Novel manganese-dependent transcriptional regulator variants and method for producing l-glutamic acid using same
By introducing a manganese-dependent transcriptional regulator variant polypeptide into a microorganism, particularly replacing the amino acid at position 160 of SEQ ID NO: 1, the production efficiency of L-glutamic acid is improved, solving the problem of low production efficiency in the prior art.
Patent Information
- Application Number
- CN202380093869.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-13
- Filing Date
- 2023-12-13
- Publication Date
- 2025-09-19
AI Technical Summary
Existing technologies are difficult to efficiently produce L-glutamic acid, and it is necessary to develop high-yield microorganisms and production methods.
By culturing microorganisms that produce a manganese-dependent transcriptional regulatory factor variant polypeptide, in particular, replacing the amino acid at position 160 of SEQ ID NO: 1, for example, replacing it with aspartic acid, the production capacity of L-glutamic acid is improved.
Compared with microorganisms without modified polypeptides, L-glutamic acid can be produced at a high yield, thereby improving the production efficiency of microorganisms.
Smart Images

Figure BDA0005543460390000251 
Figure BDA0005543460390000261 
Figure BDA0005543460390000271
Abstract
Description
Technical Field
[0001] The present disclosure relates to a novel manganese-dependent transcriptional regulator variant polypeptide; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide, the polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide; a method for producing L-glutamic acid, the method comprising the step of culturing the microorganism in a culture medium; and use of the microorganism for producing L-glutamic acid. Background Art
[0002] Glutamic acid is a representative amino acid produced by fermentation. It has a unique and distinctive taste and is one of the important amino acids widely used in the food field as well as in the medical field and other animal feed fields.
[0003] The common method of producing glutamic acid comprises using Brevibacterium (Brevibacterium) or Corynebacterium (Corynebacterium) microorganism and the rod-shaped bacteria comprising its mutant strain to produce (Amino Acid Fermentation, Gakkai Shuppan Center:195-215,1986) by fermentation.In addition, the method using microorganisms such as intestinal bacteria (Escherichia coli) or Bacillus (Bacillus), Streptomyces (Streptomyces), Penicillium (Penicillium), Klebsiella (Klebsiella), Erwinia (Erwinia), Pantoea (Pantoea) is known (U.S. Patent Publication No. 3220929 and U.S. Patent No. 6682912).
[0004] In addition, carried out the various research of effectively producing amino acid whose, for example, effort is developed for efficient production of amino acid whose microorganism or fermentation process.Particularly, developed target specific method, as the method for the expression of the gene of the enzyme that increases coding participation amino acid biosynthesis or the method (Korean Patent No. 10-0924065 and 10-1208480) of removing amino acid biosynthesis unwanted gene in Corynebacterium bacterial strain.In addition, also used the method for removing the gene that does not participate in amino acid production and the method for removing the gene that unknown its specific function is relevant with amino acid production.But still need to study the method for effectively producing L-amino acid with high yield. Summary of the Invention
[0005]
Technical Issues
[0006] An object of the present disclosure is to provide a microorganism capable of producing L-glutamic acid at a high yield compared to a microorganism having an existing unmodified polypeptide by culturing a microorganism comprising a manganese-dependent transcriptional regulator variant polypeptide, and a method for producing L-glutamic acid using the same.
[0007]
Technical solution
[0008] One aspect of the present disclosure provides a manganese-dependent transcriptional regulator variant polypeptide, wherein the amino acid corresponding to position 160 of SEQ ID NO: 1 is substituted with a different amino acid.
[0009] In a specific embodiment, the variant polypeptide may have the amino acid corresponding to position 160 of SEQ ID NO: 1 replaced by aspartic acid.
[0010] In another specific embodiment, the variant polypeptide may consist of the amino acid sequence of SEQ ID NO:3.
[0011] Another aspect of the present disclosure provides a polynucleotide encoding the variant polypeptide.
[0012] Another aspect of the present disclosure provides a microorganism comprising the variant polypeptide, the polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide.
[0013] In a specific embodiment, the microorganism may have increased L-glutamic acid-producing ability compared to a microorganism comprising the polypeptide of SEQ ID NO: 1 or a polynucleotide encoding the same.
[0014] Regarding the microorganism according to any one of the above-mentioned specific embodiments, the microorganism may be a microorganism of the genus Corynebacterium.
[0015] Regarding the microorganism according to any one of the above-mentioned specific embodiments, the Corynebacterium microorganism may be Corynebacterium glutamicum.
[0016] Another aspect of the present disclosure provides a method for producing L-glutamic acid, the method comprising the step of culturing the microorganism in a culture medium.
[0017] In a specific embodiment, the method may further comprise the step of recovering L-glutamic acid from the cultured microorganism, the culture of the microorganism, the fermentation product of the microorganism, or the culture medium.
[0018] Another aspect of the present disclosure provides a composition for producing L-glutamic acid, which comprises the variant polypeptide; the polynucleotide encoding the variant polypeptide; a vector comprising the polynucleotide; a microorganism comprising the variant polypeptide, the polynucleotide encoding the variant polypeptide, or the vector comprising the polynucleotide; or a combination of two or more thereof.
[0019] Another aspect of the present disclosure provides use of the microorganism for producing L-glutamic acid.
[0020] Beneficial effects
[0021] When a microorganism comprising the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure is cultured, L-glutamic acid can be produced at a high yield compared to a microorganism comprising an existing unmodified polypeptide. DETAILED DESCRIPTION
[0022] The present disclosure will be described in detail below. At the same time, each description and embodiment disclosed in the present disclosure can also be applied to other descriptions and embodiments. In other words, all combinations of the various elements disclosed in the present disclosure fall within the scope of the present disclosure. In addition, the scope of the present disclosure is not limited by the specific description described below. In addition, many papers and patent documents are referenced and cited throughout the specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to further illustrate the level and scope of the subject matter to which the present disclosure belongs.
[0023] One aspect of the present disclosure provides a manganese-dependent transcriptional regulator variant polypeptide, wherein the amino acid corresponding to position 160 of SEQ ID NO: 1 is substituted with a different amino acid.
[0024] As used herein, the term "manganese-dependent transcriptional regulator variant polypeptide" refers to a manganese-dependent transcriptional regulator variant polypeptide comprising a substitution of one or more amino acids in the amino acid sequence of a manganese-dependent transcriptional regulator polypeptide; or a manganese-dependent transcriptional regulator polypeptide variant comprising a substitution of one or more amino acids in the parent sequence (i.e., the amino acid sequence of a manganese-dependent transcriptional regulator polypeptide).
[0025] As used herein, the term "manganese-dependent transcriptional regulator (Mn-dependent transcriptional regulator, dtxR)" is a global regulatory factor involved in iron metabolism, refers to a factor that inhibits iron binding in diphtheria toxin gene expression, and can be used interchangeably with terms such as "diphtheria toxin inhibitory factor", "Tox regulatory factor", etc., and can be, but is not particularly limited to, a Mn-dependent transcriptional regulator (dtxR) encoded by the dtxR gene.
[0026] The gene encoding the Mn-dependent transcriptional regulator may be derived from a microorganism of the genus Corynebacterium, specifically, it may be dtxR derived from Corynebacterium glutamicum, but is not limited thereto.
