is H / CG for CAL1-TagSNP-25190881 and TT for LCd31-TagSNP-9949648.

[0034] 5) The combined haplotype Muiti-CL4 is a combined haplotype of the two SNP molecular markers (CAL1-LCd31) CC-CC in the rice genome. That is, the genotype of the combined haplotype Muiti-CL4 is CCCC, which is a combined genotype of the two SNPs: CAL1-TagSNP-25190881, which is CC, and LCd31-TagSNP-9949648, which is CC.

[0035] Example 2: Determination of Cadmium Content in Late Rice Grains The average value of each planting site was used as the standard for distinguishing the high and low cadmium content of rice, and the CAL1-LCd31 genotypes of 37 late rice materials were identified using the two molecular markers of late rice of the present invention. The rice cadmium accumulation phenotypes of 37 late rice materials were collected from two moderately polluted field experiments (Field1 and Field2). The cadmium concentration in the moderately polluted field of Field1 was 0.78 mg / kg and the pH value was 5.45; the cadmium concentration in the moderately polluted field of Field2 was 1.5 mg / kg and the pH value was 5.82; the genomic DNA was extracted from the 37 late rice materials in Table 2, and the genotype was identified using the two molecular markers of the rice cadmium accumulation-related gene CAL1-LCd31 according to the method shown in Example 3.

[0036] The cadmium content of the combined haplotypes of 37 late rice varieties is shown in Table 2. The results showed that there were five combined haplotypes for the above two molecular markers: 1) The combined haplotype Muiti-CL1 is a combined haplotype of the two SNP molecular markers (CAL1-LCd31) GG-TT in the rice genome. That is, the combined haplotype Muiti-CL1 has a genotype of GGTT, and is a combined genotype of two SNPs: CAL1-TagSNP-25190881 has a genotype of GG, and LCd31-TagSNP-9949648 has a genotype of TT.

[0037] 2) The combined haplotype Muiti-CL2 is a combined haplotype of the two SNP markers (CAL1-LCd31) CC-TT in the rice genome. Specifically, the combined haplotype Muiti-CL2 has a genotype of CCTT, which is a combination of the two SNPs: CAL1-TagSNP-25190881 (CC) and LCd31-TagSNP-9949648 (CC).

[0038] 3) The combined haplotype Muiti-CL3 is a combined haplotype of the two SNP markers (CAL1-LCd31) CC-H in the rice genome. Specifically, the combined haplotype Muiti-CL3 has a genotype of CCH, a combined genotype of two SNPs: CAL1-TagSNP-25190881 (CC), and LCd31-TagSNP-9949648 (H / CT).

[0039] 4) The combined haplotype Muiti-CL4 is a combined haplotype of the two SNP markers (CAL1-LCd31) H-TT in the rice genome. Specifically, the genotype of the combined haplotype Muiti-CL4 is HTT, and the genotype of the two SNPs is H / CG for CAL1-TagSNP-25190881 and TT for LCd31-TagSNP-9949648.

[0040] 5) The combined haplotype Muiti-CL4 is a combined haplotype of the two SNP molecular markers (CAL1-LCd31) CC-CC in the rice genome. That is, the genotype of the combined haplotype Muiti-CL4 is CCCC, which is a combined genotype of the two SNPs: CAL1-TagSNP-25190881, which is CC, and LCd31-TagSNP-9949648, which is CC.

[0041] The combined haplotype cadmium contents of 37 late rice varieties are shown in Table 2. The mean cadmium contents of rice grains of the combined haplotype Multi-CL1 in the two field experiments (Field1~Field2) were 0.26 mg / kg and 0.31 mg / kg, respectively; the mean cadmium contents of rice grains of the combined haplotype Multi-CL2 in the two field experiments ((Field1~Field2)) were 0.40 mg / kg and 0.81 mg / kg, respectively; the mean cadmium contents of rice grains of the combined haplotype Multi-CL3 in the two field experiments ((Field1~Field2)) were 0.49 mg / kg and 0.54 mg / kg, respectively; the mean cadmium contents of rice grains of the combined haplotype Multi-CL4 in the two field experiments ((Field1~Field2)) were 0.41 mg / kg and 0.76 mg / kg, respectively; The mean cadmium content in rice grains of Multi-CL1 in two field experiments (Field1~Field2) was 0.71 mg / kg and 1.09 mg / kg, respectively. Among them, the cadmium content in rice grains of Multi-CL1 was significantly lower than that of Multi-CL3, Multi-CL4 and Multi-CL5 under the conditions of the two field experiments. Under the conditions of Field4 and Field5, the cadmium content in rice grains of Multi-CL2 was higher than that of Multi-CL1 in 79% and 95% of the cases, respectively. This indicates that Multi-LCL1 is a low-cadmium combined haplotype, which can be used for early pre-selection and screening of cadmium accumulation in late rice grains, and for molecular marker-assisted selection breeding of late rice and breeding of low-cadmium late rice. In the breeding of late rice with low cadmium content, it is best to select the combined haplotype Multi-CL1, which is the late rice with the combined genotype of (CAL1-LCd31)GGTT as the parent for breeding.

