Engineered OMNI-50 nuclease variants

Abstract

The present invention provides a composition comprising a non-natural nuclease variant having at least 90% identity to SEQ ID NO: 1 and comprising at least one amino acid substitution relative to SEQ ID NO: 1 at the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779.

Description

[0001] This application claims the benefit of: (i) U.S. Provisional Application No. 63 / 483,851, filed February 8, 2023; (ii) U.S. Provisional Application No. 63 / 491,380, filed March 21, 2023; (iii) U.S. Provisional Application No. 63 / 511,795, filed July 3, 2023; and (iv) U.S. Provisional Application No. 63 / 511,927, filed July 5, 2023, the contents of each of which are incorporated herein by reference.

[0002] Throughout this application, various publications are cited, including references in parentheses. The disclosures of all publications mentioned in this application are incorporated herein by reference in their entirety to provide additional information on the field to which the invention pertains and the features of the art to which the invention may be applied. References to sequence listings

[0003] This application incorporates by reference the nucleotide sequence in the file named "102322_040393_PCT_Eng_Omni_50_Variants.xml", which is 462,633 bytes in size and was created on July 5, 2023 in IBM-PC machine format, compatible with MS-Windows operating systems, and is included as part of this application in the XML file filed on February 8, 2024. Field of the Invention

[0004] In particular, the present invention relates to compositions and methods for genome editing. Background of the Invention

[0005] Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems of bacterial and archaeal adaptive immunity display extreme diversity in protein composition and genomic loci architecture. CRISPR systems have become important tools for research and genome engineering. However, many details of CRISPR systems remain undetermined, and the applicability of CRISPR nucleases may be limited by sequence-specific requirements, expression, or delivery challenges. Different CRISPR nucleases have different characteristics, such as size, PAM site, on-target activity, specificity, cleavage pattern (e.g., blunt ends, staggered ends), and prominent patterns of indel (insertion-deletion) formation after cleavage. Different sets of characteristics can be used for different applications. For example, some CRISPR nucleases may be able to target specific genomic loci that other CRISPR nucleases cannot target due to PAM site restrictions. In addition, some currently used CRISPR nucleases exhibit pre-immunity, which may limit in vivo applicability. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Therefore, it is important to discover, engineer, and improve novel CRISPR nucleases and the RNA molecules that activate and target them. Summary of the Invention

[0006] Disclosed herein are engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated OMNI-50 nucleases with improved activity and their use in genome engineering, epigenome engineering, genome targeting, genome editing, and in vitro diagnostics.

[0007] According to some aspects of the present invention, there are provided OMNI-50 nuclease variants having improved activity and / or specificity compared to wild-type OMNI-50 nucleases, and methods of using the improved variants. Advantageously, when the engineered variant OMNI-50 nuclease is active in a CRISPR endonuclease system, the CRISPR endonuclease system shows increased on-target editing activity relative to the wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. For example, an engineered variant OMNI-50 nuclease can show improved nuclease activity at a target region containing a heterozygous SNP that is present only in the target allele and not in the non-target allele. In some embodiments, the engineered variant OMNI-50 nuclease has a reduced off-target effect.

[0008] According to some embodiments of the present invention, there is provided a variant of an OMNI-50 nuclease protein, the variant comprising a sequence at least 80% identical to the amino acid sequence of a wild-type OMNI-50 nuclease protein (SEQ ID NO: 1).

[0009] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. Each possibility represents a separate embodiment of the present disclosure and can be combined in any combination.

[0010] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant that is at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: G614, N698, E836, T939, and L1100. Each possibility represents a separate embodiment of the present disclosure and can be combined in any combination.

[0011] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: D252, D281, L302, N368, L1100, and S1339. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0012] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, or 8 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, S779, E836, T939, L1100, and S1339. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0013] In some embodiments, the non-naturally occurring OMNI-50 nuclease variants exhibit improved activity fidelity and / or targeting compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variants comprise an amino acid substitution at position L1100 compared to SEQ ID NO: 1. In some embodiments, such variants further comprise at least 1, 2, 3, 4, or 5 substitutions at the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939. In some embodiments, such variants further comprise at least 1, 2, 3, 4, or 5 substitutions at the following positions compared to SEQ ID NO: 1: D252, D281, L302, N368, and S1339. In some embodiments, such variants further comprise an amino acid substitution at position S779 compared to SEQ ID NO: 1.

[0014] In some embodiments, the non-naturally occurring OMNI-50 nuclease variants exhibit increased specificity compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variants comprise an amino acid substitution at position S1339 compared to SEQ ID NO: 1. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939, and L1100. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, or 4 of the following positions compared to SEQ ID NO: 1: D252, D281, L302, and N368. In some embodiments, such variants further comprise an amino acid substitution at position S779 compared to SEQ ID NO: 1.

[0015] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant exhibits increased stability compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variant comprises an amino acid substitution at position S779 compared to SEQ ID NO: 1.

[0016] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0017] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, or 6 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, and L1100F. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0018] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, or 6 of the following amino acid substitutions compared to SEQ ID NO: 1: D252Y, D281V, L302N, N368S, L1100F, and S1339R. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0019] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, 6, 7, or 8 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0020] According to an embodiment of the present invention, a composition is provided, comprising a non-natural nuclease variant having at least 90% identity to SEQ ID NO: 1 and comprising an amino acid substitution at at least one of the following positions relative to SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figures 1A-1D V6552 and V6172 showed increased activity and specificity for the ELANE_g58Ref target site in homozygous cell lines. The proteins were tested in HSC cells homozygous for ELANE g58Ref. The total editing percentage (%) at the target and off-target sites was calculated by next-generation sequencing (NGS) as the indel frequency in the total aligned reads. (A) On-target of g58RefV6552 compared to WT OMNI-50. (B) On-target of g58RefV6172 compared to WT OMNI-50. (C) Off-target of g58RefV6552 compared to WT OMNI-50. (D) Off-target of g58RefV6172 compared to WT OMNI-50.

[0022] Figures 2A-2CV6552 and V6172 show broad activity against diverse targets. (A) WT OMNI-50 and V6552 were tested against diverse targets (Table 5) in Jurkat cells, and the percent total editing was calculated by NGS as the frequency of indels in the total aligned reads. (B) WT OMN I-50 and V6552 were tested against ELANE_g38 (Table 5) in HSCs, and the percent total editing was calculated by NGS as the frequency of indels (insertions / deletions) in the total aligned reads. (C) WT OMN I-50 and V6172 were tested against ELANE_g38 (Table 5) in Jurkat cells, and the percent total editing was calculated by NGS as the frequency of indels in the total aligned reads.

[0023] Figures 3A-3E .V6552 and V6172 show increased discrimination for the selected target site (ELANE_g58Ref) in heterozygous cell lines. Proteins were tested in HSC heterozygous cells with ELANE g58Ref or g58Alt. The total editing percentage (%) at the target site and off-target sites was calculated by NGS as the indel frequency in the total aligned reads. Discrimination was determined by the reduction in the fraction of non-edited target alleles compared to the non-target alleles. (A) Unedited fraction for each allele (Alt or Ref) and on-target of g58Ref or g58Alt for WT OMNI-50 and V6552. (B) Off-target of g58Ref for V6552 compared to WT OMNI-50. (C) Unedited fraction for each allele (Alt or Ref) and on-target of g58Ref or g58Alt for WT OMNI-50 and V6172. (E) V6172 versus g58Ref off-target of WTOMNI-50. The V6172 optimized nuclease variant is active and discriminatory, showing reduction of the alternative allele while the reference allele remains intact.

[0024] Figures 4A-4D V6172 and V6552 also showed enhanced discrimination at other target sites in heterozygous cell lines. The proteins were tested in heterozygous HSC cells with ELANE_g62Ref. The total editing percentage (%) at target and off-target sites was calculated by NGS as the indel frequency in the total aligned reads. (A) On-target of g62Ref for WT OMNI-50 and V6552. (B) Off-target of g62Ref for V6552 compared to WT OMNI-50. (C) On-target of g62Ref for WT OMNI-50 and V6172. (D) Off-target of g62Ref for V6172 compared to WT OMNI-50.

[0025] Figures 5A-5B V6172 demonstrated higher fidelity than WT OMNI-50 at another tested site. The protein was tested in HSC cells heterozygous for ELANE_g35. The total percentage (%) of editing at both on-target and off-target sites was calculated by NGS as the indel frequency in the total aligned reads. (A) On-target ELANE_g35 for WT OMNI-50 and V6172. (B) Off-target ELANE_g35 for V6172 compared to WT OMNI-50.

[0026] Figures 6A-6B Single mutations in V6552 that result in increased activity. Variants containing only the single mutation present in V6552 were tested in ELANE_g58Ref homozygous HSC cells, and editing levels at on-target (A) and off-target (B) sites were calculated using NGS as indel frequencies among total aligned reads. Mutations L1100F (V7896) and S1339R (V7101) contributed primarily to activity, and a variant containing both mutations (V7492) had similar activity to V6552. S1339R contributed to specificity, as demonstrated by lower off-target editing of V7101.

[0027] Figures 7A-7B .Removal of individual mutations from V6552 and their contribution to activity and specificity. Variants containing five of the six mutations present in V6552 were tested in homozygous ELANE_g58Ref HSC cells, and editing levels at on-target (A) and off-target (B) sites were calculated using NGS as indel frequencies in total aligned reads. Removal of L1100F or S1339R (V7257 and V7256, respectively) reduced activity relative to V6552, highlighting the importance of those mutations for activity. D252Y and L302N contribute to specificity, as demonstrated by increased off-target editing (B) when they are removed (V7253 and V7255, respectively).

[0028] Figures 8A-8B . Fidelity of single mutations in V6172 that result in increased activity and fidelity. Variants containing only single mutations present in V6172 were tested in HSC cells homozygous for ELANE_g58Ref, and editing levels at on-target (A) and off-target (B) sites were calculated using NGS as indel frequencies in total aligned reads. Mutation L1100F appeared to contribute the most to activity. Other mutations provided additional increases in activity. Single mutants N300A (V7239), N698L (V7241), and T939L (V7243) showed reduced off-target levels, suggesting their role in fidelity ( Figure 8B ).

[0029] Figures 9A-9B .Removal of individual mutations from V6172 and their contribution to activity and specificity. Variants containing five of the six mutations from V6172 were tested in homozygous ELANE_g58Ref HSC cells, and editing levels at on-target (A) and off-target (B) sites were calculated using NGS as indel frequencies in total aligned reads. Removal of L1100F (V7143) reduced activity relative to V6172, highlighting the importance of this mutation for activity. When only one of the mutations was removed, N300A (V7138), N698L (V7140), and T939L (V7142) were shown to increase off-target editing compared to V6172 (B), demonstrating the contribution of these mutations to fidelity.

[0030] Figure 10 .Removal of single mutations from V6172 and their contribution to discrimination. Variants containing five of the six mutations from V6172 were tested in heterozygous ELANE_g58Alt HSC cells, and the editing level of the target site was calculated using NGS as the indel frequency in the total aligned reads. Discrimination was determined by the reduction in the fraction of the non-edited target allele compared to the non-target allele. The unedited fraction for each allele (Alt or Ref) and the on-target editing of g58Alt for each variant are shown. When only one of the mutations was removed, N300A (V7138), N698L (V7140), and T939L (V7142) were shown to reduce discrimination compared to V6172, as shown by the reduction in the non-edited fraction of the non-target allele (Ref). These data show that mutations also contribute to nuclease discrimination.

[0031] Figure 11 Mutation S779P increases the thermostability of OMNI-50. The S779P mutation was introduced into WT OMNI-50 (forming variant V7261) and variant V6552 (forming variant V7281). The thermostability of each protein was tested at elevated temperatures by incubating the protein at 25°C and 44°C and measuring the percent residual activity (as indicated by DNA cleavage).

[0032] Figures 12A-12BVariants V6552, V6172, and V7765 showed increased activity in cell lines homozygous for the RPE65 and VEGF_A3 targets. The proteins were tested in HSC cells homozygous for the RPE65_g13 and VEGF_A3_g10 targets. The total editing percentage (%) at the target and off-target sites was calculated by next-generation sequencing (NGS) as the indel frequency in the total aligned reads. (A) V6552, V6172, V7765 on-target for RPE65 compared to WT OMNI-50. (B) V6552, V6172, V7765 on-target for VEGF3 compared to WT OMNI-50.

[0033] Figures 13A-13I Variants V6552, V6172, and V7765 showed increased activity and specificity in cell lines homozygous for other target sites (ELANE_g62Ref, ELANE_g58Ref, SARM1, and FANCF). The proteins were tested in HSC cells homozygous for ELANE_g62Ref and ELANE_g58Ref, as well as in SH-SY5Y cells harboring SARM1. The total editing percentage (%) at target and off-target sites was calculated by next-generation sequencing (NGS) as the indel frequency in the total aligned reads. (A) On-target of ELANE_g62Ref for V6552, V6172, and V7765 compared to WT OMNI-50. (B) Off-target of ELANE_g62Ref for V6552, V6172, and V7765 compared to WT OMNI-50. (C) ELANE_g62Ref off-target 2 of V6552, V6172, and V7765 compared to WT OMNI-50. (D) ELANE_g58Ref on-target of V6552, V6172, and V7765 compared to WT OMNI-50. (E) ELANE_g58Ref off-target of V6552, V6172, and V7765 compared to WT OMNI-50. (F) SARM1 on-target of V6552, V6172, and V7765 compared to WT OMNI-50. (G) SARM1 off-target of V6552, V6172, and V7765 compared to WT OMNI-50. (H) FANCF on-target of V6552, V6172, and V7765 compared to WT. (I) FANCF off-target of V6552, V6172, and V7765 compared to WT OMNI-50. DETAILED DESCRIPTION

[0034] Disclosed herein are engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated OMNI-50 nuclease variants with altered and improved characteristics and their use in genome engineering, epigenome engineering, genome targeting, genome editing, and in vitro diagnostics.