[0027] Specifically, examples of Mn-dependent transcriptional regulator proteins may include the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 60% or greater homology or identity thereto, but are not limited thereto, as long as they have Mn-dependent transcriptional regulatory function. Specifically, the amino acid sequence may include SEQ ID NO: 1 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or greater homology or identity thereto. The sequence of SEQ ID NO: 1 can be obtained from the known databases NCBI's GenBank or the Kyoto Gene and Genome Database (KEGG). For example, the sequence may be derived from the genus Corynebacterium or Corynebacterium glutamicum, and more specifically, it may be a polypeptide / protein comprising the amino acid sequence of SEQ ID NO: 1, but is not limited thereto. It is also obvious that auxiliary proteins with amino acid sequences with deletions, modifications, substitutions or additions of certain sequences also fall within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits the corresponding efficacy of the protein.
[0028] In addition, the Mn-dependent transcriptional regulatory protein having the amino acid sequence of SEQ ID NO: 1 may be encoded by a polynucleotide having or including the sequence of SEQ ID NO: 2, or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 2, or consisting of or consisting essentially of the sequence of SEQ ID NO: 2, or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 2, but is not limited thereto.
[0029] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are different from the amino acids of the amino acid sequence before conservative substitution and / or modification, but whose function or property is maintained. Such variants can generally be identified by modifying one or more amino acids of the polypeptide or protein amino acid sequence and evaluating the properties of the modified polypeptide. In other words, the ability of the variant can be increased, unchanged or reduced compared to the polypeptide before the change. In addition, some variants can include variants in which one or more parts such as N-terminal leader sequences or transmembrane domains have been removed. Other variants can include variants in which a portion of the N- and / or C-terminal has been removed from the mature protein. The term "variant" can be used interchangeably with terms such as modification, modified polypeptide, modified protein, mutant, mutant protein and disproportionate (divergent), and is not limited thereto, as long as it is a term with variant meaning.
[0030] Furthermore, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated co-translationally or post-translationally to a protein N-terminal signal (or leader) sequence that participates in protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to identify, purify, or synthesize the polypeptide.
[0031] The manganese-dependent transcriptional regulator variant polypeptide disclosed herein may be a manganese-dependent transcriptional regulator variant polypeptide in which the amino acid corresponding to position 160 of SEQ ID NO: 1 is substituted with a different amino acid, but is not limited thereto.
[0032] In one embodiment, the manganese-dependent transcriptional regulator variant polypeptide disclosed herein may have a sequence identity of 60% or more and less than 100% with the amino acid sequence of SEQ ID NO: 1, specifically, 80% or more and less than 100%, but is not limited thereto.
[0033] Specifically, the variants of the present disclosure may include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or higher homology or identity with the amino acid sequence of SEQ ID NO: 1, wherein the amino acid at position 160 at the N-terminus of SEQ ID NO: 1 is replaced with a different amino acid. It is also obvious that variants of amino acid sequences having deletions, modifications, substitutions, conservative substitutions or additions of some sequences also fall within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits the corresponding efficacy of the variants of the present disclosure.
[0034] There is no limitation on the “different amino acid” as long as it is different from the amino acid before substitution. Meanwhile, in the present disclosure, when it is expressed that “a specific amino acid is substituted”, it is obvious that the amino acid is substituted with an amino acid different from the amino acid before substitution, even if it is not separately indicated that the amino acid is substituted with a different amino acid.
[0035] Amino acids can generally be classified based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues.
[0036] Examples of such classifications can include positively charged (basic) amino acids such as arginine, lysine, and histidine; negatively charged (acidic) amino acids such as glutamic acid and aspartic acid; amino acids with non-polar side chains (non-polar amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; amino acids with polar or hydrophilic side chains (polar amino acids) such as serine, threonine, cysteine, tyrosine, asparagine, and glutamine. For another example, amino acids can be divided into amino acids with charged side chains (charged amino acids) such as arginine, lysine, histidine, glutamic acid, and aspartic acid, and amino acids with uncharged side chains (uncharged amino acids; also called neutral amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. For another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. For another example, valine, leucine, and isoleucine can be classified as branched-chain amino acids. For another example, the 20 amino acids are classified according to size. Starting from the relatively small amino acid group, amino acids can be divided into five groups: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, they are not necessarily limited thereto.
[0037] For example, when it is described that "the amino acid corresponding to position 160 of SEQ ID NO: 1 is replaced by a different amino acid", it means that the amino acid is replaced by aspartic acid, valine, alanine, isoleucine, glutamic acid (glutamate), phenylalanine, arginine, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, lysine, tryptophan, methionine, threonine or leucine, excluding glycine, but is not limited thereto.
[0038] As used herein, although the expression "a protein having an amino acid sequence described by a specific sequence number" is used, it is obvious that any protein having an amino acid sequence comprising a deletion, modification, substitution, conservative substitution or addition of a certain sequence can also be used in the present disclosure, as long as the protein has the same or equivalent activity as the protein consisting of the amino acid sequence of the corresponding sequence number. Examples thereof do not exclude the addition of a sequence that does not change the function of the protein, a possible naturally occurring mutation, a silent mutation or a conservative substitution thereof upstream or downstream of the amino acid sequence, as long as it has the same or corresponding activity as the variant protein, and it is obvious that even proteins having such sequence additions or mutations fall within the scope of the present disclosure.
[0039] The "N position" disclosed herein may include the N position and the amino acid position corresponding to the N position. Specifically, the N position may include the amino acid position corresponding to any amino acid residue in the mature polypeptide disclosed in the specific amino acid sequence. The specific amino acid sequence may be the amino acid sequence of SEQ ID NO: 1.
[0040] As used herein, the term "corresponding to" refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a listed residue in a polypeptide. Identifying an amino acid at a corresponding position can be determining a specific amino acid in a sequence with reference to a specific sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related protein or a reference protein.
[0041] For example, an arbitrary amino acid sequence is aligned with SEQ ID NO: 1, and on this basis, each amino acid residue in the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, the sequence alignment algorithms described in the present disclosure can determine the position of an amino acid or the position of a modification such as a substitution, insertion or deletion by comparing the position of the amino acid in a query sequence (also referred to as a "reference sequence").
[0042] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277), etc. can be used, but are not limited thereto, and sequence alignment programs, pairwise sequence comparison algorithms, etc. known in the art can be appropriately used.
[0043] In a specific embodiment, the variant polypeptide may have the amino acid corresponding to position 160 of SEQ ID NO: 1 replaced by an amino acid selected from the group consisting of aspartic acid, valine, alanine, isoleucine, arginine, leucine, methionine, threonine, asparagine, glutamine, proline, serine, tryptophan, phenylalanine, histidine, cysteine, tyrosine, lysine and glutamic acid, but is not limited thereto.
[0044] In one embodiment of the above embodiments, the variant polypeptide provided by the present disclosure may include the amino acid corresponding to position 160 at the N-terminus of SEQ ID NO: 1 being replaced by an amino acid selected from glutamic acid and aspartic acid (these amino acids are negatively charged (acidic) amino acids).
