Application of 4-acetaminobutyric acid and 3, 4-dihydroxyphenylacetic acid in preparation of products for promoting intestinal motility

Abstract

The invention discovers that the components 4-acetaminobutyric acid and 3, 4-dihydroxyphenylacetic acid from the Guizhou Kaey red sour soup can enhance the micro-ecological balance of intestinal tracts, promote intestinal motility and improve constipation or inflammatory bowel diseases. The principle is as follows: 4-acetaminobutyric acid or 3, 4-dihydroxyphenylacetic acid can obviously improve the expression quantity of C-Kit in intestinal tracts and obviously inhibit the expression of inflammatory factors of macrophages.

Description

Technical Field

[0001] The present invention relates to the technical field of nutritional supplements, and in particular to the use of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of a product for promoting intestinal motility. Background Art

[0002] Miao red sour soup is a specialty fermented food of the Miao ethnic group in Guizhou, made from tomatoes, red chili peppers, Litsea cubeba, and ginger, through secondary fermentation. This sour soup retains its original lycopene and capsaicinoids while also producing organic acids such as acetic and lactic acids. Reportedly, the earliest sour soups were made with the remaining liquor from winemaking. Since then, several varieties have emerged. Researchers used Kaili red sour soup produced in Kaili City, Qiandongnan Prefecture, Guizhou Province, as experimental ingredients and analyzed the content of various components using organic acids (lactic, acetic, and citric) and minerals (calcium, phosphorus, iron, and zinc) as test indicators. The results showed that lactic acid was the highest organic acid in the soup, followed by acetic acid. Calcium, phosphorus, and iron were the highest minerals. Comparison with other sour soup products revealed that Guizhou Kaili red sour soup has superior nutritional value.

[0003] The lycopene and capsaicin in Guizhou sour soup have the potential to lower cholesterol, improve blood lipids, and reduce inflammation, while the various organic acids in it have antioxidant properties. In a rat model of nonalcoholic fatty liver disease (NAFLD), a sour soup diet inhibited NAFLD progression and altered the proteome and lipidome of hepatitis cells. However, the molecular mechanism by which sour soup inhibits inflammatory progression remains unclear. Summary of the Invention

[0004] The present invention is conducted to solve the above-mentioned problems, with the aim of exploring the mechanism of sour soup in inhibiting the progression of inflammation. On this basis, the present invention provides the use of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of a product promoting intestinal motility.

[0005] The use of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid provided by the present invention in the preparation of a product promoting intestinal motility may also have the following characteristics: the source of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid is Guizhou Hongsuan Tang.

[0006] In the use of 4-acetaminobutyric acid and 3,4-dihydroxyphenylacetic acid provided by the present invention in the preparation of a product promoting intestinal motility, the product may also have the following characteristics: the content of 4-acetaminobutyric acid is 3.04-3.41 mg / g, and the content of 3,4-dihydroxyphenylacetic acid is 1.04-1.27 mg / g.

[0007] The present invention also provides a nutritional supplement for promoting intestinal motility, which has the following characteristics: the nutritional supplement comprises one of 4-acetylaminobutyric acid or 3,4-dihydroxyphenylacetic acid, or a combination of the two.

[0008] The nutritional supplement for promoting intestinal motility provided by the present invention may also have the following characteristics: it further comprises a food-acceptable carrier or auxiliary material, or a combination of a food-acceptable carrier and auxiliary material.

[0009] Compared with the prior art, the present invention has the following advantages:

[0010] In the present invention, 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid can significantly increase the expression of C-Kit in the intestine and significantly inhibit the expression of macrophage inflammatory factors. Therefore, they can enhance the balance of intestinal microecology, promote intestinal motility, and improve constipation or inflammatory bowel disease, and thus can be used to prepare products that promote intestinal motility. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a graph showing the effect of Guizhou Kaili Hongsuantang on intestinal motility in C57BL / 6 mice according to an embodiment of the present invention, wherein: Figure 1 A is a photo showing the effect of Guizhou Kaili Hongsuan Decoction on the small intestine of constipated C57BL / 6 mice; Figure 1 B is the effect of Guizhou Kaili Hongsuan Decoction gavage on the small intestinal propulsion rate of constipated C57BL / 6 mice; Figure 1 C is the effect of Guizhou Kaili Hongsuan Decoction gavage on fecal water content in constipated C57BL / 6 mice; Figure 1 D is the effect of Guizhou Kaili Hongsuan Decoction gavage on the small intestinal propulsion rate of C57BL / 6 mice with inflammatory bowel disease; Figure 1 E is the result of oral administration of Guizhou Kaili Hongsuan Decoction on the fecal water content of C57BL / 6 mice with inflammatory bowel disease.