[0035] According to an embodiment of the present invention, a composition is provided, comprising a non-natural nuclease variant having at least 90% identity to SEQ ID NO: 1 and comprising an amino acid substitution at at least one of the following positions relative to SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. In some embodiments, the nuclease variant comprises an amino acid substitution at at least one of the following positions: L1100, S1339, and / or S779.

[0036] In some embodiments, the nuclease variant comprises an amino acid substitution at L1100.

[0037] In some embodiments, the nuclease variant comprises an amino acid substitution at S1339.

[0038] In some embodiments, the nuclease variant comprises amino acid substitutions at positions L1100 and S1339.

[0039] In some embodiments, the nuclease variant comprises an amino acid substitution at S779.

[0040] In some embodiments, the nuclease variant comprises an amino acid substitution at each of positions L1100, S1339, and S779.

[0041] In some embodiments, the nuclease variant comprises an amino acid substitution at position L1100, and the amino acid substituted for leucine is histidine (H), phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0042] In some embodiments, the nuclease variant comprises an amino acid substitution at position L1100, and the amino acid substituted for the leucine is phenylalanine (L1100F).

[0043] In some embodiments, the nuclease variant comprises an amino acid substitution at position S1339, and the amino acid substituted for serine is arginine (R), lysine (K), or histidine (H).

[0044] In some embodiments, the nuclease variant comprises an amino acid substitution at position S1339, and the amino acid substituted for serine is arginine (S1339R).

[0045] In some embodiments, the nuclease variant comprises an amino acid substitution at position S779, and the amino acid replacing the serine is glycine (G), alanine (A), valine (V), cysteine ​​(C), proline (P), leucine (L), isoleucine (I), methionine (M), tryptophan (W), phenylalanine (F), aspartic acid (D), asparagine (N), or histidine (H).

[0046] In some embodiments, the nuclease variant comprises an amino acid substitution at position S779, and the amino acid substituted for serine is proline (S779P).

[0047] In some embodiments, the nuclease variant comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, and L1100.

[0048] In some embodiments, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, and L1100F.

[0049] In some embodiments, the nuclease variant comprises an amino acid substitution at at least one of the following positions: D252, D281, L302, N368, L1100, and S1339.

[0050] In some embodiments, the nuclease variant comprises at least one of the following amino acid substitutions: D252Y, D281V, L302N, N368S, L1100F, and S1339R.

[0051] In some embodiments, the nuclease variant comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, S779, E836, T939, L1100, and S1339.

[0052] In some embodiments, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

[0053] In some embodiments, the nuclease variant has a wild-type OMNI-50 protein sequence (SEQ ID NO: 1) comprising an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0054] In some embodiments, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

[0055] In some embodiments, the nuclease variant comprises the amino acid sequence of any one of SEQ ID NOs: 2-30.

[0056] In some embodiments, the nuclease variant further comprises at least one nuclear localization sequence (NLS).

[0057] In some embodiments, the nuclease variant further comprises at least one affinity tag.

[0058] In some embodiments, the nuclease variant is linked to another protein to form a fusion protein.

[0059] In some embodiments, the nuclease variant is a nickase or is catalytically inactive.

[0060] According to an embodiment of the present invention, there is also provided a composition comprising a polynucleotide encoding any one of the nuclease variants described herein, preferably wherein the polynucleotide is a DNA or RNA molecule, preferably an mRNA molecule.

[0061] In some embodiments, the composition further comprises a single guide RNA (sgRNA) molecule, a crRNA molecule, and / or a tracrRNA molecule, or a DNA molecule encoding a single guide RNA (sgRNA) molecule, a crRNA molecule, and / or a tracrRNA molecule.

[0062] According to an embodiment of the present invention, there is also provided a method for binding to and / or modifying a DNA target site in a cell or a cell-free system, the method comprising delivering any one of the compositions described herein to the cell or the cell-free system.

[0063] In some embodiments, the binding and / or modification occurs in a eukaryotic cell or a prokaryotic cell.

[0064] In some embodiments, the mammalian cell is a human cell.

[0065] In some embodiments, the DNA target site is located within or near a disease-causing allele of a gene.

[0066] In some embodiments, the DNA target site is located in a gene selected from the group consisting of ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, Rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDLR, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7, and HLA-E.

[0067] In some embodiments, an exogenous donor molecule is used to repair the DNA target.

[0068] In some embodiments, the exogenous donor molecule is an RNA or DNA molecule.

[0069] In some embodiments, off-target editing activity is reduced by at least 2-fold, 10-fold, 10-fold, or 10-fold relative to wild-type nuclease (SEQ ID NO: 1). 2 times, 10 3 times, 10 4 times, 10 5 times or 10 6 times.

[0070] According to an embodiment of the present invention, there is also provided a modified cell obtained by any of the methods described herein.

[0071] In some embodiments, the cells are capable of transplantation.

[0072] In some embodiments, the cells are capable of producing progeny cells upon transplantation.

[0073] In some embodiments, the cells are capable of producing progeny cells following autologous transplantation.

[0074] In some embodiments, the cells are capable of producing progeny cells for at least 12 months or at least 24 months after transplantation.

[0075] In some embodiments, the cell is selected from the group consisting of a hematopoietic stem cell, a progenitor cell, a CD34+ hematopoietic stem cell, a bone marrow cell, and a peripheral mononuclear cell.

[0076] According to an embodiment of the present invention, there is also provided a composition comprising any one of the modified cells described herein and a pharmaceutically acceptable carrier.

[0077] According to an embodiment of the present invention, there is also provided an in vitro or ex vivo method for preparing a composition, which comprises mixing cells with a pharmaceutically acceptable carrier.

[0078] In some embodiments, OMNI-50 nuclease variants having increased specificity and / or activity and / or stability compared to wild-type OMNI-50 nuclease (SEQ ID NO: 1, which is encoded by the polynucleotide set forth in SEQ ID NO: 31) are provided, as well as methods of using the improved variants. In some embodiments, the increased specificity is increased fidelity. In some embodiments, the increased specificity is increased discrimination. For example, in some embodiments, when targeting a sequence in a mutant allele relative to the wild-type OMNI-50 nuclease, the OMNI-50 variant nuclease exhibits enhanced discrimination relative to the corresponding functional allele. In some embodiments, OMNI-50 nuclease variants having increased activity compared to the wild-type OMNI-50 nuclease, as well as methods of using the improved variants are provided. In some embodiments, OMNI-50 nuclease variants having increased stability compared to the wild-type OMNI-50 nuclease are provided. As used herein, the term "stability" includes storage stability and stability during use, such as during a washing process, and reflects the stability of a variant according to the present invention as a function of time, for example, how much activity is retained when the variant is maintained under various conditions. Stability is affected by many factors, such as pH, temperature, specific solution, detergent composition. Non-limiting examples of increased / improved stability include increased thermal stability / thermostability (i.e., increased ability to tolerate high temperatures without degradation), increased half-life under different conditions (different buffers, salt concentrations, pH), proteins that are less prone to aggregation under different buffers and salt concentrations, and higher yields when purifying proteins.

[0079] Advantageously, when the engineered variant OMNI-50 nuclease is active in a CRISPR endonuclease system, the CRISPR endonuclease system exhibits increased stability, activity, and increased specificity relative to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. In some embodiments, the increased specificity is increased fidelity, and the variant exhibits reduced off-target editing activity relative to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. In some embodiments, the increased specificity is increased discrimination, and the variant exhibits increased allele-specific editing activity relative to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. For example, an engineered variant OMNI-50 nuclease can exhibit improved allele-specific discrimination, such as specific binding and activity, in a target region containing a heterozygous SNP that is present only in the target allele and not in the non-target allele.

[0080] In some embodiments, OMNI-50 nickase variants are provided that have increased stability and / or specificity and / or increased activity compared to wild-type OMNI-50 nickase. In some embodiments, variants of OMNI-50 dead nucleases are provided that have increased stability and / or specificity and / or increased targeting activity compared to wild-type OMNI-50 dead nuclease. For example, the catalytic site of any of the OMNI-50 nucleases provided herein can be modified such that the variant has nickase activity, enabling it to cleave single-stranded DNA. Alternatively, the catalytic site of any of the OMNI-50 nucleases provided herein can be modified such that the variant does not have nuclease activity, i.e., is an inactive nuclease.

[0081] According to some embodiments of the present invention, there is provided a variant of an OMNI-50 nuclease protein, the variant comprising a sequence having at least 80% identity to the amino acid sequence of a wild-type OMNI-50 nuclease protein (SEQ ID NO: 1).

[0082] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising an amino acid substitution at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. Each possibility represents a separate embodiment of the present disclosure and can be combined in any manner. Any combination of amino acids in the twelve positions described above in the OMNI-50 nuclease variant can be substituted with a different amino acid. Amino acids in positions other than the twelve positions described above can also be substituted such that the OMNI-50 nuclease variant has at least 80%, 85%, 90%, 95% or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1).

[0083] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939, and L1100. Each possibility represents a separate embodiment of the present disclosure and can be combined in any combination.

[0084] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: D252, D281, L302, N368, L1100, and S1339. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0085] In some embodiments, the present invention provides a composition comprising a non-naturally occurring OMNI-50 nuclease variant having at least 80%, 85%, 90%, 95%, or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, or 8 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, S779, E836, T939, L1100, and S1339. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0086] In some embodiments, the non-naturally occurring OMNI-50 nuclease variants exhibit improved activity fidelity and / or targeting compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variants comprise an amino acid substitution at position L1100 compared to SEQ ID NO: 1. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, 4, or 5 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, 4, or 5 of the following positions compared to SEQ ID NO: 1: D252, D281, L302, N368, and S1339. In some embodiments, such variants further comprise substitutions at position S779 compared to SEQ ID NO: 1.

[0087] In some embodiments, the non-naturally occurring OMNI-50 nuclease variants exhibit increased specificity compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variants comprise an amino acid substitution at position S1339 compared to SEQ ID NO: 1. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, 4, 5, or 6 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, E836, T939, and L1100. In some embodiments, such variants further comprise substitutions at at least 1, 2, 3, or 4 of the following positions compared to SEQ ID NO: 1: D252, D281, L302, and N368. In some embodiments, such variants further comprise substitutions at position S779 compared to SEQ ID NO: 1.

[0088] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant exhibits increased thermostability compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variant comprises an amino acid substitution at position S779 compared to SEQ ID NO: 1.

[0089] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0090] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, or 6 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, and L1100F. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0091] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, or 6 of the following amino acid substitutions compared to SEQ ID NO: 1: D252Y, D281V, L302N, N368S, L1100F, and S1339R. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0092] In some embodiments, the present invention provides a non-naturally occurring OMNI-50 nuclease variant having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least 1, 2, 3, 4, 5, 6, 7, or 8 of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. Each possibility represents a separate embodiment of the present disclosure and can be arbitrarily combined in any combination.

[0093] According to some embodiments of the present invention, a non-naturally occurring OMNI-50 nuclease variant is provided, the variant having at least 80%, 85%, 90%, 95% or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising an amino acid substitution at at least one of the following positions compared to SEQ ID NO: 1: N300, G614, N698, S779, E836, T939, L1100 and S1339. In some embodiments, a non-naturally occurring OMNI-50 nuclease variant is provided, the variant comprising an amino acid substitution at at least 1, 2, 3, 4, 5, 6, 7 or 8 of the following positions compared to SEQ ID NO: 1: N300, G614, N698, S779, E836, T939, L1100 and S1339. Each possibility represents a separate embodiment of the present disclosure and can be combined in any combination.

[0094] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises an amino acid substitution at position S779 compared to SEQ ID NO: 1. In some embodiments, such variants exhibit improved stability compared to a comparable / identical sequence lacking the substitution and / or compared to wild-type OMNI-50 (SEQ ID NO: 1). In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises an amino acid substitution at position S779 compared to SEQ ID NO: 1 and additional 1, 2, 3, 4, 5, 6, or 7 amino acid substitutions at the following positions: N300, G614, N698, E836, T939, L1100, and S1339.

[0095] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises an amino acid substitution at position S1339 compared to SEQ ID NO: 1. In some embodiments, such variants exhibit improved specificity and / or activity compared to the comparable / identical sequence lacking the substitution.

[0096] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises amino acid substitutions at positions S779 and S1339 compared to SEQ ID NO: 1 and optionally additional 1, 2, 3, 4, 5, or 6 amino acid substitutions at the following positions: N300, G614, N698, E836, T939, and L1100. In some embodiments, such variants exhibit improved stability and / or specificity and / or activity compared to a comparable / identical sequence lacking the substitutions.

[0097] In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises amino acid substitutions at positions S779, L1100, and S1339 compared to SEQ ID NO: 1, and optionally additional 1, 2, 3, 4, or 5 amino acid substitutions at the following positions: N300, G614, N698, E836, and T939.