[0045] In one embodiment of the above embodiments, the variant polypeptide provided by the present disclosure may include an amino acid corresponding to position 160 at the N-terminus of SEQ ID NO: 1 replaced by an amino acid selected from arginine, lysine, histidine, glutamic acid and aspartic acid (these amino acids are amino acids with charged side chains (charged amino acids)).
[0046] In one embodiment of the above embodiments, the variant polypeptide provided by the present disclosure may include the amino acid corresponding to position 160 at the N-terminus of SEQ ID NO: 1 being replaced by an amino acid selected from cysteine, proline, threonine, aspartic acid and asparagine.
[0047] In one embodiment of the above embodiment, the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure may be a polypeptide in which the amino acid corresponding to position 160 of SEQ ID NO: 1 is substituted with aspartic acid, but is not limited thereto.
[0048] For example, the variant polypeptides of the present disclosure may include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or higher homology or identity with SEQ ID NO: 1, provided that the amino acid aspartic acid at position 160 of the amino acid sequence corresponding to SEQ ID NO: 1 is fixed. In addition, it is obvious that variant polypeptides having amino acid sequences with deletions, modifications, substitutions, conservative substitutions or additions of some sequences also fall within the scope of the present disclosure, as long as the amino acid sequence has the corresponding efficacy of the variant polypeptides of the present disclosure and has such homology or identity.
[0049] At the same time, those skilled in the art can identify the amino acid corresponding to position 160 of the amino acid sequence of SEQ ID NO: 1 of the present disclosure in any polynucleotide sequence by sequence alignment known in the art. Unless otherwise described in the present disclosure, when describing the "amino acid at a specific position of a specific sequence number", it is obvious that the amino acid also includes the "amino acid at the corresponding position" in any amino acid sequence.
[0050] In another specific embodiment, the variant polypeptide may consist of the amino acid sequence of SEQ ID NO:3.
[0051] Specifically, the variant polypeptides of the present disclosure may have or include SEQ ID NO: 3, or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more homology or identity to SEQ ID NO: 3, or may consist of or may consist essentially of the amino acid sequence.
[0052] Examples include those having sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus or C-terminus of the amino acid sequence and / or within the amino acid sequence that do not alter the function of the disclosed variants.
[0053] "Conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions can generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic properties of the residues. For example, positively charged (basic) amino acids include arginine, lysine and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan and tyrosine; hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan. In addition, amino acids can also be divided into amino acids with charged side chains and amino acids with uncharged side chains. Amino acids with charged side chains include aspartic acid, glutamic acid, lysine, arginine and histidine, and amino acids with uncharged side chains can also be divided into non-polar amino acids or polar amino acids. Non-polar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Generally, conservative substitutions may have little or no effect on the activity of the resulting polypeptide. Generally, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0054] In one embodiment, the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure may have enhanced manganese-dependent transcriptional regulator activity, but is not limited thereto. In addition, compared to the wild-type polypeptide of the manganese-dependent transcriptional regulator, the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure may have an activity that increases the ability to produce L-glutamate, but is not limited thereto.
[0055] Another aspect of the present disclosure provides a polynucleotide encoding the variant polypeptide.
[0056] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or longer that is a polymer of nucleotides, in which nucleotide monomers are linked into the long chain by covalent bonds; more specifically, it refers to a polynucleotide fragment encoding a variant.
[0057] The polynucleotide encoding the manganese-dependent transcriptional regulator variant polypeptide of the present invention may include any polynucleotide sequence without limitation, as long as it encodes the manganese-dependent transcriptional regulator variant polypeptide of the present invention. For example, the polynucleotide encoding the manganese-dependent transcriptional regulator variant polypeptide of the present invention may be a polynucleotide sequence encoding the amino acid sequence of the manganese-dependent transcriptional regulator variant polypeptide of the present invention, but is not limited thereto. In the present disclosure, the polynucleotide can be used to enhance the activity of the Mn-dependent transcriptional regulator to increase the production of glutamate, but is not limited thereto.
[0058] For example, the polynucleotide may include a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 3. As an example of the present disclosure, the polynucleotide of the present disclosure may have or include SEQ ID NO: 4. In addition, the polynucleotide of the present disclosure may consist of or consist essentially of SEQ ID NO: 4.
[0059] Taking into account the degeneracy of codons or the preferred codons in the organism in which the variants of the present invention are intended to be expressed, various modifications can be made to the coding regions of the polynucleotides of the present invention without changing the amino acid sequence of the variants of the present invention. Therefore, it is apparent that due to the degeneracy of codons, polynucleotides that are translated into polypeptides consisting of the amino acid sequence of the variants of the present invention or polypeptides having homology or identity thereto can also be included. For example, the polynucleotide of the present invention can be SEQ ID NO: 4 or a degenerate sequence thereof.
[0060] For example, the polynucleotides of the present disclosure may include, in a nucleotide sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or higher homology or identity with the sequence of SEQ ID NO: 2, a codon encoding glycine (which is the amino acid corresponding to position 479 of SEQ ID NO: 2) is replaced by a codon encoding an amino acid other than glycine, such as aspartic acid, but is not limited thereto. It is also obvious that variants of the polynucleotide sequence having deletions, modifications, substitutions, conservative substitutions or additions of some sequences also fall within the scope of the present disclosure, as long as the polynucleotide sequence has such homology or identity and encodes the amino acid sequence of the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure.
[0061] For another example, the polynucleotide of the present disclosure may have or include a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to SEQ ID NO: 4, or may consist of or consist essentially of a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to SEQ ID NO: 4, but is not limited thereto. Alternatively, the sequence having the above homology or identity may be a sequence in which the codon corresponding to position 160 of SEQ ID NO: 3 encoded by SEQ ID NO: 4 is fixed to a codon encoding aspartic acid.
[0062] In addition, the polynucleotides of the present disclosure may include probes prepared from known gene sequences, and may include any sequence without limitation, as long as it is a sequence that can hybridize under stringent conditions with a complementary sequence of all or part of the polynucleotide sequence of the present disclosure.
[0063] "Stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. These conditions are described in detail in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). Examples include conditions in which polynucleotides with higher homology or identity, i.e., polynucleotides with homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, hybridize with each other, whereas polynucleotides with lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS. These are general washing conditions for Southern hybridization.
[0064] Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between bases are tolerated depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present disclosure may also include substantially similar nucleic acid sequences and isolated nucleic acid fragments that are complementary to the entire sequence.
[0065] Specifically, hybridization conditions including a hybridization step with a Tm value of 55°C and the above conditions can be used to detect polynucleotides having homology or identity with the polynucleotides of the present disclosure. In addition, the Tm value can be 60°C, 63°C, or 65°C, but is not limited thereto, and can be appropriately adjusted by those skilled in the art according to the purpose.
[0066] The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementation, and these variables are well known in the art (eg, J. Sambrook et al., supra).
[0067] As used herein, the term "homology" or "identity" refers to the relatedness between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.
[0068] The sequence homology or identity of conserved polynucleotides or polypeptides are determined by standard comparison algorithms and can be used together with the default gap penalty set up by the used program. Basically, homology or identical sequences can hybridize with all or part of this sequence under medium or high stringency conditions usually. Obviously, hybridization also includes polynucleotides and polynucleotide hybridizations that contain universal codons or codons that take into account codon degeneracy.
