Use of siRNA targeting and inhibiting rabies virus G gene and / or L gene in preparation of medicine for inhibiting rabies
By designing siRNAs that target and inhibit the G and L genes of rabies virus, the problem of the lack of effective treatments for rabies in existing technologies has been solved. This has achieved effective inhibition of viral genes and reduction of viral proliferation, thereby lowering the mortality rate.
Patent Information
- Application Number
- CN202510890283.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-12
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2044-08-12
AI Technical Summary
Current technology lacks effective treatments for rabies, which has a high mortality rate, and the high mutation rate of the virus limits the effectiveness of antiviral drugs and vaccines.
Design siRNAs that target and inhibit the G and/or L genes of rabies virus, including siRNA-G and siRNA-L, and use RNA interference technology to inhibit viral gene expression to prepare drugs that inhibit rabies.
It effectively inhibits the expression of the G and L genes of rabies virus, reduces viral proliferation, provides a pathway for the development of anti-rabies virus drugs, and reduces the mortality rate.
Smart Images

Figure CN120678794B_ABST
Abstract
Description
[0001] This application is a divisional application of the invention patent application with the application number 2024110990459, the application date of August 12, 2024, and the invention name of "Application of siRNA targeting and inhibiting G gene and / or L gene of rabies virus in preparation of medicine for inhibiting rabies". TECHNICAL FIELD
[0002] The present application relates to the technical field of biological medicine, in particular, to the application of siRNA targeting and inhibiting G gene and / or L gene of rabies virus in preparation of medicine for inhibiting rabies. BACKGROUND
[0003] Rabies is a zoonosis caused by Rabies virus (RABV) infection in humans. Rabies can cause fatal encephalitis in mammals, and can cause severe neurological symptoms such as convulsions and paralysis, and eventually death. At present, there is no effective treatment for rabies, and once the clinical symptoms appear, the mortality rate is close to 100%.
[0004] RNA interference (RNAi) is a relatively conservative gene regulation method in the evolution of organisms, which uses small fragments to silence the expression of specific mRNA. In the process of RNA interference, long double-stranded RNA precursors are first cleaved into short interfering RNAs, and then RNA-induced silencing complexes bind to siRNAs and degrade one of the RNA chains, and the other chain guides the RISC complex to specifically degrade the target mRNA sequence.
[0005] The high mutation rate of viruses makes it possible to escape the host's immune system and the therapeutic effects of antiviral drugs and vaccines, so it is particularly important to develop new and alternative antiviral therapies. In recent years, researchers have widely used cell RNA interference technology to target a variety of viral genes, and siRNAs designed for different viral genes can significantly inhibit the replication ability of viruses after infecting cells, thereby playing a therapeutic role.
[0006] Currently, the design of siRNA against rabies virus mainly targets N gene and P gene, and the research on targeting genes of rabies virus is particularly important, which can provide more target points for preventing and treating rabies, and thus achieve the prevention and treatment of rabies virus. SUMMARY
[0007] The purpose of the present application is to overcome the above-mentioned shortcomings of the prior art, and to provide the application of siRNA targeting and inhibiting G gene and / or L gene of rabies virus in preparation of medicine for inhibiting rabies.
[0008] The first object of the present application is to provide an application of siRNA targeting and inhibiting G gene and / or L gene of rabies virus in preparing a medicine for inhibiting rabies.
[0009] The second object of the present application is to provide siRNA-G targeting and inhibiting G gene of rabies virus.
[0010] The third object of the present application is to provide siRNA-L targeting and inhibiting L gene of rabies virus.
[0011] The fourth object of the present application is to provide an application of the above-mentioned siRNA-G and / or the above-mentioned siRNA-L in preparing a medicine for inhibiting rabies.
[0012] The fifth object of the present application is to provide a pharmaceutical composition for inhibiting rabies.
[0013] In order to achieve the above-mentioned objects, the present application is achieved by the following scheme:
[0014] The present application claims an application of siRNA targeting and inhibiting G gene and / or L gene of rabies virus in preparing a medicine for inhibiting rabies.
[0015] Preferably, the inhibiting rabies is inhibiting expression of G gene and / or L gene of rabies virus.
[0016] Preferably, the rabies is rabies virus CVS-11 strain.
[0017] The present application also claims siRNA-G targeting G gene of rabies virus, wherein the nucleotide sequence of the sense strand of the siRNA-G is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of the siRNA-G is shown in SEQ ID NO: 2.