[0098] In some embodiments, the amino acid substitution at position S779 is any one of the following substitutions: S779D, S779E, S779R, S779T, S779N, S779Q, S779G, S779P, S779C, S779A, S779V, S779I, S779L, S779M, S779F, S779Y or S779W. Each possibility represents a separate embodiment of the present disclosure. In some embodiments, the amino acid substitution at position S779 is any one of the following substituent groups: non-polar aliphatic groups (G, A, V, L, M, I); aromatic groups (F, Y, W); positively charged groups (K, R, H); uncharged polar groups (S, T, C, P, N, Q); and negatively charged groups (D, E). In some embodiments, the amino acid substitution at position S779 is any one of the following substitutions: alanine (A), aspartic acid (D), asparagine (N), histidine (H), or phenylalanine (F).

[0099] In some embodiments, the amino acid substitution at position S1339 is any one of the following substitutions: S1339D, S1339E, S1339R, S1339T, S1339N, S1339Q, S1339G, S1339P, S1339C, S1339A, S1339V, S1339I, S1339L, S1339M, S1339F, S1339Y, or S1339W. Each possibility represents a separate embodiment of the present disclosure.

[0100] According to some embodiments of the present invention, a non-naturally occurring OMNI-50 nuclease variant is provided, which variant has at least 80%, 85%, 90%, 95% or 97% identity to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least one of the following amino acid substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100 and S1339. In some embodiments, the non-naturally occurring OMNI-50 nuclease variant comprises at least 1, 2, 3, 4, 5, 6, 7 or 8 of the following substitutions compared to SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F and S1339R. Each possibility represents a separate embodiment of the present invention and can be combined in any combination.

[0101] In some embodiments, the variant OMNI-50 nuclease comprises the amino acid sequence of any one of SEQ ID NOs: 2-30.

[0102] In some embodiments, a polynucleotide sequence encoding a non-naturally occurring OMNI-50 nuclease variant is provided, the non-naturally occurring OMNI-50 nuclease variant having a wild-type OMNI-50 protein sequence (SEQ ID NO: 1) comprising an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. In some embodiments, the polynucleotide sequence comprises a nucleotide sequence selected from SEQ ID NOs: 32-60. In some embodiments, the polynucleotide is a DNA expression vector. In some embodiments, the polynucleotide is an RNA molecule, preferably an mRNA molecule.

[0103] According to some embodiments of the present invention, a CRISPR system is provided, comprising any of the OMNI-50 nuclease variants disclosed herein in complex with a guide RNA molecule targeting a DNA target site, wherein the CRISPR system exhibits reduced off-target editing activity relative to a wild-type CRISPR system comprising a wild-type OMNI-50 nuclease protein and a guide RNA molecule. In some embodiments, the guide RNA molecule is a single guide RNA (sgRNA). In some embodiments, the guide RNA molecule is part of a crRNA:tracrRNA complex.

[0104] In some embodiments, the OMNI-50 variant nuclease exhibits increased specificity and / or activity for the target site compared to wild-type OMNI-50 nuclease (SEQ ID NO: 1) when complexed with a guide RNA that targets the OMNI-50 variant to the target site.

[0105] In some embodiments, the OMNI-50 nuclease variant is a nickase with an inactivated RuvC domain generated by amino acid substitutions at the positions provided for the CRISPR nuclease in the table below, column 1. In some embodiments, the nickase further comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0106] In some embodiments, the OMNI-50 nuclease variant is a nickase with an inactivated HNH domain generated by amino acid substitutions at the positions provided for the CRISPR nuclease in column 2 of the table below. In some embodiments, the nickase further comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0107] In some embodiments, the OMNI-50 nuclease variant is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain generated by substitution at the positions provided for the CRISPR nuclease in column 3 of the table below. In some embodiments, the catalytically inactive nuclease comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. Table 1 - Positions that influence OMNI-50 nuclease activity (relative to SEQ ID NO: 1)

[0108] The table above lists alternative positions to be substituted to generate a nickase with an inactivated RUVC domain, alternative positions to be substituted to generate a nickase with an inactivated HNH domain, and alternative positions to be substituted to generate a catalytically inactive nuclease with inactivated RUVC and HNH domains. For each amino acid position shown in columns 1-3, substitutions to any other amino acid are allowed unless followed by an asterisk, which indicates that any substitution other than substitution of aspartic acid (D) with glutamic acid (E) or glutamic acid (E) with aspartic acid (D) results in inactivation.

[0109] Reference is made herein to OMNI-50 nuclease variants, however, any of these variants can be modified to have nickase activity (i.e., a nuclease that generates single-strand DNA breaks rather than double-strand breaks) or to lack nuclease activity (i.e., a catalytically inactive nuclease).

[0110] Therefore, point mutations can be introduced into any variant described herein to modify or eliminate its nuclease activity while still maintaining its ability to specifically bind DNA in a guide RNA programming manner. Any of these variants can be specifically targeted to the desired DNA target sequence by a guide RNA molecule (e.g., single guide RNA (sgRNA) or crRNA:tracrRNA complex). Variant-guide complex will also carry any molecule attached to the complex to the target site. Therefore, the disclosure also contemplates the fusion protein comprising any variant described herein and a DNA modification domain (e.g., deaminase, nuclease, nickase, recombinase, methyltransferase, methylase, acetylase (acetylase), acetyltransferase, transcription activator or transcription repressor domain), and such fusion protein in correcting the mutation in the genome (e.g., genome of a human subject) related to the disease or in genome (e.g., human genome) producing a mutation to reduce or prevent the purposes in gene expression.

[0111] In some embodiments, any variant provided herein can be fused with a protein with enzymatic activity. In some embodiments, enzymatic activity modifies target DNA. In some embodiments, enzymatic activity is nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase (photolyase) activity or glycosylase activity. In some cases, enzymatic activity is nuclease activity. In some cases, nuclease activity introduces double-strand breaks in target DNA. In some cases, enzymatic activity modifies the target polypeptide related to target DNA. In some cases, the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity. In some cases, the target polypeptide is a histone and the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity or deubiquitinating activity.

[0112] Thus, any of the OMNI-50 nucleases, nickases, or inactive nuclease variants can be fused (e.g., directly or via a linker) to another DNA regulatory enzyme or DNA modifying enzyme, including but not limited to a base editor, such as a deaminase, a reverse transcriptase (e.g., for lead editing, see Anzalone et al., (2019)), an enzyme that modifies the DNA methylation state (e.g., a methyltransferase), or a modifier of a histone (e.g., a histone acetyltransferase). Indeed, the OMNI-50 nucleases, nickases, and inactive variants described herein can be fused to a DNA modifying enzyme or its effector domain. Examples of DNA modifiers include, but are not limited to, deaminases, nucleases, nickases, recombinases, methyltransferases, methylases, acetylases, acetyltransferases, reverse transcriptases, helicases, integrases, ligases, transposases, demethylases, phosphatases, transcriptional activators, or transcriptional repressors. In some embodiments, any of the OMNI-50 variants provided herein are fused to a protein having enzymatic activity. In some embodiments, the enzymatic activity modifies a target DNA molecule. The OMNI-50 variants described herein, or fusion proteins thereof, can be used to correct or generate one or more mutations in a gene associated with a disease, or to increase, correct, decrease, or prevent the expression of a gene.

[0113] According to some embodiments of the present invention, there is provided a method for gene editing with increased editing activity and / or increased specificity, comprising contacting a DNA target site with an active CRISPR system comprising any one of the OMNI-50 nuclease variant proteins described herein.

[0114] According to some embodiments, a method for gene editing with increased on-target activity and / or increased fidelity (reduced off-target activity) and / or increased discrimination (increased allele-specific editing) is provided, comprising: The target site locus is contacted with an active CRISPR system comprising a variant OMNI-50 nuclease protein of any one of the variants described herein, wherein the active CRISPR system exhibits reduced off-target editing activity and maintained on-target editing activity relative to a wild-type CRISPR system having a wild-type OMNI-50 nuclease protein.

[0115] The present disclosure provides an engineered OMNI-50 nuclease that exhibits increased specificity for the target site compared to the wild-type OMNI-50 nuclease (SEQ ID NO: 1). Wild-type OMNI-50 nuclease is disclosed in PCT International Application Publication No. WO / 2020-030782, which is incorporated herein by reference. When the engineered OMNI-50 nuclease variant is active in a CRISPR endonuclease system, the CRISPR endonuclease system exhibits reduced off-target editing activity and / or increased discrimination, maintained on-target editing activity relative to a CRISPR endonuclease system comprising a wild-type OMNI-50 nuclease. In some embodiments, the engineered OMNI-50 nuclease is an OMNI-50 nuclease variant comprising at least one amino acid substitution relative to the wild-type OMNI-50 nuclease. In some embodiments, the engineered OMNI-50 nuclease comprises multiple amino acid substitutions compared to the wild-type OMNI-50 nuclease.

[0116] In some embodiments, the OMNI-50 nuclease variant has at least 80%, such as at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 1. As a non-limiting example, the OMNI-50 nuclease variant may have amino acid differences at 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, or 20% of the residues relative to SEQ ID NO: 1. Such sequence differences can be revealed by sequence alignment. OMNI-50 variant nucleases can be generated by replacing at least one amino acid residue of the OMNI-50 wild-type nuclease with another amino acid residue, such as with a conservative or non-conservative amino acid substitution, and / or by inserting or deleting amino acid residues of the OMNI-50 wild-type nuclease. Any such mutation, including but not limited to substitutions, insertions, or deletions, as well as any other mutations described herein, or mutations in addition to the mutations described herein, can be used to generate OMNI-50 variant nucleases from OMNI-50 wild-type nucleases. In some embodiments, the OMNI-50 variant nucleases retain the desired activity of the parent wild-type OMNI-50 nuclease, such as the ability to interact with the guide RNA and target DNA and / or the activity of the nuclease (e.g., the ability to cause double-stranded DNA breaks, single-stranded DNA breaks, or the lack of any nuclease or nickase activity). In some embodiments, the variant exhibits an increased activity, such as nuclease activity, relative to the parent at a level greater than the activity level of the parent. In some embodiments, the variant retains the desired activity, such as nuclease activity, of the parent at a level greater than or equal to the activity level of the parent. In some embodiments, the variant retains the desired activity of the parent at a level of at least 100%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the activity level of the parent. In some embodiments, the OMNI-50 variant nuclease exhibits reduced off-target effects relative to the OMNI-50 wild-type nuclease.

[0117] In some embodiments, a variant of the OMNI-50 nuclease protein is provided, comprising a sequence at least 80% identical to the amino acid sequence of wild-type OMNI-50 (SEQ ID NO: 1) and having at least one amino acid substitution. In some embodiments, the amino acid substitution comprises replacing an amino acid residue with a positively charged, negatively charged, uncharged, hydrophilic, hydrophobic, polar, or non-polar amino acid. In some embodiments, the amino acid substitution is selected from replacing an amino acid with any one of a different amino acid selected from the group consisting of R, K, H, D, E, S, T, N, Q, C, U, G, P, A, I, L, M, F, W, Y, and V.

[0118] Positively charged amino acids include any amino acid with a positively charged R-group, such as lysine (K), arginine (R), or histidine (H). Negatively charged amino acids include any amino acid with a negatively charged R-group, such as aspartic acid (D) or glutamic acid (E).

[0119] Uncharged amino acids or neutral amino acids include amino acids whose R-groups are generally uncharged. Polar amino acids include any amino acid with a polar R-group, such as serine (S), threonine (T), tyrosine (Y), asparagine (N), or glutamine (Q). Non-polar amino acids include any amino acid with a non-polar R-group, such as glycine (G), alanine (A), valine (V), cysteine ​​(C), proline (P), leucine (L), isoleucine (I), methionine (M), tryptophan (W), or phenylalanine (F).

[0120] Large, hydrophobic amino acids include leucine, methionine, proline, and valine. Aromatic amino acids include histidine, phenylalanine, tryptophan, and tyrosine. Polar, uncharged amino acids include serine, cysteine, threonine, asparagine, and glutamine.

[0121] If the different amino acid substitutions have R-groups with similar properties to the original amino acid substitutions, the properties of the original variant protein with the original amino acid substitution at a given position can be extended to different variants with different amino acid substitutions at the same position. For example, if a variant protein shows higher specificity than the wild-type protein by replacing a lysine (K) residue with a glutamic acid (E) residue, it is reasonable to assume that a similar variant replacing an arginine (R) residue with a glutamic acid (E) residue will also show higher specificity because both lysine (K) and arginine (R) have similar properties (e.g., they both contain positively charged R-groups). In contrast, a variant having a glutamic acid (E) residue replaced by an aspartic acid (D) residue is unlikely to show higher specificity because both glutamic acid (E) and aspartic acid (D) have similar properties as the two containing negatively charged R-groups.

[0122] In some embodiments, a variant of an OMNI-50 nuclease protein is provided, the variant comprising a sequence at least 80% identical to the amino acid sequence of the wild-type OMNI-50 nuclease (SEQ ID NO: 1) and having at least one amino acid substitution at at least one of the following positions of the wild-type OMNI-50 protein sequence: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. In some embodiments, the variant OMNI-50 nuclease protein contains an amino acid substitution at at least one of the following positions of the wild-type OMNI-50 protein sequence (SEQ ID NO: 1): N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. Each possibility represents a separate embodiment of the present disclosure.