[0069] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms (such as the "FASTA" program), for example using the default parameters in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) can be used, which is implemented as follows: the Needleman program (version 5.0.0 or later) in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (including the GCG program package ((Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [et al., J MOLEC BIOL 215]:403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48:1073). For example, BLAST or ClustalW from the National Center for Biotechnology Information can be used to determine homology, similarity or identity.
[0070] Homology, similarity or identity between polynucleotides or polypeptides can be determined by comparing sequence information using the GAP computer program, for example, as described by Needleman et al. (1970), J Mol Biol. 48: 443, as disclosed by Smith and Waterman, Adv. Appl. Math (1981) 2: 482. Briefly, the GAP program defines homology, similarity or identity as the value obtained by dividing the number of similar aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. The default parameters of the GAP program may include: (1) a binary comparison matrix (including a value of 1 for identity and a value of 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, the terms "homology" or "identity" as used herein refer to the relatedness between sequences.
[0071] Another aspect of the present disclosure provides a vector comprising the polynucleotide of the present disclosure. The vector may be an expression vector for expressing the polynucleotide in a microorganism, but is not limited thereto.
[0072] As used herein, the term "vector" may include a DNA construct comprising a nucleotide sequence encoding a polynucleotide of a polypeptide of interest, which is operably linked to a suitable expression regulatory region (or expression control sequence) such that the polypeptide of interest can be expressed in a suitable host. The expression regulatory region may comprise a promoter capable of initiating transcription, any operator sequence controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling transcription and translation termination. The vector may be transformed into a suitable microorganism and then replicated or functioned independently of the host genome, or may be integrated into the genome itself.
[0073] The vectors used in the present disclosure are not particularly limited, but any vector known in the art can be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as phage vectors or cosmid vectors; pDZ system, pBR system, pUC system, pBluescript II system, pGEM system, pTZ system, pCL system, pET system, etc. can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.
[0074] For example, the polynucleotide encoding target polypeptide can be inserted into the chromosome by the vector for the intracellular chromosome insertion. The polynucleotide insertion chromosome can be carried out by any method known in the art, for example homologous recombination, but is not limited thereto. The carrier can also include a selection marker for confirming that the chromosome inserts. The selection marker is used to select the cell transformed by the carrier, that is, for confirming the insertion of the target nucleic acid molecule, and can use the mark that gives the selectable phenotype (such as drug resistance, auxotrophy, cytotoxic agent resistance or surface polypeptide expression). In the environment of processing with the selection agent, only the cell survival of the expression selection marker or show other phenotypic traits, and therefore the cell of conversion can be selected.
[0075] As used herein, the term "transformation" refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a microorganism or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the microorganism. The location of the converted polynucleotide can be inserted into the chromosome of the microorganism or located outside the chromosome, regardless of the site, as long as it can be expressed in the microorganism. In addition, the polynucleotide contains DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form, as long as it can be introduced into the microorganism and expressed. For example, the polynucleotide can be introduced into the microorganism in the form of an expression cassette, which is a genetic construct containing all the elements required for autonomous expression. The expression cassette can generally include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide. The expression cassette can be in the form of an expression vector capable of self-replication. In addition, the polynucleotide can be introduced into the microorganism in its own form and operably linked to the sequence required for expression in the microorganism, but is not limited thereto.
[0076] Furthermore, the term "operably linked" means that a polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the desired variant of the present disclosure.
[0077] Another aspect of the present disclosure provides a microorganism comprising the variant polypeptide, the polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide.
[0078] In a specific embodiment, the microorganism of the present disclosure may be a microorganism having the ability to produce L-glutamic acid.
[0079] As used herein, term " microorganism (or strain) " comprises all wild-type microorganisms or natural or artificial genetically modified microorganisms, and it can be due to the insertion of exogenous genes or the activity enhancement or inactivation of endogenous genes and the microorganism that specific mechanism is weakened or strengthened, and it can be the microorganism that comprises the genetic modification for producing required polypeptide, protein or product.As used herein, " microorganism " and " strain " have identical meaning, and can be used interchangeably without restriction.
[0080] As used herein, the term "L-glutamic acid-producing microorganism" refers to a prokaryotic or eukaryotic microorganism capable of producing L-glutamic acid in a living organism, and may include microorganisms prepared by providing L-glutamic acid-producing ability to a parent strain that does not have the ability to produce L-glutamic acid, or microorganisms inherently having the ability to produce L-glutamic acid. The ability to produce L-glutamic acid can be imparted or enhanced through species improvement.
[0081] In one embodiment, the microorganism of the present disclosure may be a microorganism that naturally has a manganese-dependent transcriptional regulatory factor variant polypeptide or L-glutamate-producing ability; or a microorganism in which a variant of the present disclosure or a polynucleotide encoding the same (or a vector comprising the polynucleotide) is introduced into a parent strain that does not have a manganese-dependent transcriptional regulatory factor variant polypeptide or L-glutamate-producing ability and / or provides the parent strain with L-glutamate-producing ability, but is not limited thereto.
[0082] In one embodiment, the microorganisms of the present disclosure may include all of the following: microorganisms comprising the manganese-dependent transcriptional regulator variant polypeptide sequence of the present disclosure due to mutation of the gene encoding the manganese-dependent transcriptional regulator variant polypeptide on the chromosome, and / or microorganisms comprising the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure by introducing a vector comprising a polynucleotide encoding the manganese-dependent transcriptional regulator variant polypeptide of the present disclosure, but are not limited thereto.
[0083] As used herein, the term "unmodified microorganism" does not exclude strains containing mutations that may occur naturally in microorganisms, and may be a wild-type strain or a natural strain itself, or may be a strain before the trait is changed due to genetic variation caused by natural or artificial factors. For example, an unmodified microorganism may be a strain into which a manganese-dependent transcriptional regulator variant polypeptide described herein has not been introduced or has not yet been introduced. The term "unmodified microorganism" may be used interchangeably with "strain before modification," "microorganism before modification," "unchanged strain," "unmodified strain," "unchanged microorganism," or "reference microorganism."
[0084] As used herein, the term "L-glutamic acid (L-glutamate)" refers to an amino acid that is classified as a non-essential amino acid and is generally produced by fermentation of glutamic acid-producing microorganisms, but is not limited thereto. L-glutamic acid is known to be the most common excitatory neurotransmitter in the central nervous system, and because L-glutamic acid has an umami taste, monosodium glutamate (MSG) has been developed from it and is widely used as a flavor enhancer.
[0085] The microorganism having L-glutamic acid-producing ability disclosed herein may be a microorganism comprising any one or more of the variant disclosed herein, the polynucleotide disclosed herein, and a vector comprising the polynucleotide disclosed herein; a microorganism modified to express the variant disclosed herein or the polynucleotide disclosed herein; a microorganism (e.g., a recombinant strain) expressing the variant disclosed herein or the polynucleotide disclosed herein; or a microorganism (e.g., a recombinant strain) having the activity of a variant disclosed herein, but is not limited thereto.