[0042] Table 2. Cadmium content in rice grains of 37 late rice varieties and genotypes of the five combined haplotypes CAL1-LCd31

[0043] In summary, the present invention discloses the application of a combined haplotype molecular marker of late rice grain cadmium content-related genes CAL1 and LCd31, belongs to the field of biotechnology, and specifically relates to the application of two combined haplotype molecular markers Multi-CL of late rice grain cadmium content-related genes CAL1 and LCd31; by detecting the polymorphism or genotype of two SNPs of late rice varieties to identify or assist in the identification of rice grain cadmium content, the cadmium content of late rice grains of the low-cadmium combined haplotype Multi-CL1 is significantly lower than that of Multi-CL2, Multi-CL3, Multi-CL4 and Multi-CL5, indicating that the combined haplotype Multi-CL1 can be used for early prediction and screening of cadmium accumulation in late rice grains, and for rice breeding and selection of low-cadmium rice.

[0044] SEQ ID NO.1 (CAL1-TagSNP-25190881): AGATGGGGACGACCAAGGGTGGCGGAGGCGAGGCACTGCCTGTCGCAGAGCCACAGGTTCAAGGGCATGTGCGTGAGCAGCAACAACTGCGCCAACGTGTGCAGGACGGAGAGCTTCCCCGACGGCGAGTGCAAGTCGCACGGCRTCGAGCGCAAGTGCTTCTGCAAGAAGGTCTGCTAGTGCATGCTAGCCCCGCTGTCTCTGCAGTCGCATTGCTCGTCGGCTGTGTATCT SEQ ID NO.2 (LCd31-TagSNP-9949648): CTAGTGGCGATAATTGCAATGAGTGTCTTTAYCCATACAAATATGCATCATGACTCGATAGAAAACGGGAGGATGTACATGGGAGTGCAGTTCTTTGGTACGTTGGCAATAATGTTTAAAGGGTTGGCAGAAATGGGAGCAGCTCTTGCAAATCTCCCAGTTTTTTCAAGCAAAGG SEQ ID NO.3: ACCAAGGTGGCGGAGGC SEQ ID NO.4: AGCCGACGAGCAATGCG SEQ ID NO.5: GCGATAATTGCAATGAGTGTCTTGA SEQ ID NO.6: CCTTTGCTTGAAAAAAACTGGG At this point, those skilled in the art will recognize that, although the embodiments of the present invention have been shown and described in detail herein, many other variations or modifications consistent with the principles of the present invention may be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the present invention. Therefore, the scope of the present invention should be understood and deemed to cover all such other variations or modifications.

Claims

1. A combined haplotype molecular marker for the genes CAL1 and LCd31 related to cadmium content in late rice grains, characterized by: The combined haplotype molecular marker consists of CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648, and is recorded as the combined haplotype molecular marker Multi-CL; the combined haplotype molecular marker Multi-CL is a polymorphic combination of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 on the rice chromosome; Wherein, the CAL1-TagSNP-25190881 is a SNP in the rice genome, and the sequence list is SEQ ID NO.1; it is the 308th nucleotide in the sequence list SEQ ID NO.1, which is C or G; Wherein, the LCd31-TagSNP-9949648 is a SNP in the rice genome, and the sequence list is SEQ ID NO.2; it is the 32nd nucleotide in SEQ ID NO.2, which is C or T; The cadmium content in the grains of late rice having the genotype GGTT of the two SNPs is lower than or is candidate lower than that of late rice having the genotype CCCC, CCTT, CCH or HTT of the two SNPs. The late rice of the genotype GGTT is a combined genotype of the two SNPs of CAL1-TagSNP-25190881, which is GG, and LCd31-TagSNP-9949648, which is TT; The late rice with the genotype CCCC is a combined genotype of two SNPs, namely, CAL1-TagSNP-25190881, which has a genotype of CC, and LCd31-TagSNP-9949648, which has a genotype of CC; The late rice of the genotype CCTT is a combined genotype of two SNPs, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is TT; The late rice of genotype CCH is a combined genotype of two SNPs, namely, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is H / CT; The late rice of the genotype HTT has a genotype of H / CG for CAL1-TagSNP-25190881 and a combined genotype of the two SNPs of TT for LCd31-TagSNP-9949648.