[0012] Figure 2 This is the result of the effect of Guizhou Kaili Hongsuan Decoction on the intestinal microorganisms of constipated C57BL / 6 mice. Figure 2 A is a phylogenetic tree diagram showing the effect of oral administration of Guizhou Kaili Hongsuan Decoction on the intestinal microbial flora of constipated C57BL / 6 mice; Figure 2 B is the LEFSe analysis result of the effect of oral gavage of Guizhou Kaili Hongsuan Decoction on the intestinal microbial flora of constipated C57BL / 6 mice.

[0013] Figure 3 : is a graph showing the test results of ingredients in Guizhou Kaili Hongsuantang in an embodiment of the present invention, wherein: Figure 3A is the serum mass spectrometry test results of C57BL / 6 mice treated with Guizhou Kaili Hongsuan Decoction for 2 hours after oral administration; Figure 3 B is the molecular structural formula of 3,4-dihydroxyphenylacetic acid and 4-acetylaminobutyric acid.

[0014] Figure 4 The results of the effects of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid on intestinal motility of C57BL / 6 mice are shown in Figure 2. Figure 4 A is the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the small intestinal propulsion rate of constipated C57BL / 6 mice; Figure 4 B is the effect of oral administration of Guizhou Kaili Hongsuan Decoction with 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the fecal water content of constipated C57BL / 6 mice; Figure 4 C is the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the small intestinal propulsion rate of C57BL / 6 mice with inflammatory bowel disease; Figure 4 D is the result graph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on fecal water content in C57BL / 6 mice with inflammatory bowel disease.

[0015] Figure 5 The results of the effects of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid on C-KIT and inflammatory factors are shown in FIG. Figure 5 A is an IHC photograph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on C-KIT+ cells in constipated C57BL / 6 mice. Figure 5 B is the result diagram of the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factors at the protein level; Figure 5 C is the result diagram of the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factors at the mRNA level; Figure 5 D is the result diagram of the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factor IL-6 at the mRNA level; Figure 5 E is the result graph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factor TNF-α at the mRNA level. DETAILED DESCRIPTION

[0016] To facilitate a clear understanding of the technical means, inventive features, objectives, and efficacy achieved by the present invention, the following examples, combined with accompanying figures, specifically illustrate the use of 4-acetaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of a product promoting intestinal motility. In the following examples, Guizhou Hongsuan Tang is a commercially available product (purchased from Guizhou Lianghuanzhai Catering and Entertainment Management Co., Ltd.). Unspecified reagents and materials were purchased through commercial channels. Experimental procedures and conditions not described were based on conventional procedures and conditions in the art.

[0017] The inflammatory bowel disease-induced C57BL / 6 mouse model, constipation C57BL / 6 mouse model, and control C57BL / 6 mouse model of the present invention are obtained by the following steps:

[0018] Induced C57BL / 6 mouse model of inflammatory bowel disease:

[0019] Experimental principle: Dextran sulfate sodium DSS can destroy the intestinal epithelial barrier and induce inflammatory bowel disease.

[0020] a. Allow C57BL / 6 mice free access to a 1-5% DSS solution for 5-7 days.

[0021] b. Observe the patient for symptoms such as weight loss, diarrhea, and bloody stools.

[0022] c. The drug can be administered in cycles, such as 7 days of drug administration followed by 14 days of water administration, to simulate chronic inflammation.

[0023] Constipation C57BL / 6 Mouse Model:

[0024] Experimental principle: The opioid receptor agonist loperamide (Loperamide, Lop) can inhibit intestinal peristalsis.

[0025] a. Mice were treated with Lop (5 mg / kg / d) by gavage for 3 consecutive days.

[0026] b. Observe the patient and find symptoms such as decreased number of stool particles, hard and dry stools, and prolonged intestinal transit time.

[0027] Control C57BL / 6 mouse model:

[0028] a. Mice were gavaged with phosphate-buffered saline (PBS) (1x) for 3 consecutive days.

[0029] b. The patient was observed and showed no obvious symptoms.

[0030] Example 1

[0031] This example investigates the effect of Guizhou Kaili Hongsuantang on intestinal motility.

[0032] The experimental method of this embodiment is as follows:

[0033] 1.1 Kailihong sour soup gavage

[0034] Dilute the Kailihong sour soup stock solution 5 times with sterile double-distilled water.

[0035] The mouse model was treated by gavage with 100 μL of Kailihongsuantang diluted KSS every day for 5 days.

[0036] 1.2 Small intestinal propulsion rate measurement

[0037] 1.2.1 Oral administration of markers

[0038] After fixation, mice were gavaged with activated carbon suspension (0.2 mL / 10 g) according to their body weight.

[0039] Recording time: start from the completion of gavage.

[0040] 1.2.2 Sacrifice and sampling

[0041] Time point: 30 minutes after oral administration.

[0042] Mice were killed by cervical dislocation, and the entire small intestine from the pylorus to the ileocecal region was quickly removed and placed in ice-cold saline.

[0043] 1.2.3 Measurement data

[0044] Gently straighten the small intestine to avoid stretching and deformation.