[0086] For example, the strains disclosed herein are cells or microorganisms transformed with the polynucleotides disclosed herein or vectors containing polynucleotides encoding the variants disclosed herein to express the variants disclosed herein, and the strains disclosed herein may include any microorganism capable of producing L-glutamic acid by containing the variants disclosed herein. For example, the microorganisms disclosed herein may be recombinant strains having increased L-glutamic acid production capacity due to expression of a manganese-dependent transcriptional regulator variant polypeptide by introducing a polynucleotide encoding the variants disclosed herein into a natural wild-type microorganism or a microorganism having L-glutamic acid production capacity. The recombinant strains having increased L-glutamic acid production capacity may be microorganisms having increased L-glutamic acid production capacity compared to natural wild-type microorganisms or microorganisms in which the Mn-dependent transcriptional regulator is not modified (e.g., microorganisms expressing wild-type Mn-dependent transcriptional regulators or microorganisms that do not express the variants disclosed herein), but are not limited thereto. For example, the microorganisms disclosed herein having increased L-glutamic acid production capacity may be microorganisms having increased L-glutamic acid production capacity compared to microorganisms containing the polypeptide of SEQ ID NO: 1 or a polynucleotide encoding the same, but are not limited thereto. For example, the unmodified microorganism (which is the target strain for comparison of whether the L-glutamic acid production ability is increased) can be a wild-type Corynebacterium glutamicum strain, ATCC13869 or ATCC13032 strain; or a glutamic acid-producing strain, KFCC11074 strain (KR 10-0292299B1), but is not limited thereto.
[0087] The microorganisms disclosed herein may include any microorganisms capable of expressing the manganese-dependent transcriptional regulator variant polypeptides disclosed herein by methods other than the introduction of the nucleotides or vectors and other various known methods.
[0088] For example, the microorganism with increased L-glutamic acid productivity can have an increase of about 1% or more, specifically, about 1% or more, about 2% or more, about 3% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, compared to the parent strain before modification or the unmodified microorganism. The L-glutamic acid productivity of the modified microorganism may be increased by about 61% or more, about 62% or more, about 63% or more, or about 64% or more (the upper limit is not particularly limited, but may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 90% or less, about 80% or less, about 70% or less, or about 65% or less), but the increase is not limited thereto, as long as the productivity has an increase of a + value compared to the productivity of the parent strain before modification or the unmodified microorganism. In another example, the recombinant strain having an increased L-glutamic acid-producing ability may have an L-glutamic acid-producing ability of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.05 times or more, about 1.1 times or more, about 1.15 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.35 times or more, about 1.40 times or more, about 1.45 times or more, about 1.50 times or more, about 1.55 times or more, about 1.60 times or more, about 1.61 times or more, about 1.62 times or more, about 1.63 times or more, or about 1.64 times or more (the upper limit is not particularly limited, but may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, or 1.7 times or less), as compared to the parent strain or unmodified microorganism before modification, but is not limited thereto. As used herein, the term "about" is intended to include all ranges of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values equivalent to or similar to the value following the term "about", but the scope is not limited thereto.
[0089] Regarding the microorganism according to any of the above-mentioned specific embodiments, the microorganism of the present disclosure can be a microorganism of the genus Corynebacteria sp., Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Pseudomonas sp., Leptospira sp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp. or Nocardia sp., fungi or yeast, in particular, a microorganism of the genus Corynebacterium, but not limited thereto.
[0090] As an example of the present disclosure, the microorganism of the present disclosure may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singular, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the microorganism of the present disclosure may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, but is not limited thereto.
[0091] Meanwhile, the microorganisms having L-glutamic acid-producing ability disclosed herein may include all of the following: natural wild-type microorganisms themselves, microorganisms having improved L-glutamic acid-producing ability by enhancing or weakening the activity of genes related to the L-glutamic acid production mechanism, and microorganisms having improved L-glutamic acid-producing ability by introducing or enhancing the activity of exogenous genes.
[0092] Meanwhile, it is known that Corynebacterium microorganisms can produce L-glutamic acid, but their production capacity is very low, and the genes or mechanisms responsible for this production mechanism have not yet been revealed. Therefore, the Corynebacterium microorganisms having L-glutamic acid production capacity disclosed herein may include all of the following: naturally occurring wild-type microorganisms themselves, Corynebacterium microorganisms having improved L-glutamic acid production capacity by enhancing or weakening the activity of genes related to the L-glutamic acid production mechanism, and Corynebacterium microorganisms having improved L-glutamic acid production capacity by introducing or enhancing the activity of exogenous genes.
[0093] Furthermore, the microorganisms of the present disclosure may have enhanced activity of a Mn-dependent transcriptional regulator protein compared to the parent strain.
[0094] As used herein, the term "protein activity" of a Mn-dependent transcriptional regulator is used interchangeably with terms such as polypeptide activity, protein activity, and the like.
[0095] As used herein, the term "enhancement" of the activity of a Mn-dependent transcriptional regulator protein can be used interchangeably with terms such as activation, upregulation, overexpression, and increase. Here, activation, enhancement, upregulation, overexpression, and increase can include expressing an activity that was not originally present and expressing an increased activity compared to the endogenous activity or activity before modification.
[0096] "Endogenous activity" refers to the activity of a specific polypeptide originally present in the parent strain or unmodified microorganism before the trait is altered, when the trait is altered due to genetic variation caused by natural or artificial factors. This can be used interchangeably with "activity before modification." The fact that the activity of a polypeptide is "enhanced," "upregulated," "overexpressed," or "increased" compared to the endogenous activity means that the activity of the polypeptide is increased compared to the activity and / or concentration (expression level) of the specific polypeptide originally present in the parent strain or unmodified microorganism before the trait is altered.
[0097] Enhancement can be achieved by introducing an exogenous polypeptide or enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. An increase in polypeptide activity can be confirmed by an increase in the activity level and expression level of the corresponding polypeptide or an increase in the amount of a product produced by the corresponding polypeptide.
[0098] In order to enhance the activity of polypeptides, various methods well known in the art can be applied, as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification, the method is not limited. Specifically, genetic engineering and / or protein engineering well known to those skilled in the art can be used, which are conventional methods in molecular biology, but the method is not limited thereto (for example, Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, 1-16, Sambrook et al., Molecular Cloning 2012, etc.).
[0099] Specifically, the polypeptides that enhance the present disclosure may be:
[0100] 1) increasing the copy number of the polynucleotide encoding the polypeptide in the cell;
[0101] 2) Replacing the gene expression regulatory region on the chromosome encoding the polypeptide with a sequence that exhibits strong activity;
[0102] 3) modifying the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0103] 4) Modifying the amino acid sequence of a polypeptide to enhance its activity;
[0104] 5) Modifying a polynucleotide sequence encoding a polypeptide to enhance the activity of the polypeptide (e.g., modifying the polynucleotide sequence of a polypeptide gene to encode a modified polypeptide to enhance the activity of the polypeptide);
[0105] 6) introducing an exogenous polypeptide expressing the polypeptide activity or an exogenous polynucleotide encoding the polypeptide;
[0106] 7) codon optimization of the polynucleotide encoding the polypeptide;
[0107] 8) analyzing the tertiary structure of the polypeptide to select and modify or chemically modify exposed sites; or
[0108] 9) A combination of two or more selected from 1) to 8), but not particularly limited thereto.