2. A method for using the combined haplotype molecular markers of the late rice grain cadmium content-related genes CAL1 and LCd31 as claimed in claim 1, characterized in that: The invention relates to an application of a substance for detecting the polymorphism or genotype of the combined haplotype molecular marker Multi-CL in identifying or assisting in identifying the cadmium content in rice grains.

3. A method for using the combined haplotype molecular markers of the late rice grain cadmium content-related genes CAL1 and LCd31 as claimed in claim 1, characterized in that: The invention relates to an application of a substance for detecting the polymorphism or genotype of the combined haplotype molecular marker Multi-CL in the preparation of a product for identifying or assisting in identifying the cadmium content in rice grains.

4. A method for using the combined haplotype molecular markers of the late rice grain cadmium content-related genes CAL1 and LCd31 as claimed in claim 1, characterized in that: The invention relates to an application of a material for detecting the polymorphism or genotype of the combined haplotype molecular marker Multi-LCL in rice breeding or preparing rice breeding products, wherein the purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

5. The application method according to any one of claims 2 to 4, characterized in that: The substance is D1, D2 or D3 as follows: D1: containing PCR primers for amplifying a rice genomic DNA fragment including CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 as claimed in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

6. The application method according to claim 5, characterized in that: The PCR forward primer sequence of the CAL1-TagSNP-25190881 is: F1: ACCAAGGTGGCGGAGGC, which is SEQ ID NO.3; the PCR reverse primer sequence of the CAL1-TagSNP-25190881 is: R1: AGCCGACGAGCAATGCG, which is SEQ ID NO.4; the PCR forward primer sequence of the LCd31-TagSNP-9949648 is: F1: 5'-GCGATAATTGCAATGAGTGTCTTGA-3', which is SEQ ID NO.5; the PCR reverse primer sequence of the LCd31-TagSNP-9949648 is: R1: 5'-CCTTTGCTTGAAAAAAACTGGG-3', which is SEQ ID NO.

6.

7. The product is characterized in that The product contains the substance for detecting the polymorphism or genotype of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in the rice genome as described in claim 1, and can be any one of the following G1-G3: G1: A product for detecting single nucleotide polymorphisms or genotypes related to cadmium content in rice grains; G2: Products for identifying or assisting in identifying the cadmium content in rice grains; G3: Products for rice breeding, the purpose of which is to cultivate rice with low cadmium content in grain or to select grain Rice varieties with low cadmium content.

8. The product as claimed in claim 7, characterized in that The substance is D1, D2 or D3 as follows: D1: containing PCR primers for amplifying a rice genomic DNA fragment including CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 as claimed in claim 1; D2: PCR reagent containing the PCR primers described in D1; D3: A kit containing the PCR primers described in D1 or the PCR reagents described in D2.

9. A method for identifying or assisting in identifying the cadmium content in rice grains, comprising: Detecting the polymorphism combination or genotype of the two SNPs CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648 in the rice genome of claim 1 in the rice to be tested, and identifying or assisting in identifying the cadmium content of rice grains based on the genotype of the rice to be tested: The cadmium content in the grains of late rice having the genotype GGTT of the two SNPs is lower than or is candidate lower than that of late rice having the genotype CCCC, CCTT, CCH or HTT of the two SNPs. The late rice of the genotype GGTT is a combined genotype of the two SNPs of CAL1-TagSNP-25190881, which is GG, and LCd31-TagSNP-9949648, which is TT; The late rice with the genotype CCCC is a combined genotype of two SNPs, namely, CAL1-TagSNP-25190881, which has a genotype of CC, and LCd31-TagSNP-9949648, which has a genotype of CC; The late rice of the genotype CCTT is a combined genotype of two SNPs, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is TT; The late rice of genotype CCH is a combined genotype of two SNPs, namely, the genotype of CAL1-TagSNP-25190881 is CC, and the genotype of LCd31-TagSNP-9949648 is H / CT; The late rice of the genotype HTT has a genotype of H / CG for CAL1-TagSNP-25190881 and a combined genotype of the two SNPs of TT for LCd31-TagSNP-9949648.

10. Use of the method according to claim 9 in rice breeding, wherein the purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains; the rice breeding method specifically comprises: The polymorphism combination or genotype of the two SNPs, CAL1-TagSNP-25190881 and LCd31-TagSNP-9949648, in the rice genome to be tested according to claim 1 is detected in the rice to be tested, and the late rice with the genotype of the two SNPs being GGTT is selected as the parent for breeding, and the late rice with the genotype GGTT is a combined genotype of the two SNPs, the genotype of CAL1-TagSNP-25190881 being GG and the genotype of LCd31-TagSNP-9949648 being TT.

Images