[0045] The total length of the small intestine (Ltotal) and the distance from the char front to the pylorus (Lchar) were measured.

[0046] Calculate the small intestinal propulsion rate: propulsion rate (%) = L char / L total × 100%

[0047] 1.3 Determination of water content in mouse feces

[0048] 1.3.1 Stool sample collection

[0049] The natural defecation method is suitable for short-term experiments: place the mice individually in a clean cage (with filter paper), observe for 30-60 minutes, and collect fresh fecal pellets.

[0050] 1.3.2 Weighing wet weight W0

[0051] After collection, the weight of fresh feces was quickly weighed using an electronic balance.

[0052] Record the initial wet weight of each feces W0 in mg.

[0053] 1.3.3 Drying feces

[0054] Oven method: Place feces in aluminum foil or a weighing dish and dry in a 65°C oven for 6 hours to a constant weight, i.e., the difference between two weighings is < 0.1 mg.

[0055] 1.3.4 Weighing dry weight W1

[0056] The dried feces were taken out and cooled to room temperature before weighing the dry weight W1.

[0057] 1.3.5 Calculation of moisture content

[0058] Water content (%) = (W0 − W1) / W0 × 100%

[0059] Figure 1 This is a graph showing the effect of Guizhou Kaili Hongsuantang on intestinal motility in C57BL / 6 mice according to an embodiment of the present invention. Figure 1 A is a photo showing the effect of Guizhou Kaili Hongsuan Decoction on the small intestine of constipated C57BL / 6 mice; Figure 1 B is the effect of Guizhou Kaili Hongsuan Decoction gavage on the small intestinal propulsion rate of constipated C57BL / 6 mice; Figure 1 C is the effect of Guizhou Kaili Hongsuan Decoction gavage on fecal water content in constipated C57BL / 6 mice; Figure 1 D is the effect of Guizhou Kaili Hongsuan Decoction gavage on the small intestinal propulsion rate of C57BL / 6 mice with inflammatory bowel disease; Figure 1 E is the result of oral administration of Guizhou Kaili Hongsuan Decoction on the fecal water content of C57BL / 6 mice with inflammatory bowel disease.

[0060] like Figure 1 As shown in A and B, oral administration of Guizhou Kaili Hongsuan Decoction can significantly increase the small intestinal propulsion rate of constipated C57BL / 6 mice. Figure 1 As shown in C, oral administration of Guizhou Kaili Hongsuan Decoction can significantly increase the fecal water content of the constipated C57BL / 6 mouse model. Figure 1 As shown in D, oral administration of Guizhou Kaili Hongsuan Decoction can significantly increase the small intestinal propulsion rate of the C57BL / 6 mouse model of inflammatory bowel disease. Figure 1 As shown in E, oral administration of Guizhou Kaili Hongsuan Decoction can significantly increase the fecal water content of the C57BL / 6 mouse model of inflammatory bowel disease.

[0061] The experimental results showed that oral administration of Guizhou Kaili Hongsuan Decoction could significantly promote intestinal motility of C57BL / 6 mice.

[0062] Example 2

[0063] This example investigates the effect of Guizhou Kaili Hongsuantang on intestinal microorganisms.

[0064] The experimental method of this embodiment is as follows:

[0065] 2.1 Intestinal flora detection

[0066] 2.1.1 Collection of intestinal contents from mouse models

[0067] 2.1.2 DNA was extracted (using the QIAamp DNA Stool Mini Kit) and DNA concentration and purity were determined (Qubit) (A260 / A280 ≈ 1.8-2.0).

[0068] 2.1.2 PCR amplification of 16S rRNA gene

[0069] (1) Primer selection (taking the amplification of the V3-V4 region as an example):

[0070] Forward primer: 341F (5′-CCTACGGGNGGCWGCAG-3′)

[0071] Reverse primer: 805R (5′-GACTACHVGGGTATCTAATCC-3′)

[0072] (2) Prepare the reaction system (25 μL):

[0073] 2× Taq Master Mix 12.5 μL

[0074] Primer (10 μM) 1 μL each

[0075] 10-50 ng DNA template

[0076] Add ddH2O to 25 μL

[0077] (3) Set up the amplification program:

[0078] 95℃ 3 min

[0079] 95℃ 30 sec, 55℃ 30 sec, 72℃ 45 sec (30 cycles)

[0080] 72℃ 10 min

[0081] (4) After the PCR process is completed, the PCR product is obtained.

[0082] 2.1.3 Library construction and sequencing

[0083] (1) Purification of PCR products: Use AMPure XP magnetic beads to purify the PCR products to remove primers, unreacted nucleotides and other impurities in the PCR reaction.

[0084] (2) Add adapters and indexes: Use the Illumina Nextera XT Index Kit to add adapters and index sequences to the purified PCR products.

[0085] (3) Library quantification: Qubit + Agilent Bioanalyzer (fragment size detection).