[0123] In some embodiments, the variant OMNI-50 nuclease protein comprises at least one amino acid substitution at the following positions of the catalytically active, nickase, or catalytically inactive form of the double-stranded DNA nuclease OMNI-50 protein sequence: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. In some embodiments, the variant OMNI-50 nuclease protein comprises at least one of the following amino acid substitutions at the following positions of the fully active, nickase, or catalytically inactive form of the wild-type OMNI-50 protein sequence: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

[0124] In some embodiments, the variant OMNI-50 nuclease protein comprises at least one amino acid substitution at the following positions of the catalytically active, nickase, or catalytically inactive form of the double-stranded DNA nuclease OMNI-50 protein sequence: N300, G614, N698, S779, E836, T939, L1100, and S1339. In some embodiments, the variant OMNI-50 nuclease protein comprises at least one of the following amino acid substitutions at the following positions of the fully active, nickase, or catalytically inactive form of the wild-type OMNI-50 protein sequence: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

[0125] In some embodiments, the OMNI-50 variant nuclease further comprises one or more nuclear localization sequences (NLS), cell penetrating peptide sequences and / or affinity tags (e.g., HIS tags, HA tags). In one embodiment, the OMNI-50 variant nuclease comprises one or more nuclear localization sequences of sufficient strength to drive the accumulation of the CRISPR complex in the nucleus of a eukaryotic cell, the CRISPR complex comprising a detectable amount of the CRISPR nuclease. Examples of OMNI-50 variant nuclease sequences engineered to comprise additional peptides are provided as SEQ ID NOs: 61-89. Specifically, these examples provide variants engineered in the following form: NLS-variant-HA-NLS-8xHis. Polynucleotides encoding the amino acids of SEQ ID NOs: 61-89 are provided by SEQ ID NOs: 90-118, respectively.

[0126] According to some embodiments, an isolated OMNI-50 variant nuclease protein is provided, comprising one or more substitutions or mutations relative to a wild-type OMNI-50 nuclease sequence, wherein the isolated variant OMNI-50 variant nuclease is active in a CRISPR system, wherein the CRISPR system exhibits reduced off-target editing activity and maintained on-target editing activity relative to a wild-type CRISPR system.

[0127] According to some embodiments, additional mutations of the OMNI-50 variant nucleases described herein can be implemented. Examples include, but are not limited to, mutations that alter the PAM recognition sequence, mutations that alter the nuclease activity of the enzyme, and truncations or removals of portions of the nuclease. According to some embodiments, the variant OMNI-50 variant nuclease can be encoded by any nucleic acid sequence that produces the desired amino acid sequence of the variant. For example, the nucleic acid sequence can be codon-optimized for cells such as bacterial cells, plant cells, or mammalian cells.

[0128] In an embodiment of the present invention, the CRISPR nuclease and the targeting molecule form a CRISPR complex that binds to the target DNA sequence to achieve cleavage of the target DNA sequence. The CRISPR nuclease can form a CRISPR complex comprising a CRISPR nuclease and a single guide RNA (sgRNA) molecule. Alternatively, the CRISPR nuclease can form a CRISPR complex comprising a CRISPR nuclease, a crRNA molecule, and a tracrRNA molecule. In some embodiments, the single guide RNA (sgRNA) molecule comprises an RNA sequence having at least 80%, 85%, 90%, or 95% identity to the sequence shown in SEQ ID NO: 140 or SEQ ID NO: 141.

[0129] According to some embodiments of the present invention, there is provided a gene editing method with reduced off-target editing activity and / or increased on-target editing activity, comprising: contacting a target site locus with an active CRISPR endonuclease system having a variant OMNI-50 protein complexed with a suitable guide RNA or guide RNA complex, wherein the active CRISPR endonuclease system exhibits increased editing activity and / or reduced off-target editing activity and / or increased allele-specific editing relative to a wild-type OMNI-50 CRISPR system.

[0130] According to some embodiments of the present invention, there is provided a method for gene editing with reduced off-target editing activity, comprising contacting a DNA target site with an active CRISPR system comprising any of the OMNI-50 nuclease variant proteins described herein. According to some embodiments of the present invention, there is provided a method for gene editing with increased editing activity, comprising contacting a DNA target site with an active CRISPR system comprising any of the OMNI-50 nuclease variant proteins described herein. According to some embodiments of the present invention, there is provided a method for gene editing with increased allele-specific editing, comprising contacting a DNA target site with an active CRISPR system comprising any of the OMNI-50 nuclease variant proteins described herein.

[0131] In some embodiments, the gene editing occurs in eukaryotic cells or prokaryotic cells. In some embodiments, the eukaryotic cells are plant cells or mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the DNA target site is located within or near the pathogenic allele of the gene.

[0132] In some embodiments, the DNA target site is located in a gene selected from the group consisting of ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, Rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDLR, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7, and HLA-E.

[0133] A non-limiting example of an sgRNA sequence that can be used to target TRAC includes: UUAGAGUCUCUCAGCUGGUACAGUUUGAGAGUUAUGAAAAUGACGAGUUCAAAUAA AAAUUUAUUCAAACCGCCUAUUUAUAGGCCGCAGAUGUUCUGCUUU (SEQ ID NO: 142).

[0134] In some embodiments, an exogenous donor molecule is used to repair the DNA target.

[0135] In some embodiments, the DNA target site is located in or adjacent to a gene selected from the group consisting of: AAVS1, ABCD1, APOLD1, AQP4, ATP7B, B2M, BCL11A, CCL4, CCR5, CD34, CD52, CD5, CD7, CIITA, CLK3, CLYBL, CTNS, CUL3, DYRK1A, EGFR, EMX1, F8, FANCF, FKTN, GALNS, GRN2B, HAS3, HBB, HPRT1, KRAS, MECP2, MIP, NRL, OMP, OT C, PAH, PDCD1, PDGFRA, PLP1, PPP2R5D, PTEN, RELN, RUNX1, RYR2, SHANK3, SNCA, TMEM175, TRAC, TRBC1, UBE3A, VEGFA, ZSCAN, FBL , FUS, G3BP1, HIST1H2BJ, LAMP1, MAP1LC3B, NPM1, Rab11A, RAD21, Roji1, Roji2, SEC61B, SMC1A, Sqstm1, TOMM20, TOP2a, TUBa1B.

[0136] In some embodiments, the allele-specific editing activity of the variant is increased by at least 1.25-fold, 1.5-fold, 2-fold, 10-fold, 10-fold, or 10-fold relative to the wild-type OMNI-50 nuclease. 2 times, 10 3 times, 10 4 times, 10 5 times or 10 6 In some embodiments, off-target editing activity is reduced by at least 2-fold, 10-fold, 10-fold, or 2 times, 10 3 times, 10 4 times, 10 5 times or 10 6 In some embodiments, the on-target editing activity is increased by at least 1.25-fold, 1.5-fold, 2-fold, 10-fold, 10-fold, or 10-fold. 2 times, 10 3 times, 104 times, 10 5 times or 10 6 times.

[0137] According to some embodiments of the present invention, there is provided a polynucleotide molecule encoding any one of the OMNI-50 variant proteins described herein.

[0138] Additional descriptions of OMNI-50 nuclease (SEQ ID NO: 1) are provided in PCT International Application Publication Nos. WO 2020 / 223514A2, WO 2022 / 098693 A1, and WO 2023 / 019263A1, the contents of each of which are incorporated herein by reference. deliver

[0139] The OMNI-50 variant compositions described herein can be delivered as proteins, DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or any combination thereof. In some embodiments, the RNA molecules comprise chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl, 3' phosphorothioate (MS) or 2'-O-methyl, 3' thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility represents a separate embodiment of the present invention.

[0140] The OMNI-50 variants described herein and / or polynucleotides encoding the variants and / or other molecules, such as single guide RNA molecules, crRNA molecules, tracrRNA molecules, or nucleotide molecules encoding any of them, can be delivered to target cells by any suitable means. The target cell can be any type of cell (e.g., a eukaryotic cell or a prokaryotic cell) in any environment (e.g., isolated or unisolated, maintained in culture, in vitro, ex vivo, in vivo, or in a plant). The target site in the target cell can be located in the nucleus of the cell.

[0141] The compositions described herein can be introduced into cells as part of a vector molecule with additional sequences (e.g., replication origin, promoter, and genes encoding antibiotic resistance). In addition, the compositions can be introduced into cells as naked nucleic acids or proteins, as nucleic acids or proteins complexed or packaged therein with reagents (e.g., liposomes, exosomes, or poloxamer), or can be delivered by recombinant viruses (e.g., adenoviruses, AAVs, herpes viruses, retroviruses, lentiviruses, and integrase-deficient lentiviruses (IDLVs)) or virus-like particles. As a non-limiting example, the composition can be packaged into adeno-associated viruses (AAVs), or into lentiviruses (e.g., non-integrating lentiviruses or lentiviruses lacking reverse transcription ability). Other non-limiting examples include packaging the composition into liposomes, extracellular vesicles, or exosomes, which can be pseudotyped with vesicular stomatitis glycoprotein (VSVG) or conjugated to cell-penetrating peptides, antibodies, targeting moieties, or any combination thereof.

[0142] In some embodiments, the composition to be delivered includes mRNA for the nuclease and a guide RNA. In some embodiments, the composition to be delivered includes mRNA for the nuclease, a guide RNA, and a donor template. In some embodiments, the composition to be delivered includes CRISPR nuclease and a guide RNA. In some embodiments, the composition to be delivered includes CRISPR nuclease, a guide RNA, and a donor template for gene editing via, for example, homology-directed repair. Optionally, the lentivirus includes mRNA for the nuclease and a guide RNA molecule, for example, a single guide RNA molecule or a crRNA molecule, which is used to target the nuclease to the target site. In some embodiments, the composition delivered to the cell includes mRNA for the nuclease, a guide RNA molecule, and a donor template molecule. Optionally, the lentivirus includes a nuclease protein variant and a guide RNA molecule. Optionally, the composition delivered to the cell comprises a nuclease protein variant, a guide RNA molecule, and / or a donor template for homology-directed repair. Optionally, the composition delivered to the cell includes mRNA for the nuclease variant, a DNA-targeted crRNA molecule, and a tracrRNA molecule. The composition delivered to the cell includes the mRNA of the nuclease variant, the crRNA molecule of DNA targeting, the tracrRNA molecule and the donor template molecule. The composition delivered to the cell includes the nuclease protein variant, the crRNA molecule of DNA targeting and the tracrRNA molecule. Optionally, the composition delivered to the cell includes the nuclease protein variant, the crRNA molecule of DNA targeting and the tracrRNA molecule, and the DNA donor template molecule for homology-directed repair.

[0143] Any suitable viral vector system can be used to deliver such compositions. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids and / or OMNI-50 variant proteins into cells (e.g., mammalian cells, plant cells, etc.) and target tissues. Such methods can also be used to administer the encoding nucleic acids and / or OMNI-50 variant proteins to cells in vitro. In certain embodiments, the nucleic acids and / or OMNI-50 variant proteins are administered for in vivo or ex vivo gene therapy applications. Non-viral vector delivery systems include naked nucleic acids and nucleic acids complexed with delivery vehicles (e.g., liposomes or poloxamers). For reviews of gene therapy approaches, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0144] Non-viral delivery methods for nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, virus-like particles, exosomes, liposomes, immunoliposomes, polycationic or lipid:nucleic acid conjugates, artificial virosomes, and agent-enhanced nucleic acid uptake, or can be delivered to plant cells via bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizobium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, and cassava vein mosaic virus). See, e.g., Chung et al., Trends Plant Sci. (2006). Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also considered as an in vivo or in vitro delivery method. See Zuris et al., Nat. Biotechnol. (2015), Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006); and Basha et al., Mol. Ther. (2011).

[0145] Non-viral vectors (e.g., transposon-based systems, such as the recombinant Sleeping Beauty transposon system or the recombinant PiggyBac transposon system) can also be delivered to target cells and used to transpose the polynucleotide sequence of the composition molecule or the polynucleotide sequence encoding the composition molecule in the target cell.

[0146] Additional exemplary nucleic acid delivery systems include those consisting of Biosystems (Cologne, Germany), Maxcyte Corporation (Rockville, Maryland), BTX Molecular Delivery System (Holliston, Massachusetts) and those provided by Copernicus Therapeutics (see, for example, U.S. Patent No. 6,008,336). Lipofection is described in, for example, U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787; and U.S. Patent No. 4,897,355, and lipofection reagents are sold through commercial channels (e.g., Transfectam.TM., Lipofectin.TM. and Lipofectamine.TM. RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those disclosed in PCT International Publication Nos. WO / 1991 / 017424 and WO / 1991 / 016024. Delivery can be performed to cells (ex vivo administration) or target tissues (in vivo administration).

[0147] Preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipisomes, is well known to those skilled in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad ... Res. 52:4817-4820 (1992); U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028 and 4,946,787).

[0148] Other delivery methods include packaging the nucleic acid to be delivered into EnGeneIC delivery vectors (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies, where one arm of the antibody is specific for the target tissue and the other arm is specific for the EDV. The antibody brings the EDV to the surface of the target cell and then brings the EDV into the cell through endocytosis. Once inside the cell, the contents are released (see, MacDiamid et al. (2009) Nature Biotechnology 27 (7), page 643).