[0109] More specifically, 1) increasing the number of copies of a polynucleotide encoding a polypeptide within a cell can be achieved by introducing a vector into a host cell that can replicate and function independently of the host, and to which a polynucleotide encoding the corresponding polypeptide is operably linked. Alternatively, such an increase can be achieved by introducing one copy, two or more copies of the polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell. Introduction into the chromosome can be achieved by introducing a vector capable of inserting the polynucleotide into the host cell chromosome, but is not limited thereto. The vector is as described above.
[0110] 2) Replacing the gene expression regulatory region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence exhibiting stronger activity can be, for example, by causing a variation in the sequence due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or by replacing it with a sequence exhibiting stronger activity, thereby further enhancing the activity of the expression regulatory region. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling transcription and translation termination, and the like. For example, the replacement may be replacing the original promoter with a stronger promoter, but is not limited thereto.
[0111] Examples of known strong promoters include cj1 to cj7 promoters (U.S. 7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. 10584338B2), O2 promoter (U.S. 10273491B2), tkt promoter, yccA promoter, etc., but are not limited thereto.
[0112] 3) Modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, replaced with a nucleotide sequence encoding another start codon having a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.
[0113] 4) and 5) modification of the amino acid sequence or polynucleotide sequence can be due to a deletion, insertion, non-conservative substitution or conservative substitution or a combination thereof of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or a substitution with an amino acid sequence or polynucleotide sequence that is improved to exhibit stronger activity, or a substitution with an amino acid sequence or polynucleotide sequence that is improved to be more active, thereby enhancing the activity of the polypeptide, but is not limited thereto. The replacement can be specifically carried out by inserting the polynucleotide into the chromosome through homologous recombination, but is not limited thereto. The vector used here can also include a selection marker for confirming chromosomal insertion. The selection marker is as described above.
[0114] 6) Introduction of an exogenous polynucleotide expressing polypeptide activity can be accomplished by introducing the exogenous polynucleotide into a host cell, wherein the polypeptide encoded by the exogenous polynucleotide exhibits the same or similar activity as the polypeptide. The exogenous polynucleotide is not limited to its source or sequence, as long as it exhibits the same or similar activity as the polypeptide. The introduction method can be performed by appropriately selecting a known transformation method used by those skilled in the art. As the introduced polynucleotide is expressed in the host cell, the polypeptide can be produced and its activity can be increased.
[0115] 7) Codon optimization of a polynucleotide encoding a polypeptide can be codon optimization of an endogenous polynucleotide to increase transcription or translation in a host cell, or codon optimization of an exogenous polynucleotide to optimize transcription and translation in a host cell.
[0116] 8) Analyzing the tertiary structure of a polypeptide to select and modify or chemically modify exposed sites can be, for example, performed by comparing the sequence information of the polypeptide to be analyzed with a database storing sequence information of known proteins, determining template protein candidates based on the degree of sequence similarity, confirming the structure based on the sequence, and modifying or chemically modifying the exposed sites to be modified or chemically modified.
[0117] Based on the activity or concentration of the polypeptide expressed in the wild type or microbial strain before modification, this enhancement of polypeptide activity can be an increase in the activity or concentration expression level of the corresponding polypeptide, or an increase in the amount of the product produced by the corresponding polypeptide, but is not limited thereto.
[0118] In the microorganisms of the present disclosure, some or all of the modifications of the polynucleotides can be induced by: (a) homologous recombination using a vector for chromosomal insertion in the microorganism, or genome editing using an engineered nuclease (e.g., CRISPR-Cas9), and / or (b) treatment with light (e.g., ultraviolet light and irradiation) and / or chemicals, but not limited thereto. Methods for modifying some or all of the genes can include methods using DNA recombination technology. For example, by introducing a nucleotide sequence or vector comprising a nucleotide sequence homologous to the gene of interest into the microorganism to cause homologous recombination, some or all of the genes can be deleted. The nucleotide sequence or vector to be introduced may comprise a dominant selection marker, but is not limited thereto.
[0119] Another aspect of the present disclosure provides a method for producing L-glutamic acid, the method comprising the step of culturing the microorganism of the present disclosure in a culture medium.
[0120] Specifically, the method for producing L-glutamic acid disclosed herein may include the step of culturing a microorganism comprising the variant disclosed herein, the polynucleotide disclosed herein, or the vector disclosed herein in a culture medium, but is not limited thereto.
[0121] As used herein, the term "cultivation" refers to growing the microorganisms of the present disclosure under appropriately adjusted environmental conditions. The cultivation procedures of the present disclosure can be carried out according to suitable culture media or culture conditions known in the art. Those skilled in the art can easily adjust and adapt such cultivation processes according to the selected strain. Specifically, the cultivation can be batch, continuous and / or fed-batch, but is not limited thereto.
[0122] As used herein, " culture medium " refers to the mixture containing the nutrients required for cultivating the microorganism of the present disclosure as the main component, wherein the culture medium provides the nutrients comprising the necessary water, growth factors, etc. for survival and growth. Particularly, for the culture medium and other culture conditions for cultivating the microorganism of the present disclosure, any culture medium that is generally used to cultivate microorganisms can be used, without particular limitation. However, the microorganism of the present disclosure can be cultivated in a general culture medium containing suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid and / or vitamin under aerobic conditions, while controlling temperature, pH value, etc. For example, the culture medium for Corynebacterium strains can be found in the literature [" Manual of Methods for General Bacteriology " (Washington, D.C., the U.S., 1981) of the American Bacteriological Society].
[0123] In the present disclosure, the carbon source may include carbohydrates such as glucose, sucrose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc.; and glycerol, propylene glycol, etc. In addition, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, bagasse, and corn steep liquor may be used, and in particular, carbohydrates such as glucose and aseptically pretreated molasses (i.e., molasses converted to reducing sugars) may be used, and various other carbon sources may be used in appropriate amounts without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0124] As the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition product, defatted soybean cake or its degradation product, etc. can be used. These nitrogen sources can be used alone or in combination of two or more, but are not limited thereto.
[0125] The phosphate source may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium salts. Inorganic compounds may include sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, and the like. Furthermore, amino acids, vitamins, and / or suitable precursors may also be included. These components or precursors may be added to the culture medium in batches or continuously. However, the present disclosure is not limited thereto.
[0126] In the process of cultivating microorganisms of the present disclosure, the pH of the culture medium can be regulated by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid in a suitable manner to the culture medium. In addition, a defoamer (such as fatty acid polyethylene glycol ester) can be added to suppress foam formation during cultivation. In addition, oxygen or oxygen-containing gas can be injected into the culture medium to maintain the aerobic state of the culture medium, or gas can not be injected, or nitrogen, hydrogen or carbon dioxide gas can be injected to maintain the anaerobic or non-aerobic state of the culture medium, but is not limited thereto.
[0127] In the culture of the present disclosure, the culture temperature may be maintained at 20° C. to 45° C., specifically, 25° C. to 40° C., and the culture may be continued until a desired amount of product is obtained, and may be performed for about 10 to 160 hours, but is not limited thereto.