[0086] Specifically, to ensure library quality and sequencing accuracy, quantification and quality assessment were performed after library construction. The concentration of the DNA library was measured using a Qubit fluorometer to ensure sufficient DNA for subsequent sequencing. Simultaneously, the library fragment size was analyzed using an Agilent Bioanalyzer to assess the size distribution of the DNA fragments and ensure that the fragment size of the library met the requirements of the sequencing platform.

[0087] (4) Sequencing platform: Illumina MiSeq / NovaSeq (paired-end 250 / 300 bp).

[0088] Specifically, the constructed library is subjected to high-throughput sequencing using the Illumina MiSeq or NovaSeq sequencing platforms. These platforms use paired-end sequencing technology to read sequence information from both ends of the DNA fragment, typically with a sequencing length of 250 or 300 base pairs (bp).

[0089] 2.2 Diversity Analysis

[0090] 2.2.1 Alpha Diversity (within a single sample)

[0091] The richness Chao1, diversity Shannon and dominance Simpson analyses were performed on the intestinal flora of constipated C57BL / 6 mice treated with Guizhou Kaili Hongsuan Decoction.

[0092] The intestinal microbiota of untreated constipated C57BL / 6 mice were analyzed by Chao1 richness, Shannon diversity, and Simpson dominance.

[0093] 2.2.2 β-diversity (differences between samples)

[0094] The differences in the intestinal microbiota between constipated C57BL / 6 mice treated with Guizhou Kaili Hongsuan decoction and untreated constipated C57BL / 6 mice were analyzed based on the Bray-Curtis / UniFrac distance.

[0095] Figure 2 This is the result of the effect of Guizhou Kaili Hongsuan Decoction on the intestinal microorganisms of constipated C57BL / 6 mice. Figure 2 A is a phylogenetic tree diagram showing the effect of oral administration of Guizhou Kaili Hongsuan Decoction on the intestinal microbial flora of constipated C57BL / 6 mice; Figure 2 B is the LEFSe analysis result of the effect of oral gavage of Guizhou Kaili Hongsuan Decoction on the intestinal microbial flora of constipated C57BL / 6 mice.

[0096] like Figure 2 As shown in the results, 16sDNA sequencing results showed that oral administration of Guizhou Kaili Hongsuan Tang could significantly improve the diversity of intestinal flora in the constipated C57BL / 6 mouse model and change the abundance of multiple intestinal flora, that is, Guizhou Kaili Hongsuan Tang could enhance the balance of intestinal microecology.

[0097] Example 3

[0098] This example investigates whether 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid are substances in Guizhou Kaili Hongsuan Tang that promote intestinal motility.

[0099] The experimental method of this embodiment is as follows:

[0100] 3.1 Mouse plasma metabolomics mass spectrometry

[0101] 3.1.1 Sample collection and storage

[0102] Blood collection: 2 hours after oral administration of Kailihong sour soup dilution, blood was collected from the mice's orbits, left to stand at room temperature for 30 minutes, and then centrifuged to obtain plasma.

[0103] 3.1.2 Metabolite extraction

[0104] Metabolite extraction was performed using a mixture of methanol and plasma at a ratio of 9:1.

[0105] 3.1.3 Liquid chromatography-mass spectrometry LC-MS determination

[0106] Figure 3 : This is a graph showing the test results of ingredients in Guizhou Kaili Red Sour Soup in an embodiment of the present invention. Figure 3 A is the serum mass spectrometry test results of C57BL / 6 mice treated with Guizhou Kaili Hongsuan Decoction for 2 hours after oral administration; Figure 3 B is the molecular structural formula of 3,4-dihydroxyphenylacetic acid and 4-acetylaminobutyric acid.

[0107] like Figure 3As shown in A, the results of serum mass spectrometry showed that the relative abundance of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid were significantly increased, indicating that Guizhou Kaili Hongsuantang is rich in 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid, and it is inferred that these two substances are key substances for promoting intestinal motility. Figure 3 Figure B shows the molecular structure of 3,4-dihydroxyphenylacetic acid and 4-acetylaminobutyric acid.

[0108] Specifically, the content of 4-acetylaminobutyric acid in Guizhou Hongsuan Tang is 3.04-3.41 mg / g, and the content of 3,4-dihydroxyphenylacetic acid is 1.04-1.27 mg / g.

[0109] Example 4

[0110] This example investigates the effects of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid on intestinal motility.

[0111] The experimental method of this embodiment is as follows:

[0112] 4.1 Oral administration of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC)

[0113] 4-Acetylaminobutyric acid (ac-GABA) (50 mg kg −1 d −1 ) and 3,4-dihydroxyphenylacetic acid (DOPAC) (50 mg kg −1 d −1 C57BL / 6 mice with inflammatory bowel disease and constipation were gavage-treated for 3 consecutive days, and then the small intestinal propulsion rate and fecal water content of the mice were measured. 4-Acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) were purchased from MedChemExpress.