[0149] The use of RNA or DNA virus-based systems to deliver nucleic acids utilizes a highly evolved process in which the virus is targeted to specific cells in the body and the viral payload is transported to the nucleus. Viral vectors can be directly applied to patients (in vivo), or they can be used for in vitro treatment of cells, and modified cells are applied to patients (ex vivo). Conventional viral-based systems for delivering nucleic acids include, but are not limited to, retroviruses, slow viruses, adenoviruses, adeno-associated viruses, vaccinia, and herpes simplex virus vectors for gene transfer. It is possible to integrate retroviruses, slow viruses, and adeno-associated viruses into the host genome using gene transfer methods, typically resulting in long-term expression of the inserted transgene. In addition, high transduction efficiency has been observed in many different cell types and target tissues. OMNI-50 variants or nucleic acids expressing the variants and any related nucleic acids can be delivered by non-integrating slow viruses. Optionally, slow viruses are used to deliver RNA. Optionally, slow viruses include mRNA and guide RNA molecules of nucleases, for example, single guide RNA molecules or crRNA molecules, which are used to target nucleases to target sites. Optionally, the lentivirus comprises an mRNA for the nuclease, a guide RNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant and a guide RNA molecule. Optionally, the lentivirus comprises a nuclease protein variant, a guide RNA molecule, and / or a donor template for homology-directed repair. Optionally, the lentivirus comprises an mRNA for the nuclease variant, a DNA-targeted crRNA molecule, and a tracrRNA molecule. Optionally, the lentivirus comprises an mRNA for the nuclease variant, a DNA-targeted crRNA molecule, and a tracrRNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant, a DNA-targeted crRNA molecule, and a tracrRNA molecule. Optionally, the lentivirus comprises a nuclease protein variant, a DNA-targeted crRNA molecule, and a tracrRNA molecule, and a DNA donor template molecule for homology-directed repair.

[0150] As described above, the compositions described herein can be used using non-integrating lentiviral particle methods (e.g. System) is delivered to the target cell. This method can be used to deliver mRNA or other types of RNA into the target cell, so that the RNA is delivered to the target cell and causes the composition described herein to be assembled in the target cell. See also PCT International Publication Nos. WO2013 / 014537, WO2014 / 016690, WO2016185125, WO2017194902 and WO2017194903.

[0151] The tropism of retroviruses can be altered by incorporating exogenous envelope proteins, thereby expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors are composed of cis-acting long terminal repeats (LTRs) and have a packaging capacity of up to 6-10 kb of exogenous sequence. The minimal cis-acting LTR is sufficient to replicate and package the vector, which is then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); PCT International Publication No. WO / 1994 / 026877A1).

[0152] Currently, at least six viral vector approaches are available for gene transfer in clinical trials, utilizing methods that involve complementing defective vectors by inserting genes into helper cell lines to produce the transducing agent.

[0153] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood (1995); Kohn et al., Nat. Med. (1995); Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., Science (1995)). Transduction efficiencies of 50% or greater have been observed with MFG-S-packaged vectors (Ellem et al., Immunol. Immunother. (1997); Dranoff et al., Hum. Gene Ther. (1997)).

[0154] Packaging cells are used to form viral particles that can infect host cells. Such cells include 293 cells that package adenovirus and AAV, and psi.2 cells or PA317 cells that package retroviruses. Viral vectors used for gene therapy are usually generated by production cell lines that package nucleic acid vectors into viral particles. The vector usually contains the minimum viral sequences required for packaging and subsequent integration into the host (if applicable), and other viral sequences are replaced by expression cassettes encoding the protein to be expressed. The missing viral functions are provided in trans by the packaging cell line. For example, AAV vectors used for gene therapy usually only have inverted terminal repeat (ITR) sequences from the AAV genome, which are necessary for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid that encodes other AAV genes (i.e., rep and cap) but lacks ITR sequences. The cell line is also infected with adenovirus as a helper virus. The helper virus promotes the replication of the AAV vector and the expression of the AAV genes in the helper plasmid. Due to the lack of ITR sequences, the helper plasmid cannot be packaged in large quantities. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced on a clinical scale using a baculovirus system (see, U.S. Patent No. 7,479,554).

[0155] In many gene therapy applications, it is desirable that gene therapy vectors are delivered to specific tissue types with a high degree of specificity. Therefore, it is possible to modify the ligand by expressing it as a fusion protein with a viral coat protein on the outer surface of the virus so that it is specific to a given cell type. Select a ligand with affinity for a receptor known to be present on the target cell type. For example, Han et al., Proc. Natl. Acad. Sci. USA 92: 9747-9751 (1995), reported that Moloney's murine leukemia virus can be modified to express human neuregulin (heregulin) fused with gp70, and recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, wherein the target cell expresses a receptor, and the virus expresses a fusion protein comprising a ligand for a cell surface receptor. For example, filamentous phage can be engineered to display an antibody fragment (such as FAB or Fv) with specific binding affinity to almost any selected cell receptor. Although the above description is mainly applied to viral vectors, the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that facilitate uptake by specific target cells.

[0156] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local administration, as described below. Alternatively, the vector can be delivered ex vivo to cells, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirate, tissue biopsy), or universal donor hematopoietic stem cells, which are then reimplanted into the patient, typically after selection for cells that have incorporated the vector.

[0157] Ex vivo cell transfection for diagnostics, research or for gene therapy (eg by reinfusion of the transfected cells into a host organism) is well known to those skilled in the art.

[0158] In a preferred embodiment, cells are isolated from a subject organism, transfected with the RNA composition, and then infused back into the subject organism (e.g., a patient). Various cell types suitable for ex vivo transfection are well known to those skilled in the art (see, e.g., Freshney et al., Culture of Animal Cells, A Manual of Basic Technique (3rd ed., 1994) and references cited therein for a discussion of how to isolate and culture cells from a patient).

[0159] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines generated by such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells, any plant cell (differentiated or undifferentiated), and insect cells such as Spodoptera fugiperda (Sf), or fungal cells such as Saccharomyces, Pichia, and Schizosaccharomyces. In certain embodiments, the cell line is a CHO-K1, MDCK or HEK293 cell line. In addition, primary cells can be isolated and treated with a nuclease system (e.g., CRISPR / Cas) in vitro for reintroduction into the subject to be treated. Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and other blood cell subsets, such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells, such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neuronal stem cells, and mesenchymal stem cells.

[0160] In one embodiment, stem cells are used for cell transfection and gene therapy in ex vivo methods. The advantage of using stem cells is that they can be differentiated into other cell types in vitro or can be introduced into a mammal (e.g., a cell donor) where they will be engrafted into the bone marrow. Methods for using cytokines such as GM-CSF, IFN-γ, and TNF-α to differentiate CD34+ cells in vitro into clinically important immune cell types are known (as a non-limiting example, see, Inaba et al., J. Exp. Med. 176: 1693-1702 (1992)).

[0161] Stem cells are isolated using known methods for transduction and differentiation. For example, stem cells are isolated from bone marrow cells by panning bone marrow cells with antibodies that bind to unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and Iad (differentiated antigen-presenting cells) (as a non-limiting example, see, Inaba et al., J. Exp. Med. 176: 1693-1702 (1992)). In some embodiments, modified stem cells can also be used.

[0162] It is noteworthy that any of the OMNI-50 variants described herein can be applied to genome editing of post-mitotic cells or any cells that are not actively dividing, such as arrested cells. Examples of post-mitotic cells that can be edited using the OMNI-50 variants of the present invention include, but are not limited to, myocytes, cardiomyocytes, hepatocytes, bone cells, and neurons.

[0163] The carrier (for example, retrovirus, liposome etc.) containing therapeutic RNA compositions can also be directly administered to organism for in vivo cell transduction. Alternatively, naked RNA or mRNA can be administered. By being generally used for introducing any approach that molecule is finally contacted with blood or tissue cells, administer, described approach includes but is not limited to injection, infusion, topical application and electroporation. The suitable method of administering this type of nucleic acid is obtainable and well known to those skilled in the art, and although more than one approach can be used to administer specific compositions, specific approach can usually provide more direct and more effective reaction than another approach.

[0164] Vectors suitable for introducing transgenes into immune cells (eg, T cells) include non-integrating lentiviral vectors. See, for example, US Patent Publication No. 2009 / 0117617.

[0165] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered and the particular method used to administer the composition. Thus, as described below, there are a variety of suitable pharmaceutical composition formulations available for use (see, e.g., Remington's Pharmaceutical Sciences, 17th edition, 1989). DNA repair by homologous recombination

[0166] In some embodiments of the invention, variant OMNI-50 nucleases are used to effect DNA breaks at target sites to induce cellular repair mechanisms such as, but not limited to, non-homologous end joining (NHEJ) or homology-directed repair (HDR).

[0167] The term "homologous directed repair" or "HDR" refers to a mechanism for repairing DNA damage in cells, for example, during the repair of double-stranded and single-stranded breaks in DNA. HDR requires nucleotide sequence homology and uses a "nucleic acid template" (nucleic acid template or donor template are used interchangeably herein) to repair a sequence (e.g., a DNA target sequence) in which a double-stranded or single-stranded break has occurred. This results in the transfer of genetic information from, for example, a nucleic acid template to a DNA target sequence. If the nucleic acid template sequence is different from the DNA target sequence, and part or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can result in alterations (e.g., insertions, deletions, mutations) in the DNA target sequence. In some embodiments, a complete nucleic acid template polynucleotide, a portion of a nucleic acid template polynucleotide, or a copy of the nucleic acid template is integrated at the site of the DNA target sequence.

[0168] The terms "nucleic acid template" and "donor" refer to a nucleotide sequence that is inserted or copied into a genome. A nucleic acid template comprises a nucleotide sequence of, for example, one or more nucleotides that will be added to a target nucleic acid or will be used as a template to change a target nucleic acid, or can be used to modify a target sequence. A nucleic acid template sequence can be any length, for example, a length between 2 and 10,000 nucleotides (or any integer value therebetween or above), preferably a length between about 100 and 1,000 nucleotides (or any integer therebetween), more preferably a length between about 200 and 500 nucleotides. A nucleic acid template can be a single-stranded nucleic acid or a double-stranded nucleic acid. In some embodiments, a nucleic acid template comprises a nucleotide sequence, for example, a nucleotide sequence of one or more nucleotides that corresponds to the wild-type sequence of the target nucleic acid at, for example, the target position. In some embodiments, a nucleic acid template comprises a ribonucleotide sequence, for example, a ribonucleotide sequence of one or more ribonucleotides that corresponds to the wild-type sequence of the target nucleic acid at, for example, the target position. In some embodiments, a nucleic acid template comprises modified ribonucleotides.

[0169] For example, an exogenous sequence (also referred to as a "donor sequence," "donor template," or "donor") for correcting a mutant gene or for increasing the expression of a wild-type gene may also be inserted. It will be apparent that a donor sequence is generally not identical to the genomic sequence in which it is located. A donor sequence may contain a non-homologous sequence flanked by two regions of homology to allow for efficient HDR at the target location. Additionally, a donor sequence may comprise a vector molecule containing a sequence that is not homologous to the target region in the cellular chromatin. A donor molecule may contain several discontinuous regions that are homologous to the cellular chromatin. For example, in order to target the insertion of a sequence that is not normally present in the target region, the sequence may be present in the donor nucleic acid molecule and flanked by regions homologous to sequences in the target region.

[0170] Donor polynucleotides can be single-stranded and / or double-stranded DNA or RNA and can be introduced into cells in linear or circular form.See, for example, U.S. Patent Publication Nos. 2010 / 0047805; 2011 / 0281361; 2011 / 0207221; and 2019 / 0330620. If introduced in linear form, the end of the donor sequence can be protected (for example, from exonucleolytic degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule and / or self-complementary oligonucleotides are connected to one or both ends.See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding terminal amino groups and using modified internucleotide bonds, such as phosphorothioate, phosphoramidate (phosphoramidate) and O-methyl ribose or deoxyribose residues.

[0171] Thus, embodiments of the present invention that use a donor template for repair can use DNA or RNA, single-stranded and / or double-stranded donor templates, which can be introduced into cells in linear or circular form. In embodiments of the present invention, a gene editing composition comprises: (1) an RNA molecule comprising a guide sequence that affects a double-strand break in a gene before repair and (2) a donor RNA template for repair, wherein the RNA molecule comprising the guide sequence is a first RNA molecule and the donor RNA template is a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are connected as part of a single molecule.

[0172] Donor sequences can also be oligonucleotides and used for gene correction or targeted alteration of endogenous sequences. Oligonucleotides can be introduced into cells on a vector, can be electroporated into cells, or can be introduced by other methods known in the art. Oligonucleotides can be used to "correct" mutant sequences in endogenous genes (e.g., sickle cell mutations in beta globin), or can be used to insert sequences with a desired purpose into an endogenous locus.

[0173] The polynucleotide can be introduced into the cell as part of a vector molecule with additional sequences (e.g., replication origin, promoter, and genes encoding antibiotic resistance). In addition, the donor polynucleotide can be introduced as naked nucleic acid, as a nucleic acid complexed with or packaged in reagents such as liposomes, exosomes, or poloxamers, or can be delivered by recombinant viruses (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)) or virus-like particles. Non-viral vectors, such as transposon-based systems, such as the recombinant Sleeping Beauty transposon system or the recombinant PiggyBac transposon system, can also be used for transposition of polynucleotide sequences in target cells.