[0128] L-glutamic acid produced by the culture of the present disclosure may be released into the culture medium, or may be retained in the cells.
[0129] In a specific embodiment, the method for producing L-glutamic acid of the present disclosure may further include, for example, before the culturing step, the step of preparing the microorganism of the present disclosure, preparing a culture medium for culturing the strain, or a combination of these steps (regardless of the order, in any order).
[0130] In a specific embodiment, the method for producing L-glutamic acid disclosed herein may further include a step of recovering L-glutamic acid from the cultured microorganism, the culture of the microorganism, the fermentation product of the microorganism, or the culture medium. A recovery step may also be included after the culture step.
[0131] Recovery can be a method of cultivating a microorganism according to the present disclosure, such as batch, continuous or fed-batch type cultivation, by collecting L-glutamic acid using suitable methods known in the art. For example, centrifugation, filtration, treatment with a crystalline protein precipitant (salting out), extraction, ultrasonic treatment, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography and affinity chromatography), HPLC and combinations of these methods can be used, and L-glutamic acid can be recovered from the culture medium or microorganism using suitable methods known in the art.
[0132] In addition, the method for producing L-glutamic acid of the present disclosure may further include a purification step. Purification can be performed by using a suitable method known in the art. In an exemplary embodiment, when the method for producing L-glutamic acid of the present disclosure includes a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously without regard to the order, or may be performed simultaneously or integrated into one step, but is not limited thereto.
[0133] In the methods disclosed herein, the variant polypeptides, polynucleotides, L-glutamic acid, etc. are described in other aspects.
[0134] Another aspect of the present disclosure provides a composition for producing L-glutamic acid, which comprises a variant polypeptide of the present disclosure; a polynucleotide encoding the variant polypeptide; a vector comprising the polynucleotide; or a microorganism comprising the variant polypeptide of the present disclosure, a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide; a culture of the microorganism; or a combination of two or more thereof.
[0135] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing L-glutamic acid, examples of which may include preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, isotonic agents, and the like, but are not limited thereto.
[0136] In a specific embodiment, the various components present in the compositions of the present disclosure may be included in microbiologically effective amounts, or in amounts that may be suitably present in the composition for manufacture.
[0137] In the compositions of the present disclosure, the variant polypeptides, polynucleotides, L-glutamic acid, etc. are described in other aspects.
[0138] Another aspect of the present disclosure provides use of a microorganism comprising the variant polypeptide of the present disclosure, a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide for producing L-glutamic acid.
[0139] In the present disclosure, the variant polypeptides, polynucleotides, vectors, microorganisms, L-glutamic acid, etc. are described in other aspects.
[0140] [Mode for Carrying Out the Invention]
[0141] The present disclosure will be described in more detail below by way of exemplary embodiments. However, the following exemplary embodiments are merely intended to illustrate preferred embodiments of the present disclosure and are not intended to limit the scope of the present disclosure thereto. Furthermore, those skilled in the art or similar technical fields to which the present disclosure pertains can fully understand and readily implement technical matters not described in this specification.
[0142] Example 1. Screening of mutant strains with increased glutamate production capacity by artificial mutation method Example 1-1. Inducing artificial mutation by UV irradiation
[0143] In order to screen for mutant strains with improved glutamate (the target product of fermentation) production capacity, wild-type Corynebacterium glutamicum (ATCC13869) was first plated on a nutrient medium containing agar and cultured for 16 hours at 30° C. Hundreds of colonies thus obtained were irradiated with UV light at room temperature to induce random mutations in the strain genome.
[0144] Example 1-2. Fermentation titer experiment of mutagenized strains and screening strains
[0145] The fermentation titer test was performed on the mutant strain in which random mutations were induced in Example 1-1.
[0146] Each colony was subcultured in a nutrient medium and then cultured in a fermentation medium for 5 hours. 25% tween 40 was then added to each medium at a concentration of 0.4%, and each colony was cultured for an additional 32 hours.
[0147] <Nutrient medium>
[0148] 1% glucose, 0.5% meat extract, 1% polypeptone, 0.25% sodium chloride, 0.5% yeast extract, 2% agar, 0.2% urea, pH 7.2
[0149] <Fermentation medium>
[0150] 6% glucose, 5% calcium carbonate, 2.25% ammonium sulfate, 0.1% potassium dihydrogen phosphate, 0.04% magnesium sulfate, 10mg / L ferrous sulfate, 0.3mg / L biotin, 0.2mg / L thiamine hydrochloride
[0151] Under these conditions, cultivate each bacterium colony, screen and produce L-glutamic acid and be equal to or higher than the mutant strain of wild-type Corynebacterium glutamicum (ATCC13869).After this, use HPLC to measure the L-glutamic acid concentration of selected mutant strain.The L-glutamic acid concentration measured is shown in table 1 below.
[0152] [Table 1]
[0153]
[0154]
[0155] Referring to Table 1, "ATCC13869-y1" and "ATCC13869-y11" were selected as mutant strains showing increased glutamate production compared to the wild-type strain.
[0156] Example 2. Identification of mutations by gene sequencing
[0157] In order to identify the gene mutations of the mutant strains, the genes of the ATCC13869-y1 and ATCC13869-y11 strains screened in Example 1-2 were compared with the genes of the wild-type strain.
[0158] As a result, it was confirmed that the ATCC13869-y1 and ATCC13869-y11 strains had the same mutation at a specific position of the gene dtxR (SEQ ID NO: 2) encoding the Mn-dependent transcriptional regulator (nucleotide 479 of the polynucleotide sequence represented by SEQ ID NO: 2 was substituted with A).
[0159] Therefore, in the following Examples 3 and 4, it was intended to determine whether the mutation affects the amount of glutamic acid produced by a microorganism of the genus Corynebacterium.
[0160] Example 3. Preparation of mutagenic strains and detection of glutamate production
[0161] Example 3-1. Preparation of mutagenic strains
[0162] The purpose was to prepare a mutant strain into which the mutation identified in Example 2 above was introduced. Specifically, in order to introduce the mutation (nucleotide 479 of the polynucleotide sequence represented by SEQ ID NO: 2 was replaced with A) into wild-type Corynebacterium glutamicum (ATCC 13869 and ATCC 13032), a vector for gene replacement was constructed to replace glycine with aspartic acid at position 160 of the Mn-dependent transcriptional regulator represented by SEQ ID NO: 1 in these strains. Using genomic DNA from ATCC 13869 as a template, a gene fragment for constructing the vector was obtained by PCR. Primers containing the polynucleotides of SEQ ID NOS: 5 to 8 were prepared based on information on the gene and nearby nucleotide sequences of Corynebacterium glutamicum (ATCC 13869) registered in the NIH GenBank.
[0163] PCR was performed by denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 20 seconds, annealing at 55°C for 20 seconds, and polymerization at 72°C for 30 seconds, followed by polymerization at 72°C for 5 minutes. Specifically, a 500-bp polynucleotide amplified using primers of SEQ ID NOS: 5 and 6 and a 500-bp polynucleotide amplified using primers of SEQ ID NOS: 7 and 8 were obtained. The two gene fragments thus obtained were ligated using a fusion enzyme to the pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) digested with the restriction enzymes BamHI and SalI to prepare a gene replacement vector designated "pDZ-dtxR(G160D)." The primer sequences used to construct the above vector are shown in Table 2 below.