[0114] Figure 4 The results of the effects of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid on intestinal motility of C57BL / 6 mice are shown in Figure 2. Figure 4 A is the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the small intestinal propulsion rate of constipated C57BL / 6 mice; Figure 4 B is the effect of oral administration of Guizhou Kaili Hongsuan Decoction with 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the fecal water content of constipated C57BL / 6 mice; Figure 4C is the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the small intestinal propulsion rate of C57BL / 6 mice with inflammatory bowel disease; Figure 4 D is the result graph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on fecal water content in C57BL / 6 mice with inflammatory bowel disease.

[0115] like Figure 4 As shown in A, both 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) can increase the small intestinal propulsion rate in the constipated C57BL / 6 mouse model. Figure 4 As shown in Figure B, both 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) can significantly increase the fecal water content of the constipated C57BL / 6 mouse model. Figure 4 Both C, 4-acetylaminobutyric acid (ac-GABA) and 3, 4-dihydroxyphenylacetic acid (DOPAC) can significantly increase the small intestinal propulsion rate in the C57BL / 6 mouse model of inflammatory bowel disease. Figure 4 As shown in D, both 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) significantly increased fecal water content in the C57BL / 6 mouse model of inflammatory bowel disease.

[0116] The experimental results showed that both 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) can promote intestinal motility in C57BL / 6 mice.

[0117] Example 5

[0118] This example investigates whether 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid enhance the activity of intestinal rhythmic cells Cajal cells by inhibiting inflammatory activation of macrophages.

[0119] This example uses an mRNA expression analysis experiment in Cajal cells, and the experimental method is as follows:

[0120] 5.1 Trizol method for extracting total cellular RNA (050403A)

[0121] 5.1.1 Instruments and Materials: High-speed / refrigerated centrifuge (Eppendorf, Germany, 5415D)

[0122] 5.1.2 Reagents:

[0123] (1) Trizol; (2) DEPC water; (3) Chloroform; (4) Isopropyl alcohol; (5) Ethanol.

[0124] 5.1.3 Experimental steps

[0125] (1) Cell collection:

[0126] Cajal cells were cultured at 2 × 10 6 / mL was inoculated into the culture medium. After 24 hours of cell inoculation, the cells were carefully transferred into a 15ml centrifuge tube and centrifuged at 1500 rpm for 10 min to precipitate the suspended cells, and the supernatant was discarded.

[0127] (2) Add 1 ml of PBS to the centrifuge tube, resuspend the cells and transfer them to a 1.5 ml tube. Centrifuge at 1500 rpm for 5 min and discard the supernatant.

[0128] (3) Discard the supernatant, add 2 ml of Earle's solution, gently blow up the cells with a pipette, and centrifuge at 2000 rpm for 5 min. Avoid RNase contamination during the following steps.

[0129] (4) Precool the low-temperature centrifuge to 4°C;

[0130] (5) Add 1 ml of Trizol and gently transfer the cells and Trizol to a 1.5 ml centrifuge tube using a 1 ml pipette;

[0131] (6) Shake the centrifuge tube vigorously by hand (no white cell clumps are visible) about 50 times and let it stand at room temperature for 10 minutes.

[0132] (7) Add 1 / 5 volume (0.2 ml) of chloroform, mix thoroughly by inversion 10 times, and let stand at room temperature for 5 min. (Purpose: separation of RNA, DNA, and protein) Centrifuge at 12,000 g for 15 min at 4°C.

[0133] (8) Carefully aspirate the upper aqueous phase and place approximately 500 μl in another 1.5 ml centrifuge tube (be careful to avoid aspiration of impurities between the aqueous and oil phases). (9) Add an equal volume of isopropanol, invert to mix, and incubate at room temperature for 10 min.

[0134] (10) Centrifugation at 12,000 g for 10 min at 4°C;

[0135] (11) Carefully remove the centrifuge tube, pay attention to the size and position of the sediment, and carefully pour out the supernatant;

[0136] (12) Add 1 ml of ice-cold 75% ethanol to wash the RNA pellet;

[0137] (13) Carefully pour off the supernatant (after adding ethanol, the precipitate will be suspended) and carefully aspirate the remaining supernatant with a pipette;

[0138] (14) Open the centrifuge tube and place it on a clean bench to air dry naturally (about 10-20 minutes, avoid over-drying to prevent dissolution);

[0139] (15) Depending on the size of the precipitate, re-dissolve it with 30-60 μl of DEPC water (a 50°C water bath can assist dissolution);

[0140] (16) Divide into 3-4 tubes, one of which contains 2 μl for concentration determination;

[0141] (17) Seal the container with sealing film and store in a low-temperature refrigerator.