[0174] Typically the donor is inserted such that its expression is driven by an endogenous promoter at the integration site, i.e., a promoter driving expression of the endogenous gene into which the donor is inserted. However, it will be apparent that the donor may comprise a promoter and / or enhancer, such as a constitutive promoter or an inducible or tissue-specific promoter.

[0175] The donor molecule can be inserted into the endogenous gene so that all, some or none of the endogenous genes are expressed. For example, the transgenes described herein can be inserted into the endogenous locus so that some of the endogenous sequences (the N-terminus and / or C-terminus of the transgene) are expressed, for example, as a fusion with the transgene or none of them are expressed. In other embodiments, the transgene (e.g., with or without additional coding sequences such as endogenous genes) is integrated into any endogenous locus, such as a safe harbor locus, for example, a CCR5 gene, a CXCR4 gene, a PPP1R12c (also known as AAVS1) gene, an albumin gene, or a Rosa gene. (See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Publication Nos. 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960 and U.S. Provisional Application No. 61 / 823,689).

[0176] When an endogenous sequence (an endogenous sequence of a transgenic gene or a portion thereof) is expressed with a transgenic gene, the endogenous sequence can be a full-length sequence (wild type or mutant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of the functions of these full-length or partial sequences include increasing the serum half-life of a polypeptide expressed by the transgenic gene (e.g., a therapeutic gene) and / or acting as a carrier.

[0177] Additionally, although not required for expression, the exogenous sequences may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals.

[0178] In certain embodiments, the donor molecule comprises a sequence selected from the group consisting of a gene encoding a protein (e.g., a coding sequence encoding a protein that is deficient in the cell or individual or an alternative form of a gene encoding a protein), a regulatory sequence, and / or a sequence encoding a structural nucleic acid such as a microRNA or siRNA. DNA-targeting RNA molecules

[0179] In embodiments of the present invention, a DNA-targeting RNA sequence comprises a guide sequence portion. A "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, for example, a guide sequence portion having a nucleotide sequence that is fully complementary to the targeted DNA sequence along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or is about 17-30, 17-29, 17-28, 17-27, 17-26, 27-25, 17-24, 18-22, 19-22, 18-20, 17-20, or 21-22 nucleotides in length. The full length of the guide sequence portion is fully complementary to the targeted DNA sequence along the length of the guide sequence portion. The guide sequence portion can be part of an RNA molecule that can form a complex with a CRISPR nuclease, wherein the guide sequence portion serves as the DNA targeting portion of the CRISPR complex. When an RNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule is capable of targeting the CRISPR nuclease to a specific target DNA sequence. Each possibility represents a separate embodiment. RNA molecules can be custom designed to target any desired sequence.

[0180] According to some aspects of the present invention, the disclosed methods include methods for modifying a nucleotide sequence at a target site in a cell-free system or a cell genome, the methods comprising introducing a composition according to any embodiment described herein into a cell.

[0181] In some embodiments, the cell is a eukaryotic cell, preferably a mammalian cell or a plant cell. In some embodiments, the genomic modification occurs in the nucleus of the cell.

[0182] According to some aspects of the invention, the disclosed methods include use of any of the compositions described herein for treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the genome of the subject.

[0183] According to some aspects of the invention, the disclosed methods include methods of treating a subject having a mutational disorder comprising targeting any of the compositions described herein to an allele associated with the mutational disorder.

[0184] In some embodiments, the mutation disorder is associated with any disease or disorder selected from the group consisting of: neoplasia; age-related macular degeneration; schizophrenia; neurological, neurodegenerative, or movement disorders; fragile X syndrome; secretase-related disorders; prion-related disorders; ALS; addiction; autism; Alzheimer's disease; neutropenia; inflammation-related disorders; Parkinson's disease; blood and coagulation diseases and disorders, beta thalassemia, sickle cell anemia; cellular dysregulation and oncology diseases and disorders; inflammation and immune-related diseases and disorders; metabolic, liver, hypercholesterolemia, kidney, and protein diseases and disorders; muscle and skeletal diseases and disorders; skin diseases and disorders; neural and neuronal diseases and disorders; lung diseases and disorders; corneal diseases and disorders, retinal diseases and disorders, and ocular diseases and disorders. Diseases and treatments

[0185] Certain embodiments of the present invention target nucleases to specific genetic loci associated with a disease or condition in the form of gene editing, treatment methods or therapies. For example, in order to induce editing or knockout of a gene, custom-designed guide RNA molecules can be used to specifically target the pathogenic mutation alleles of the new nuclease disclosed herein. The guide RNA molecule is preferably designed by first considering the PAM requirements of the nuclease, as shown herein, which also depends on the system in which gene editing is performed. For example, the guide RNA molecule intended to target the OMNI-50 nuclease to the target site is designed to contain a spacer sequence complementary to the DNA chain of the double-stranded region of the DNA adjacent to the OMNI-50 PAM sequence, such as "NGG". The guide RNA molecule is also preferably designed to contain a spacer region (i.e., a region complementary to the target allele in the guide RNA molecule) of sufficient length and preferably optimal length to increase the specific activity of the nuclease and reduce off-target effects.

[0186] As non-limiting examples, guide RNA molecules can be designed to target specific regions of nuclease mutant alleles, such as near the start codon, so that after the DNA damage caused by nuclease, non-homologous end joining (NHEJ) pathway is induced and the silencing of mutant alleles is caused by introducing frameshift mutations. This method of designing guide RNA molecules is particularly suitable for changing the effect of dominant negative mutations, thereby treating subjects. As a separate non-limiting example, guide RNA molecules can be designed to target specific pathogenic mutations of mutant alleles, so that after the DNA damage caused by nuclease, homology-directed repair (HDR) pathway is induced, and the correction of template-mediated mutant alleles is caused. This method of designing guide RNA molecules is particularly suitable for changing the haploinsufficiency effect (haploinsufficiency effect) of mutant alleles, thereby treating subjects.

[0187] Non-limiting examples of specific genes that can be targeted for alteration to treat a disease or condition are presented below. Specific disease-associated genes and mutations that induce mutational conditions are described in the literature. Such mutations can be used to design DNA-targeting RNA molecules to target CRISPR compositions to alleles of disease-associated genes, wherein the CRISPR compositions cause DNA damage and induce DNA repair pathways to alter the alleles and thereby treat mutational conditions.

[0188] Mutations in the ELANE gene are associated with neutropenia. Thus, without limitation, embodiments of the present invention targeting ELANE can be used in methods of treating subjects suffering from neutropenia. Guide RNA molecules that target the ELANE gene and can be used to treat neutropenia are disclosed in PCT International Application No. PCT / US2020 / 059186, which is incorporated herein by reference.

[0189] CXCR4 is a coreceptor for human immunodeficiency virus type 1 (HIV-1) infection. Thus, without limitation, embodiments of the present invention targeting CXCR4 can be used in methods of treating a subject suffering from HIV-1 or conferring resistance to HIV-1 infection in a subject.

[0190] Programmed cell death protein 1 (PD-1) destruction enhances CAR-T cell-mediated tumor cell killing, and PD-1 can be a target in other cancer therapies. Thus, without limitation, embodiments of the present invention targeting PD-1 can be used in methods for treating subjects suffering from cancer. In one embodiment, the treatment is CAR-T cell therapy using T cells modified to be PD-1 deficient according to the present invention.

[0191] In addition, BCL11A is a gene that plays a role in inhibiting hemoglobin production. By inhibiting BCL11A, globin production can be increased to treat diseases such as thalassemia or sickle cell anemia. See, for example, PCT International Publication No. WO2017 / 077394A2; U.S. Publication No. US2011 / 0182867A1; Humbert et al., Sci. Transl. Med. (2019); and Canver et al., Nature (2015). Therefore, without limitation, embodiments of the present invention targeting the BCL11A enhancer can be used in methods for treating subjects suffering from beta thalassemia or sickle cell anemia.

[0192] Embodiments of the present invention can also be used to target any disease-associated gene for the study, alteration, or treatment of any disease or condition listed in Table A or Table B below. Indeed, any disease associated with a genetic locus can be studied, altered, or treated by using the nucleases disclosed herein to target appropriate disease-associated genes, such as those listed in U.S. Publication No. 2018 / 0282762A1 and European Patent No. EP3079726B1. Table A - Diseases, conditions and their associated genes Table B - Diseases, conditions and their associated genes

[0193] Unless otherwise specified, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used for the practice or testing of embodiments of the present invention, exemplary methods and / or materials will be described below. In the event of conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be necessarily limiting.

[0194] In the discussion, unless otherwise indicated, adjectives such as "substantially" and "about" that modify conditions or relational features of one or more features of an embodiment of the present invention should be understood to mean that the condition or feature is defined within an acceptable tolerance range for the operation of the embodiment for its intended application. Unless otherwise indicated, the word "or" in the specification and claims is considered to be inclusive rather than exclusive and indicates at least one or any combination of the items to which it is associated.

[0195] It should be understood that the terms "a" and "an" as used above and elsewhere herein refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms "a," "an," and "at least one" are used interchangeably in this application.

[0196] For a better understanding of the present teachings and in no way limiting the scope of the present teachings, all numbers and other numerical values ​​expressing quantities, percentages or ratios used in the specification and claims should be understood as being modified in all cases by the term "about," unless otherwise indicated. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values ​​that may vary depending on the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0197] In the specification and claims of this application, each of the verbs "comprise," "include," and "have," and their variations, is used to indicate that the object or objects of the verb do not necessarily fully list the components, elements, or parts of the subject or subjects of the verb. Other terms used herein are intended to be defined by their commonly understood meanings in the art.

[0198] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or a molecule comprising a nucleotide sequence that is capable of hybridizing to a specific target sequence, for example, a targeting sequence having a nucleotide sequence that is at least partially complementary to the targeted sequence along the length of the targeting sequence. The targeting sequence or targeting molecule can be part of an RNA molecule that is capable of forming a complex with a CRISPR nuclease, wherein the targeting sequence acts as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present at the same time as a CRISPR molecule, the RNA molecule is capable of targeting the CRISPR nuclease to a specific target sequence. Each possibility represents a separate embodiment. RNA molecules can be custom designed to target any desired sequence.

[0199] As used herein, the term "target" refers to the preferential hybridization of a targeting sequence or targeting molecule to a nucleic acid having a targeted nucleotide sequence. It should be understood that the term "targeting" encompasses variable hybridization efficiencies, thereby preferentially targeting nucleic acids having a target nucleotide sequence, but unintentional off-target hybridization other than on-target hybridization may also occur. It should be understood that where an RNA molecule targets a sequence, the complex of the RNA molecule and the CRISPR nuclease molecule targets the sequence to provide for nuclease activity.

[0200] As used herein, the term "wild type" is a term understood by those skilled in the art and refers to the typical form of an organism, strain, gene or trait found in nature, as distinguished from mutant or variant forms. Thus, as used herein, where an amino acid or nucleotide sequence refers to a wild-type sequence, a variant refers to a variant of that sequence, e.g., comprising a substitution, deletion, insertion. In embodiments of the present invention, an engineered CRISPR nuclease is a variant CRISPR nuclease that comprises at least one amino acid modification (e.g., a substitution, deletion and / or insertion), also referred to as a "mutation," compared to the wild-type OMNI-50 nuclease of SEQ ID NO: 1.

[0201] The terms "non-naturally occurring" or "engineered" are used interchangeably and refer to human manipulation. When referring to a nucleic acid molecule or polypeptide, these terms can mean that the nucleic acid molecule or polypeptide is at least substantially free of at least one other component with which it is naturally associated in nature and as found in nature.

[0202] The terms "mutant" or "variant" are used interchangeably and refer to a non-naturally occurring or engineered molecule.

[0203] As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine and the D- or L-optical isomers, as well as amino acid analogs and peptidomimetics.

[0204] As used herein, "genomic DNA" refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in one or more cells of interest. In some embodiments, the cells of interest are eukaryotic cells. In some embodiments, the cells of interest are prokaryotic cells. In some embodiments, the method produces a double-strand break (DSB) at a predetermined target site in a genomic DNA sequence, resulting in a mutation, insertion, and / or deletion of the DNA sequence at the target site in the genome.

[0205] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0206] As used herein, the term "modified cell" refers to a cell in which double-strand breaks are affected by a complex of an RNA molecule and a CRISPR nuclease variant due to hybridization with a target sequence, i.e., on-target hybridization. The term "modified cell" may also encompass cells in which repair or correction of mutations following double-strand breaks induced by a variant is being affected. The modified cell may be any type of cell, such as a eukaryotic or prokaryotic cell, in any environment, such as isolated or unisolated, maintained in culture, in vitro, isolated, in vivo, or in planta.

[0207] The present invention provides one or more modified cells obtained by any variant or method described herein. In one embodiment, these modified cells can produce daughter cells. In one embodiment, these modified cells can produce daughter cells after transplantation. As a non-limiting example, the modified cells can be hematopoietic stem cells (HSC), or any cells suitable for allogeneic cell transplantation or autologous cell transplantation. The variants and methods described herein can also be used to produce chimeric antigen receptor T (CAR-T) cells.

[0208] The present invention also provides a composition comprising the modified cells and a pharmaceutically acceptable carrier. Also provided is an in vitro or ex vivo method for preparing the composition, comprising mixing the cells with a pharmaceutically acceptable carrier.