[0164] [Table 2]
[0165] SEQ ID NO. Primer name 5'-3' sequence 5 dtxR(G160D)-AF CGGTACCCGGGGATCCGCATAAATTGAGTTTGG 6 dtxR(G160D)-AR ATCGATGGCACGAACGTCGGAATCAGGCTCATCTG 7 dtxR(G160D)-BF ACGTTCGTGCCATCGATCTGCCTCTCGGTGAGAAC 8 dtxR(G160D)-BR ATGCCTGCAGGTCGACGGGCTTTTCCACTGATTCG
[0166] 160D) ".
[0167] Example 3-2. Detection of glutamate production
[0168] The mutant strains ATCC13869::dtxR(G160D) and ATCC13032::dtxR(G160D) prepared by Example 3-1 and their respective wild-type Corynebacterium glutamicum (ATCC13869 and ATCC13032) were cultured in the same manner as in Example 1-2.
[0169] After the culture was completed, the L-glutamic acid concentration in each culture medium was measured. The measured L-glutamic acid concentrations are shown in Table 3 below.
[0170] [Table 3]
[0171]
[0172]
[0173] As shown in Table 3, it was confirmed that the concentration of L-glutamic acid produced by the mutation-introduced Corynebacterium glutamicum ATCC13869::dtxR(G160D) strain was about 2.1 g / L (about 29%) higher than that produced by the wild-type Corynebacterium glutamicum ATCC13869.
[0174] It was also confirmed that the concentration of L-glutamic acid produced by the mutation-introduced Corynebacterium glutamicum ATCC13032::dtxR(G160D) strain was about 0.9 g / L (about 27%) higher than that produced by the wild-type Corynebacterium glutamicum ATCC13032.
[0175] In other words, it was confirmed that the variants of the present disclosure increased the L-glutamic acid-producing ability of the microorganism.
[0176] Example 4. Detection of glutamate production in KFCC11074 strain with introduced mutation
[0177] Example 4-1. Preparation of mutagenic strains
[0178] To examine whether this mutation has the same effect in strains having increased glutamate production ability in addition to the wild-type strain, this mutation was intended to be introduced into KFCC11074 strain (Korean Patent Publication No. 10-0292299), which is known as a glutamate-producing strain.
[0179] Specifically, the pDZ-dtxR (G160D) vector prepared in Example 3-1 was transformed into the KFCC11074 bacterial strain by homologous recombination on the chromosome to replace the aspartic acid at position 160 of the SEQ ID NO: 1 contained in the above-mentioned bacterial strain with glycine (van der Rest et al., Appl Microbiol Biotechnol 52: 541-545, 1999). The bacterial strain in which the vector was inserted into the chromosome by homologous recombination was screened in a culture medium containing 25 mg / L kanamycin. After this, the Corynebacterium glutamicum transformant that had completed secondary recombination was subjected to sequencing analysis, confirming that the target mutation was introduced into the bacterial strain, and the bacterial strain into which the mutation was introduced was named "KFCC11074-dtxR (G160D)".
[0180] Example 4-2. Detection of glutamate production
[0181] Corynebacterium glutamicum KFCC11074 into which no mutation had been introduced and KFCC11074_dtxR(G160D) into which the mutation had been introduced according to Example 4-1 were cultured in the same manner as in Example 1-2.
[0182] After the culture was completed, the L-glutamic acid concentration in each culture medium was measured. The measured L-glutamic acid concentrations are shown in Table 4 below.
[0183] [Table 4]
[0184] Strain name L-glutamic acid (g / L) KFCC11074 5.4 KFCC11074_dtxR(G160D) 8.9
[0185] As shown in Table 4, it was confirmed that the concentration of L-glutamic acid produced by the mutation-introduced Corynebacterium glutamicum KFCC11074_dtxR(G160D) strain was about 3.5 g / L (about 64%) higher than that produced by Corynebacterium glutamicum KFCC11074 without the mutation.
[0186] In other words, it was confirmed that the mutation disclosed herein also increased the L-glutamic acid-producing ability of the microorganism in the strain having increased glutamic acid-producing ability.
[0187] In summary, by enhancing the activity of Mn-dependent transcriptional regulatory factors in wild-type or glutamate-producing strains through the activity of mutated genes, the variants disclosed herein can increase the production capacity of the fermentation target product glutamate, and therefore, can be used in various industrial fields for high-yield production of glutamate.
[0188] Based on the above description, it will be understood by those skilled in the art that the present disclosure can be implemented in different specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the above embodiments are not restrictive, but illustrative in all aspects. The scope of the present disclosure is defined by the appended claims rather than by the description before them, and all changes and modifications that fall within the boundaries and scope of the claims, or equivalent replacements of these boundaries and scopes, are covered by the claims.
Claims
1. A manganese-dependent transcriptional regulator variant polypeptide, wherein the amino acid corresponding to position 160 of SEQ ID NO: 1 is replaced by a different amino acid.
2. The variant polypeptide according to claim 1, wherein the amino acid corresponding to position 160 of SEQ ID NO: 1 is substituted by aspartic acid.
3. The variant polypeptide according to claim 1, wherein the variant polypeptide consists of the amino acid sequence of SEQ ID NO:
3. A polynucleotide encoding the variant polypeptide according to any one of claims 1 to 3. 5 . A microorganism comprising the variant polypeptide according to claim 1 , a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide.
6. The microorganism according to claim 5, wherein the microorganism has enhanced L-glutamic acid-producing ability compared to a microorganism comprising the polypeptide of SEQ ID NO: 1 or a polynucleotide encoding the same. The microorganism according to claim 5 , wherein the microorganism is a microorganism of the genus Corynebacterium . The microorganism according to claim 7 , wherein the Corynebacterium microorganism is Corynebacterium glutamicum .
9. A method for producing L-glutamic acid, comprising the step of culturing the microorganism according to claim 5 in a culture medium.
10. The method according to claim 9, further comprising the step of recovering L-glutamic acid from the cultured microorganism, the culture of the microorganism, the fermentation product of the microorganism, or the culture medium.
11. 1 kinds of compositions for the production of L-Glutamic acid, described compositions comprises the variant polypeptide according to any one in claim 1 to 3; The polynucleotide of encoding described variant polypeptide; The carrier that comprises described polynucleotide; The polynucleotide that comprises described variant polypeptide, described encoding described variant polypeptide or the described microorganism that comprises described polynucleotide; The culture of described microorganism; Or its two or more combination.
12. Use of a microorganism comprising a variant polypeptide according to any one of claims 1 to 3, a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide for producing L-glutamic acid.
Citation Information
Patent Citations
Microorganism producing glutamic acid and process for preparation glutamic acid using the same
KR100292299B1
A corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR100924065B1
Method for producing L-lysine or L-threonine usingEscherichia bacteria having attenuated malic enzymeactivity
KR101208480B1
Promoter and uses thereof
US10273491B2
Promoter and use thereof
US10584338B2