[0142] 5.2 RNA concentration determination

[0143] 5.2.1 Instrument: Nanodrop spectrophotometer 20002000C (Thermo scientific)

[0144] 5.2.2 The specific steps for RNA concentration determination are as follows:

[0145] (1) Open the software and select the detection RNA concentration;

[0146] (2) Lift the sample arm and add DEPC water to the detection base;

[0147] (3) Lower the sample arm and click blank in the software to perform a blank test;

[0148] (4) After completing the blank calibration, lift the sample arm and wipe the DEPC on the upper and lower bases with clean dust-free paper. Then add the sample to the detection base, lower the sample arm, and click "Measure" to detect the sample.

[0149] (5) After testing one sample, when testing the next sample, wipe the samples on the upper and lower bases with clean dust-free paper. Wiping the samples in this way can avoid sample residue on the base.

[0150] (6) After the test is completed, the measured value is exported.

[0151] 5.3 Reverse transcription to generate cDNA (050406A)

[0152] 5.3.1 Instrument: PCR instrument (Eppendorf, Mastercycler personal)

[0153] 5.3.2 Reagents: PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect RealTime) (Takara Catalog No.: RR047)

[0154] 5.3.3 The specific steps of the reverse transcription experiment to generate cDNA are as follows:

[0155] (1) Genomic DNA Removal Reaction: Prepare the reaction mixture on ice according to the ingredients shown in Table 1. To ensure the accuracy of the reaction mixture preparation, prepare the Master Mix according to the number of reactions + 2, then aliquot it into each reaction tube, and finally add the RNA sample. The amount of RNA sample added is 1 μg (the amount of RNA loaded depends on the RNA concentration).

[0156] Table 1 Components of genomic DNA removal reaction solution

[0157]

[0158] After mixing well, let it stand at room temperature for 5 minutes.

[0159] (2) Reverse transcription reaction

[0160] Prepare the reaction mix on ice using the ingredients listed in Table 2. To ensure accurate reaction mix preparation, prepare a Master Mix equal to the number of reactions + 2 for each reaction, then aliquot 10 μl into each reaction tube. Mix gently and immediately proceed with the reverse transcription reaction.

[0161] Table 2 Reverse transcription reaction solution components and conditions

[0162]

[0163] After the reaction, the tubes were placed at 4°C for real-time PCR.

[0164] 5.4 Real-Time PCR

[0165] 5.4.1 Instrument: Biosystems 7500 Fast Real-Time PCR System

[0166] 5.4.2 Reagents: TB Premix Ex Taq™ (Tli RNaseH Plus) (Takara Catalog No. RR420)

[0167] The primer sequences for mouse IL-1β, TNF-α, IL-6, and GAPDH genes used in this example are shown in Table 3:

[0168] Table 3 Gene primer sequences

[0169] Gene Sequences of forward primer Sequences of reverse primer IL-1β (mouse) TGGCAACTGTTCCTG GGAAGCAGCCCTTCATCTTT TNF-α (mouse) GCCTCTTCTCATTCCTGCTT TGGGAACTTCTCATCCCTTTG IL-6 (mouse) CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG GAPDH (mouse) TCCCACTCTTCCACCTTCGA AGTTGGGATAGGGCCTCTCTT

[0170] The above primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and used in subsequent experiments.

[0171] 5.4.3 The experimental steps are as follows:

[0172] (1) Prepare the PCR reaction solution according to the components in Table 4 (the reaction solution should be prepared on ice) and prepare a 20 μl system.

[0173] The 2× real-time quantitative PCR amplification premix solution (Hieff® qPCR SYBR Green MasterMix) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0174] Table 4 PCR reaction solution configuration system:

[0175] Components Volume (μL) Final concentration Hieff® qPCR SYBR Green Master Mix 10 1X forward primer (10 μM) 0.4 0.2μM Reverse primer (10 μM) 0.4 0.2μM Template DNA X - <![CDATA[RNase Free H2O]]> To 20 -

[0176] (2) Perform Real Time PCR reaction

[0177] Two-step PCR amplification standard procedure:

[0178] Stage 1: Pre-denaturation

[0179] Number of Cycles:1 95℃ 30 seconds

[0180] Stage 2: PCR reaction

[0181] Number of Cycles:40

[0182] 95℃ 3 seconds

[0183] 60℃ 30 seconds

[0184] Stage 3: Melt Curve

[0185] (3) Result calculation: The real-time PCR data were analyzed using the 2-ΔΔCt method.

[0186] 5.5 Immunohistochemical staining (IHC)

[0187] Mice were euthanized and colon samples were collected and paraffin-embedded for sectioning.

[0188] 5.5.1 Dewaxing and hydration

[0189] (1) Soak the paraffin sections in xylene I for 10 min, then soak them in xylene II for 10 min to remove the paraffin;

[0190] (2) Wash the sections with anhydrous ethanol for 5 min to remove xylene;

[0191] (3) Soak the slices in 95%, 80%, and 70% ethanol in sequence for 3 minutes at each concentration, gradually reducing the ethanol concentration to help the slices adapt to the hydration process;

[0192] (4) Rinse the sections with distilled water to completely remove the ethanol.