[0209] As used herein, the term "nuclease" refers to an enzyme that is capable of cleaving the phosphodiester bond between the nucleotide subunits of a nucleic acid. The nuclease can be isolated or derived from a natural source. The natural source can be any living organism. Alternatively, the nuclease can be a modified or synthetic protein that retains phosphodiester bond cleavage activity.

[0210] As used herein, the term "protospacer adjacent motif" or "PAM" refers to a nucleotide sequence of the target DNA that is located near the targeted DNA sequence and is recognized by the CRISPR nuclease. The PAM sequence can vary depending on the identity of the nuclease. For example, wild-type Streptococcus pyogenes Cas9 recognizes the "NGG" PAM sequence. Those skilled in the art will understand that a single guide RNA molecule or crRNA:tracrRNA complex is able to complex with the CRISPR nuclease to associate with a target genomic DNA sequence of interest that is adjacent to the protospacer adjacent motif (PAM). The nuclease then mediates cleavage of the target DNA to produce a double-strand break within the protospacer sequence.

[0211] As used herein, a sequence or molecule has X% "sequence identity" to another sequence or molecule if X% of the bases or amino acids between the molecular sequences are identical and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity to a second nucleotide sequence will have at least 95% of the same bases in the same relative positions as the other sequence.

[0212] The terms "nuclear localization sequence" and "NLS" are used interchangeably to represent an amino acid sequence / peptide that instructs a protein associated therewith to be transported from the cytoplasm of a cell through the nuclear envelope barrier (nuclear envelope barrier). The term "NLS" not only includes the nuclear localization sequence of a specific peptide, but also includes derivatives thereof that can instruct cytoplasmic polypeptides to pass through the translocation of the nuclear envelope barrier. When connected to the N-terminus, C-terminus, or both the N- and C-termini of a polypeptide, NLS can instruct the nuclear translocation of a polypeptide. In addition, polypeptides having an NLS coupled to an amino acid side chain randomly positioned along the amino acid sequence of a polypeptide by its N- or C-terminus will be translocated. Typically, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, and other types of NLS are known. Non-limiting examples of NLSs include NLS sequences derived from SV40 virus large T antigen, nuclear plasmin, c-myc, hRNPAl M9 NLS, the IBB domain from importin-α, myoma T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus delta antigen, mouse Mx1 protein, human poly (ADP-ribose) polymerase, and steroid hormone receptor (human) glucocorticoid.

[0213] The term "CRISPR system" refers to a CRISPR endonuclease system that includes a CRISPR nuclease protein, such as a mutant or variant described herein, and a suitable guide RNA molecule or guide RNA complex, such as a single guide RNA or a crRNA:tracrRNA complex, for targeting the CRISPR nuclease protein to a desired target DNA sequence based on complementarity between the guide RNA molecule or a portion of the guide RNA complex and the target DNA sequence. The term "wild-type CRISPR endonuclease system" refers to a system that includes a wild-type CRISPR protein and a suitable guide RNA molecule or guide RNA complex, such as a single guide RNA or a crRNA:tracrRNA complex, for targeting the wild-type CRISPR nuclease protein to a desired target DNA sequence based on complementarity between the guide RNA molecule or a portion of the guide RNA complex and the target DNA sequence.

[0214] In the context of the present invention, "maintained on-target editing activity" refers to the ability of an OMNI-50 variant to target a DNA target site that is targeted by a guide RNA molecule associated with and programmed by the OMNI-50 variant. In some embodiments, the OMNI-50 variant maintains on-target editing activity of a DNA target at a percentage level greater than or equal to that of the wild-type OMNI-50 nuclease editing the DNA target. In some embodiments, the OMNI-50 variant maintains on-target editing activity of a DNA target at at least 100%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the percentage level of editing of the DNA target by the wild-type OMNI-50 nuclease.

[0215] For the aforementioned embodiments, each embodiment disclosed herein is considered applicable to each other disclosed embodiment.For example, it should be understood that any RNA molecule or composition of the invention can be used in any method of the invention.

[0216] As used herein, all headings are for organizational purposes only and are not intended to limit the disclosure in any way. The contents of any individual section may apply equally to all sections.

[0217] Other objects, advantages and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as described above and claimed herein are experimentally supported in the following examples.

[0218] It should be understood that, for the sake of clarity, certain features of the present invention described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, various features of the present invention described in the context of a single embodiment may also be provided individually or in any suitable subcombination or as appropriate in any other described embodiment of the present invention. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiment will not function without those elements.

[0219] In general, the nomenclature used herein and the laboratory methods used in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. These techniques are fully explained in the literature. See, for example, Sambrook et al., "Molecular Cloning: A laboratory Manual" (1989); Ausubel, RM (ed.), "Current Protocols in Molecular Biology" Vols. I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (ed.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New New York (1998); as described in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (ed.), "Cell Biology: A Laboratory Handbook," Vols. I-III (1994); Freshney, "Culture of Animal Cells—A Manual of Basic Technique," Third Edition, Wiley-Liss, NY (1994); Coligan JE (ed.), "Current Protocols in Immunology," Vols. I-III (1994); Stites et al. (eds.), "Basic and Clinical Immunology," 8th Edition, Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); Clokie and Kropinski (eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009), all of which are incorporated herein by reference. Other general references are provided herein.

[0220] Provide examples below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes for making and implementing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are intended to illustrate the present invention. Example Example 1: General method

[0221] To select for OMNI-50 nuclease variants with improved functionality, such as increased activity, improved fidelity, and improved discrimination, amino acid substitutions were introduced into the open reading frame of the wild-type OMNI-50 sequence (SEQ ID NO: 1).

[0222] To evaluate the functionality of OMNI-50 variants, the activity of OMNI-50 nuclease variants was compared with that of wild-type OMNI-50 nuclease. In addition, guides designed to distinguish SNP positions were used to test OMNI-50 nuclease variant activity and allele-specific editing. Example 2: OMNI-50 CRISPR Nuclease Variants OMNI-50 CRISPR Nuclease Variant Library

[0223] The open reading frame of the wild-type OMNI-50 CRIPR nuclease was codon-optimized for expression in human cell lines and cloned into a dual-expression plasmid (pShuttle), which enables bacterial and mammalian expression using either the T7 or CMV promoter, respectively. A complete gene library with combinatorial random mutations along the full-length OMNI-50 open reading frame (ORF) was constructed by inserting oligonucleotides bearing the NNK degenerate codon at each position in the OMNI-50 sequence. Bacteria-based positive selection system

[0224] To isolate OMNI-50 variants with enhanced activity, a positive selection bacterial system was designed. In this system, a positive selection plasmid was electroporated into Escherichia coli strain BW25141 (lDE3) to generate a positive selection bacterial strain. The positive selection plasmid contains a T7-expressed single guide RNA (sgRNA) and an embedded target site. The sequence of the target site (which is located upstream of the human ELANE gene) and the spacer and scaffold sequences of the guide RNA molecule are listed in Table 5.

[0225] The positive selection plasmid also contains a chloramphenicol resistance cassette and expresses the E. coli toxin gene CcdB under the control of the araBAD promoter. Therefore, when the OMNI-50 library pool containing OMNI-50 variants is electroporated into the positive selection bacterial strain, only bacterial colonies expressing active OMNI-50 variants that cleave the positive selection plasmid, thereby neutralizing the toxin, will survive on selective plates containing arabinose.

[0226] After a 10-minute recovery period in TB medium following electroporation, transformed bacteria were plated onto selective TB plates containing carbenicillin and 15 mM arabinose and incubated overnight at 37°C. The following morning, surviving colonies were harvested, plasmids isolated, and retransformed into a positively selected bacterial strain for another round of selection. The first generation of mutagenesis involved three rounds of positive selection, followed by a second generation of mutagenesis and an additional six rounds of positive selection. After the final round, individual bacterial colonies were randomly picked and fully sequenced. Unique variants were cloned into the pET9 vector for production of the protein as RNPs. Advanced protein expression and purification

[0227] WT OMNI-50 and its variants were cultured in autoinducing TB medium at 37°C and 250 rpm until OD 600 The lysate was purified by centrifugation at 6000 x g for 20 min and then at 20 ° C for 17-20 hours. The cells were harvested and stored at -80 ° C. The cells were lysed using a chemical lysis method and then centrifuged. The clarified lysate was purified on Ni-NTA resin. The Ni-NTA eluted fraction was purified on CEX (SO3 Fractogel) resin and then SEC purified on Superdex 200Increase 10 / 300GL at AKTA Pure (GE Healthcare Life Sciences). The fractions containing the OMNI-50 variant were pooled and concentrated to 20 mg / ml, filtered at 0.22 μm, quickly frozen in liquid nitrogen, and stored at -80 ° C. HTP protein expression and purification

[0228] WT OMNI-50 and its variants were cultured in autoinduction TB culture medium at 37°C, 350rpm for 3.5 hours and transferred to 18°C ​​for 17-20 hours. Cells were harvested by 4000xg centrifugation and stored at -80°C. OMNI-50 variants and WT cell pellets were thawed and incubated in lysis buffer for 30 minutes. The crude lysate was clarified by centrifugation at 4000xg for 1 hour at 4°C. The clarified protein lysate was incubated with Sepharose 6 Ni-NTA resin (Cytiva). The protein-bound Ni-NTA resin was loaded onto a 96-well filter plate and washed with buffer (HEPES 20mM, NaCl 0.6M, imidazole 60mM) to remove contaminants. Protein was eluted from the resin with a high concentration of imidazole buffer (HEPES 20mM, NaCl 0.6M, imidazole 0.4M). The eluted protein was desalted using a 96-well filter plate containing 1800 μl of G-25 Sephadex resin equilibrated with storage buffer. The desalted protein was then concentrated (Amicon-ultra 0.5 ml 50 kDa, Millipore) and sterile filtered (Ultrafree-MC 0.22 μm PVDF filters). The purified variant was then stored at -80°C and analyzed for concentration, purity, and in vitro activity before being transfected into cells. Screening and cleavage assays in mammalian cells

[0229] 124pmol of the sgRNA listed in Table 5 and 105pmol of nuclease were mixed at room temperature for 10 minutes to prepare an RNP mixture. HSCs homozygous or heterozygous for the ELANE_g58 target site, or SH-SY5Y cells homozygous for hSARM1_g92 were centrifuged at 300g for 5 minutes at room temperature and washed with PBS. The precipitate was resuspended in an appropriate volume of Lonza Nucleofection electroporation solution and transferred to an RNP mixture. Electroporation was performed in triplicate or duplicate using a 4D-Nucleofector device (Lonza Bioscience). Immediately after electroporation, preheated culture medium was added to the sample pool (cuvette). The cells were incubated for 3 days (37°C, 5% CO2). At 72 hours, the cells were harvested, and their genomic DNA contents were used as templates in PCR reactions to amplify the corresponding cleavage targets and off-target targets (if known). The amplicon was subjected to NGS, and the resulting sequence was then used to calculate the percentage of editing events in each target site. Short insertions or deletions (indels) around the cleavage site are a typical consequence of DNA repair following nuclease-induced DNA cleavage. Therefore, the editing percentage was calculated based on the fraction of indel-containing sequences within each amplicon. Protein residual activity determination

[0230] To determine thermal stability, the protein was diluted to 100 nM and incubated at 25°C and 44°C for 10 minutes. Following incubation, 150 nM gRNA was added and incubated at 25°C for 10 minutes. Next, 100 nM DNA was added to the RNPs, and cleavage activity was measured. The percentage of residual activity was calculated by dividing the activity level at 44°C by the activity level at 25°C. result Increased activity and fidelity of two OMNI-50 variants at selected tested target sites

[0231] Two major variants were isolated from the bacterial selection, OMNI-50 V6552 and V6172 (Table 2), which displayed significantly increased activity relative to the WTO OMNI-50 nuclease.

[0232] In HSCs homozygous for ELANE_g58Ref, both variants showed significantly increased activity relative to WT RNP at the human target site used in the selection system ( Figure 1A and 1B In addition to the high activity of these variants, they also showed increased fidelity, as observed by reduced levels of off-target editing of the g58Ref target ( Figure 1C and 1D ). OMNI-50 variants display broadly increased activity at different sites

[0233] The two main variants also showed significantly increased activity relative to WTRNP at other sites when tested in mammalian cells ( Figures 2A-2C , Table 5). When tested in Jurkat cells, V6552 showed higher activity than WT OMNI-50 at the SARM_g13, SARM_g68, and RPE_g13 target sites. When tested in HSC cell lines, V6552 also showed higher activity than WT OMNI-50 at ELANE_g38Ref ( Figure 2B In addition, when tested in Jurkat cells, V6172 showed increased activity against ELANE_g38Ref ( Figure 2C ). OMNI-50 variants show increased specificity

[0234] Discrimination between two heterozygous alleles requires high specificity from the nuclease rather than fidelity, as the undesired DNA site may differ from the target DNA site by only a single nucleotide. When tested in HSCs heterozygous for the ELANE SNP using the selected g58Ref, both variants showed increased discrimination profiles compared to WT OMNI-50, as evidenced by a higher fraction of the unedited Alt allele compared to the target Ref allele ( Figure 3A and 3C However, when treated with the Alt guide RNA, only V6172 showed complete discrimination, indicating that it has the higher specificity of the two. However, both variants maintained a higher level of fidelity than the WT, as indicated by lower off-target editing ( Figure 3B and 3E ).

[0235] We further tested the ability of the V6172 and V6552 variants to distinguish alleles at another ELANE SNP (target 62, Table 5). Figures 4A-4D As shown, when cells were treated with g62Ref, WT OMNI-50 protein primarily cleaved the Ref allele but showed 10% nonspecific editing on the Alt allele. However, V6552 showed specific editing of the Ref target allele with no nonspecific editing of the Alt allele ( Figure 4A Likewise, V6172 showed a higher discrimination profile by almost completely cleaving the target Ref allele without contacting the Alt allele ( Figure 4C This specificity was also demonstrated by the reduction of off-target activity for g62Ref for this variant, which was not the case for V6552. This suggests that specificity can be sequence-dependent in this case ( Figure 4D V6172 was also active against g35 and had reduced off-target activity compared to WT OMNI-50 (0.03% vs. 0.49%, respectively). Figures 5A-5B ). Table 2: Table 3: Table 4: Contribution of each mutation of variant 6552 to nuclease activity and specificity

[0236] OMNI-50V6552 contains six (6) mutations: D252Y, D281V, L302N, N686S, L1100F, and S1339R (Table 2). To better understand the impact and contribution of each mutation to the activity of OMNI-50V6552, we expressed and purified all individual V6552 variants (i.e., each variant had one of the six V6552 mutations) in HTP format and tested their activity and fidelity as RNPs in homozygous HSC cells against the target site ELANE_g58Ref as well as off-target sites of this guide sequence (Table 3, Figures 6A-6B Mutations L1100F and S1339R were the mutations that contributed most to the increased activity, as shown in variants containing their individual mutations (V7101 for the S1339R mutation and V7896 for the L1100F mutation). The combination of these two mutations (V7492) showed even higher increased activity compared to each mutation alone. Although L1100F also increased off-target activity (V7896, Figure 6B ), but S1339R showed reduced editing levels on g58Ref off-target compared with WT (V7101, Figure 6B ), indicating that this mutation may contribute to the improvement of V6552 specificity.

[0237] Although the other four (4) single mutations showed reduced activity in the WT background (V7274, V7275, V7276 and V7277– Figure 6A ), but they did not affect the activity against the full variant V6552, suggesting that they may contribute to the specificity.

[0238] We also tested how reverting each single mutation to WT substitution relative to V6552 affected activity and fidelity. All variants were expressed and purified in HTP format and tested for their activity and fidelity as RNPs in homozygous HSC cells against the target site ELANE_g58Ref and off-target sites of the guide (Table 3, Figures 7A-7B Removal of L1100F (V7257) or S1339R (V7256) reduced activity relative to V6552, again highlighting the importance of these mutations for variant activity. When mutations D252Y (V7253) and L302N (V7255) were removed, there was increased editing in off-target sites relative to V6552, demonstrating the contribution of these mutations to V6552 specificity. Contribution of each mutation of variant 6172 to nuclease activity and specificity

[0239] OMNI-50V6172 contains six (6) mutations: N300A, G614R, N698L, E836F, T939L, and L1100F (Table 2). To better understand the impact and contribution of each mutation to the activity of OMNI-50V6172, we expressed and purified all individual V6172 variants (i.e., each variant harboring one of the six V6172 mutations) in HTP format and tested their activity and fidelity as RNPs in homozygous HSC cells against the target site ELANE_g58Ref as well as off-target sites of this guide ( Figures 8A-8B Here, L1100F (V7896) appears to be the mutation that contributes most to the activity relative to WT ( Figure 8A However, since V6172 itself has higher activity than L1100F, any other mutations of V6172 may contribute to the additional increase in activity. The single mutants N300A (V7239), N698L (V7241), and T939L (V7243) showed a reduction in off-target levels, suggesting that they play a role in the fidelity level ( Figure 8B ).

[0240] We also tested how reverting each single mutation to WT substitution relative to V6712 affected activity and fidelity. All variants were expressed and purified in HTP format and tested for their activity and fidelity as RNPs in homozygous HSC cells against the target site ELANE_g58Ref and off-target sites of the guide. (Table 4, Figures 9A-9B On g58Ref, removal of L1100F (V7143) reduced activity relative to V6172 ( Figure 9A ). However, this reduction was not relative to WT levels, indicating a contribution of other mutations to activity. Removal of one of the mutations, specifically N300A (V7138), T939L (V7142), or N698L (V7140), increased off-target activity compared to V6172, demonstrating their contribution to specificity ( Figure 9B ).

[0241] Because V6172 has a higher level of specificity, as indicated by its ability to discriminate alleles based on the SNP, we further tested the contribution of single mutation removal from V6172 to g58 in heterozygous HSCs using a more challenging version of the Alt guide ( Figure 10 For discrimination, the same trend as for fidelity on g58Alt was observed, where discrimination decreased after removal of N300A (V7138), N698L (V7140), and T939L (V7142). Design of variants with improved activity and fidelity based on variant 6172

[0242] Variant V7765 (which has the following substitutions relative to WT OMNI-50: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, S1339R) is a rationally designed variant based on variant V6172 and has increased activity and specificity. Two additional mutations identified during screening were introduced: S779P and S1339R, which had been shown to increase activity in V6552 (Table 2). The S779P substitution increases OMNI-50 thermostability

[0243] Variants of WT OMNI-50 were screened and a single substitution of position S779 in WT OMNI-50 to a proline residue (i.e., S779P, which formed variant V7261) was identified that significantly increased the thermostability of the protein, as measured by an increase in residual activity at 44°C ( Figure 11 The same effect was observed when S779P was introduced into variant V6552 (i.e., variant V7281, see Table 2). These results indicate that S779P is a global stabilizing mutation that improves the thermal stability of proteins on different mutant backbones. Increased activity of OMNI-50 variants V6552, V6172, and V7765, and increased fidelity of V7765 against different targets

[0244] OMNI-50 variant V6552, OMNI-50 variant V6172, and OMNI-50 variant V7765 were designed to have higher activity than WTOMNI-50. To characterize their activity, we expressed and purified them in HG form and tested their activity as RNPs with their corresponding guide sequences in HSC cells homozygous for the RPE65 and VEGFA3 target sites (Table 3, Figures 12A-12B In fact, V6552, V6172, and V7765 showed high activities at both targets, with V7765 showing the highest activity.

[0245] These variants were then tested on targets with known off-target sites to characterize their activity and specificity. Using the target ELANE_g62Ref, all variants had high activity, however, V6172 and V7765 showed higher fidelity for both off-target sites ( Figures 13A-13C For ELANE_g58Ref, variant V7765 showed the highest activity and fidelity ( Figures 13D-13E The variants were tested against the target hSARM1_g92 in SH-SY5Y cells, with V7765 also showing the highest activity and fidelity ( Figures 13F-13GIn FANCF, V7765 was shown to have higher activity than WT OMNI-50 and similar activity on off-target ( Figures 13H-13I ). Table 5:

Claims

1. A composition comprising a non-naturally occurring nuclease variant having at least 90% identity to SEQ ID NO: 1 and comprising an amino acid substitution at at least one of the following positions relative to SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

2. The composition of claim 1, wherein the nuclease variant comprises an amino acid substitution at at least one of the following positions: L1100, S1339 and / or S779.

3. The composition of any one of claims 1 or 2, wherein the nuclease variant comprises an amino acid substitution at L1100.

4. The composition of any one of claims 1-3, wherein the nuclease variant comprises an amino acid substitution at S1339.

5. The composition of any one of claims 1-4, wherein the nuclease variant comprises amino acid substitutions at positions L1100 and S1339.

6. The composition of any one of claims 1-5, wherein the nuclease variant comprises an amino acid substitution at S779.

7. The composition of any one of claims 1-6, wherein the nuclease variant comprises an amino acid substitution at each of positions L1100, S1339, and S779.

8. The composition of any one of claims 1 to 7, wherein the nuclease variant comprises an amino acid substitution at position L1100, and the amino acid replacing leucine is histidine (L1100H), phenylalanine (L1100F), tryptophan (L1100W), or tyrosine (L1100Y).

9. The composition of any one of claims 1 to 8, wherein the nuclease variant comprises an amino acid substitution at position L1100, and the amino acid substituted for leucine is phenylalanine (L1100F).

10. The composition of any one of claims 1-9, wherein the nuclease variant comprises an amino acid substitution at position S1339, and the amino acid replacing serine is arginine (S1339R), lysine (S1339K) or histidine (S1339H).

11. The composition of any one of claims 1-10, wherein the nuclease variant comprises an amino acid substitution at position S1339, and the amino acid substituted for serine is arginine (S1339R).

12. The composition of any one of claims 1-11, wherein the nuclease variant comprises an amino acid substitution at position S779, and the amino acid replacing the serine is glycine (S779G), alanine (S779A), valine (S779V), cysteine ​​(S779C), proline (S779P), leucine (S779L), isoleucine (S779I), methionine (S779M), tryptophan (S779W), phenylalanine (S779F), aspartic acid (S779D), asparagine (S779N), or histidine (S779H).

13. The composition of any one of claims 1-12, wherein the nuclease variant comprises an amino acid substitution at position S779, and the amino acid substituted for serine is proline (S779P).

14. The composition of any one of claims 1-13, wherein the nuclease variant comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, E836, T939, and L1100.

15. The composition of any one of claims 1-14, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, and L1100F.

16. The composition of any one of claims 1-15, wherein the nuclease variant comprises an amino acid substitution at at least one of the following positions: D252, D281, L302, N368, L1100, and S1339.

17. The composition of any one of claims 1-16, wherein the nuclease variant comprises at least one of the following amino acid substitutions: D252Y, D281V, L302N, N368S, L1100F, and S1339R.

18. The composition of any one of claims 1-17, wherein the nuclease variant comprises an amino acid substitution at at least one of the following positions: N300, G614, N698, S779, E836, T939, L1100, and S1339.

19. The composition of any one of claims 1-18, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

20. The composition of any one of claims 1-19, wherein the nuclease variant is at least 97% identical to the wild-type OMNI-50 protein sequence (SEQ ID NO: 1), comprising at least one amino acid substitution at the following positions: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

21. The composition of any one of claims 1-20, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

22. The composition of any one of claims 1-21, wherein the nuclease variant comprises the amino acid sequence of any one of SEQ ID NOs: 2-30.

23. The composition of any one of claims 1-22, wherein the nuclease variant further comprises at least one nuclear localization sequence (NLS).

24. The composition of any one of claims 1-23, wherein the nuclease variant further comprises at least one affinity tag.

25. The composition of any one of claims 1-24, wherein the nuclease variant is linked to another protein to form a fusion protein.

26. The composition of any one of claims 1-25, wherein the nuclease variant is a nickase or is catalytically inactive.

27. A composition comprising a polynucleotide encoding the nuclease variant according to any one of claims 1 to 26, preferably wherein the polynucleotide is a DNA or RNA molecule, preferably an mRNA molecule.

28. The composition of any one of claims 1-27, further comprising a single guide RNA (sgRNA) molecule, a crRNA molecule and / or a tracrRNA molecule, or a DNA molecule encoding a single guide RNA (sgRNA) molecule, a crRNA molecule and / or a tracrRNA molecule.

29. A method of binding and / or modifying a DNA target site in a cell or a cell-free system, the method comprising delivering to the cell or cell-free system a composition according to any one of claims 1 to 28.

30. The method of claim 29, wherein the binding and / or modification occurs in a eukaryotic cell or a prokaryotic cell.

31. The method of claim 30, wherein the eukaryotic cell is a plant cell or a mammalian cell.

32. The method of claim 31 , wherein the mammalian cell is a human cell.

33. The method of claim 32, wherein the DNA target site is located within or near a disease-causing allele of a gene.

34. The method of any one of claims 29-33, wherein the DNA target site is located in a gene selected from the group consisting of ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, Rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDLR, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7, and HLA-E.

35. The method of any one of claims 29-34, wherein the DNA target is repaired with an exogenous donor molecule.

36. The method of claim 35, wherein the exogenous donor molecule is an RNA or DNA molecule.

37. The method of any one of claims 29-36, wherein the off-target editing activity is reduced by at least 2-fold, 10-fold, 10-fold, or 10-fold relative to the wild-type nuclease (SEQ ID NO: 1). 2 times, 10 3 times, 10 4 times, 10 5 times or 10 6 times.

38. A modified cell obtained by the method of any one of claims 29 to 37.

39. The modified cell of claim 38, wherein the cell is capable of transplantation.

40. The modified cell of any one of claims 38 or 39, wherein the cell is capable of producing progeny cells upon transplantation.

41. The modified cell of any one of claims 38-40, wherein the cell is capable of producing progeny cells following autologous transplantation.

42. The modified cell of any one of claims 38-41, wherein the cell is capable of producing progeny cells for at least 12 months or at least 24 months after transplantation.

43. The modified cell of any one of claims 38-42, wherein the cell is selected from the group consisting of hematopoietic stem cells, progenitor cells, CD34+ hematopoietic stem cells, bone marrow cells, and peripheral mononuclear cells.

44. A composition comprising the modified cell of any one of claims 38-43 and a pharmaceutically acceptable carrier.

45. An in vitro or ex vivo method for preparing the composition of claim 44, comprising admixing cells with a pharmaceutically acceptable carrier.

46. ​​A composition, method, process, kit or use, characterized in that One or more elements disclosed herein.

Images