[0193] 5.5.2 Antigen retrieval

[0194] 5.5.2.1 Thermal repair method is more commonly used. The specific steps are as follows:

[0195] (1) Soak the sections in antigen retrieval solution (e.g., 0.01 M citrate buffer, pH 6.0) to allow them to fully contact the retrieval solution;

[0196] (2) Place the slices in a microwave heating device and heat to boiling for 5-10 minutes to ensure antigen repair;

[0197] (3) After heating, the slices were allowed to cool naturally to room temperature to ensure a stable repair process.

[0198] 5.5.2.2 Enzyme repair method: applicable to certain specific antigens, such as trypsin digestion.

[0199] 5.5.3 Blocking endogenous peroxidase

[0200] (1) Add 3% hydrogen peroxide (H2O2) solution to the slices and incubate at room temperature for 10-15 minutes to inhibit the activity of endogenous peroxidase (this step is required for the horseradish peroxidase (HRP) system).

[0201] (2) Wash the sections three times with phosphate-buffered saline (PBS) for 5 minutes each time to remove excess hydrogen peroxide.

[0202] 5.5.4 Closure

[0203] Add 5-10% normal goat serum to the sections and block at room temperature for 30 minutes to reduce nonspecific binding.

[0204] 5.5.5 Primary Antibody Incubation

[0205] Add diluted primary anti-C-KIT antibody to the sections and incubate the sections at 4°C overnight or at 37°C for 1-2 hours.

[0206] Rinse sections three times with PBS for 5 minutes each to remove unbound primary antibody.

[0207] 5.5.6 Secondary Antibody Incubation

[0208] Add HRP-labeled secondary antibody to the sections and incubate at room temperature for 30-60 minutes;

[0209] Rinse sections three times with PBS for 5 minutes each to remove unbound secondary antibody.

[0210] 5.5.7 Color Development (HRP System)

[0211] (1) DAB color development: Add DAB working solution to the slice and control the color development time under a microscope. The color development time is usually 1-5 minutes. Stop the reaction when a clear brown or black reaction is observed in the target area.

[0212] (2) Rinse the sections with distilled water to terminate the color development reaction.

[0213] 5.5.8 Counterstaining and Coverslips

[0214] (1) Immerse the sections in hematoxylin solution for 1-2 minutes to counterstain the cell nuclei;

[0215] (2) Immerse the slices in 1% hydrochloric acid alcohol;

[0216] (3) Use running water or alkaline solution to turn the cell nucleus blue.

[0217] (4) Dehydration and transparency: Soak the sections in graded ethanol (70%, 80%, 95%, 100%), dehydrate them step by step, and then defat them with xylene to make the sections transparent;

[0218] (5) Seal the slides with neutral gum.

[0219] 5.5.9 Microscope observation

[0220] The processed sections were observed and analyzed using a microscope (Leica Versa 8 system), and the results were recorded and images were captured.

[0221] 5.6 Western Blot Assays (WB)

[0222] Mice were euthanized and colon samples were collected and paraffin-embedded for sectioning.

[0223] 5.6.1 Sample preparation

[0224] Add RIPA buffer (containing protease inhibitors) to the sample and lyse on ice, usually for 30 minutes;

[0225] Centrifuge at 4°C, 12,000–14,000 rpm for 10 min, and collect the supernatant.

[0226] Use the BCA or Bradford assay to determine the protein loading amount based on the measured concentration.

[0227] 5.6.2 SDS-PAGE electrophoresis

[0228] 5.6.2.1 Glue filling:

[0229] Separating gel (lower layer, containing 8% acrylamide) and stacking gel (upper layer, containing 5% acrylamide).

[0230] 5.6.2.2 Sample loading:

[0231] Load 20-50 μg protein per well (adjusted according to protein concentration) and add prestained protein marker to the control marker well.

[0232] 5.6.2.3 Electrophoresis:

[0233] At the beginning of electrophoresis, set the constant voltage to 80V (for the stacking gel portion). After the sample has run into the separating gel, adjust it to 120V until the bromophenol blue reaches the bottom of the gel.

[0234] 5.6.3 Transfer, taking wet transfer as an example

[0235] 5.6.3.1 Membrane treatment:

[0236] Soak the PVDF membrane in methanol for 1 min to ensure that the membrane is completely wet, and then equilibrate the PVDF membrane with transfer buffer.

[0237] NC membrane can be directly immersed without methanol treatment.

[0238] 5.6.3.2 Transfer membrane assembly ("sandwich" structure):

[0239] Assemble the transfer device in the order of "negative electrode → sponge pad → filter paper → gel → membrane → filter paper → sponge pad → positive electrode", and pay attention to avoid the generation of bubbles.

[0240] 5.6.3.3 Transfer conditions: constant current 300mA, time 2.5h.

[0241] 5.6.4 Closure

[0242] After transfer, prepare a blocking solution using 5% skim milk dissolved in TBST buffer (containing Tween-20). Place the membrane in the blocking solution and block for 1 hour at room temperature, gently rocking it on a shaker.

[0243] 5.6.5 Primary Antibody Incubation

[0244] Dilute the primary antibody to the desired concentration in blocking buffer. The primary antibodies are listed in Table 5. Place the membrane in the primary antibody solution and incubate overnight at 4°C on a shaker. After incubation, wash the membrane three times with TBST buffer for 10 minutes each.

[0245] Table 5 Primary antibodies corresponding to each protein

[0246] C-KIT Abcam (ab317843) IL-1β R&D (AF-401-NA) GAPDH Abcam (ab8245)

[0247] 5.6.6 Secondary Antibody Incubation

[0248] Dilute HRP-conjugated secondary antibody (anti-rabbit / mouse IgG, purchased from CST) in blocking buffer at a ratio of 1:5000. Immerse the membrane in the secondary antibody solution and incubate at room temperature for 1 hour. After incubation, wash the membrane three times with TBST buffer for 10 minutes each.

[0249] 5.6.7 Development (ECL method)

[0250] 5.6.7.1 ECL reaction:

[0251] Prepare the ECL chemiluminescent reagent by mixing equal volumes of Solution A and Solution B. Add the ECL mixture dropwise to the membrane and allow to react for 1 minute to allow the proteins on the membrane to react with the peroxidase, generating a detectable chemiluminescent signal.

[0252] 5.6.7.2 Imaging:

[0253] The images were developed using a Bio-Rad Laboratories chemiluminescence analyzer. The exposure time was adjusted according to the signal strength to ensure the clearest signal was captured.

[0254] Figure 5 The figure shows the effects of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid on C-KIT and inflammatory factors. Figure 5 A is an IHC photograph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on C-KIT+ cells in constipated C57BL / 6 mice. Figure 5 B is the result diagram of the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factors at the protein level; Figure 5 C is the result diagram of the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factors at the mRNA level; Figure 5 D is the result diagram of the effect of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factor IL-6 at the mRNA level; Figure 5 E is the result graph showing the effects of 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) on the expression of C-KIT and inflammatory factor TNF-α at the mRNA level.

[0255] like Figure 5 As shown in A, 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) can increase the number of C-KIT+ cells in the intestine of constipated C57BL / 6 mice. Figure 5 As shown in Figure B, 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) can increase the expression of C-KIT in the intestine of constipated C57BL / 6 mice and reduce the expression of the inflammatory factor IL-1β. Figure 5 As shown in C to E, the results of real-time quantitative PCR showed that both 4-acetylaminobutyric acid (ac-GABA) and 3,4-dihydroxyphenylacetic acid (DOPAC) could significantly reduce the expression levels of inflammatory factors IL-1β, IL-6, and TNF-α.

[0256] Experimental results showed that oral administration of 4-acetylaminobutyric acid (4ABA) or 3,4-dihydroxyphenylacetic acid (3,4-DHPA) significantly increased C-Kit expression in the intestines of constipated C57BL / 6 mice and significantly inhibited the expression of inflammatory factors in macrophages. This suggests that 4-AABA or 3,4-DHPA promotes intestinal motility in C57BL / 6 mice by enhancing the activity of Cajal cells, a key intestinal rhythmic cell, and inhibiting inflammatory macrophage activation.

[0257] Based on the experimental results of Examples 1-5, it can be concluded that 4-acetaminobutyric acid and 3,4-dihydroxyphenylacetic acid, components of Guizhou Kaili Hongsuantang, can enhance intestinal microecological balance, promote intestinal motility, and improve constipation or inflammatory bowel disease. The mechanism is that 4-acetaminobutyric acid or 3,4-dihydroxyphenylacetic acid can significantly increase C-Kit expression in the intestine and significantly inhibit the expression of inflammatory factors in macrophages.

[0258] Based on this, 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid can improve constipation or inflammatory bowel disease, and can be used to prepare products for promoting intestinal motility.

[0259] Those skilled in the art will appreciate that the present invention is not limited to the foregoing embodiments. The foregoing embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Application of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of products promoting intestinal motility.

2. The use of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of a product for promoting intestinal motility according to claim 1, characterized in that: in, The source of the 4-acetylaminobutyric acid and the 3,4-dihydroxyphenylacetic acid is Guizhou Hongsuantang.

3. The use of 4-acetylaminobutyric acid and 3,4-dihydroxyphenylacetic acid in the preparation of a product for promoting intestinal motility according to claim 2, characterized in that: in, In the Guizhou red sour soup, the content of 4-acetylaminobutyric acid is 3.04-3.41 mg / g, and the content of 3,4-dihydroxyphenylacetic acid is 1.04-1.27 mg / g.

Images