[0018] The present application also claims siRNA-L targeting and inhibiting L gene of rabies virus, wherein the nucleotide sequence of the sense strand of the siRNA-L is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is shown in SEQ ID NO: 4.
[0019] The present application also claims an application of the above-mentioned siRNA-G and / or the above-mentioned siRNA-L in preparing a medicine for inhibiting rabies.
[0020] Preferably, the rabies virus is rabies virus CVS-11 strain.
[0021] Preferably, the inhibiting rabies is inhibiting expression of G gene and / or L gene of rabies virus.
[0022] The application also claims a pharmaceutical composition for inhibiting rabies, comprising the siRNA-G, the siRNA-L and / or the delivery system.
[0023] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
[0024] More preferably, the pharmaceutical composition is administered intracranially, by intramuscular injection and / or by intravenous injection.
[0025] Compared with the prior art, the application has the following beneficial effects:
[0026] The application provides the use of siRNA for targeting and inhibiting the G gene and / or the L gene of rabies virus in the preparation of a medicine for inhibiting rabies. Furthermore, the application provides siRNA-G for targeting and inhibiting the G gene of rabies virus and siRNA-L for targeting and inhibiting the L gene of rabies virus, wherein the nucleotide sequence of the sense strand of the siRNA-G is shown in SEQ ID NO: 1, the nucleotide sequence of the antisense strand of the siRNA-G is shown in SEQ ID NO: 2; the nucleotide sequence of the sense strand of the siRNA-L is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is shown in SEQ ID NO: 4. The siRNA-G and / or the siRNA-L can effectively inhibit the expression of the G gene and the L gene of rabies virus, reduce the proliferation of rabies virus, and can be used as an effective small nucleic acid drug in the development of an anti-rabies virus medicine. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 Fig. 2 is a fluorescence microscope observation result diagram of each cell plate in the direct immunofluorescence detection process in Example 2;
[0028] Figure 2Figure of detection result of fluorescent quantitative PCR in Example 2; A is the figure of mRNA level of L gene in si-L2157-NA fluorescent amplification product, si-L5055-NA fluorescent amplification product, si-L5773-NA fluorescent amplification product and siNC-NA fluorescent amplification product; B is the figure of mRNA level of L gene in si-L2157-BHK fluorescent amplification product, si-L5055-BHK fluorescent amplification product, si-L5773-BHK fluorescent amplification product and siNC-BHK fluorescent amplification product; C is the figure of mRNA level of G gene in si-G997-NA fluorescent amplification product, si-G193-NA fluorescent amplification product, si-G672-NA fluorescent amplification product and siNC-NA fluorescent amplification product; D is the figure of mRNA level of G gene in si-G997-BHK fluorescent amplification product, si-G193-BHK fluorescent amplification product, si-G672-BHK fluorescent amplification product and siNC-BHK fluorescent amplification product;
[0029] Figure 3 Figure of TCID in Example 2 50 Figure of detection result; A is the figure of TCID in si-G997-NA virus liquid infected NA cells 50 , si-G193-NA virus liquid infected NA cells 50 , si-G672-NA virus liquid infected NA cells 50 and siNC-NA virus liquid infected NA cells 50 , B is the figure of TCID in si-L5055-NA virus liquid infected NA cells 50 , si-L2157-NA virus liquid infected NA cells 50 , si-L5773-NA virus liquid infected NA cells 50 and siNC-NA virus liquid infected NA cells 50 ;
[0030] Figure 4 Figure of identification result of expression plasmid in Example 3
[0031] Figure 5 Figure of identification result of packaging plasmid in Example 3
[0032] Figure 6 Figure of fluorescence curve of pAAV-EGFP with different copy numbers in Example 3
[0033] Figure 7 Figure of standard curve in Example 3
[0034] Figure 8 Figure for virus titer detection results of cell supernatant at different times after inoculation of CVS-11 strain in Example 4 and figure for transcription level detection results of each recombinant adeno-associated virus infection group; A is G gene transcription level results of rAAV-G997 recombinant adeno-associated virus infection group and rAAV-NC recombinant adeno-associated virus infection group; B is L gene transcription level results of rAAV-L5055 recombinant adeno-associated virus infection group and rAAV-NC recombinant adeno-associated virus infection group; C is a figure for virus titer detection results of cell supernatant at different times after inoculation of CVS-11 strain in rAAV-G997 recombinant adeno-associated virus infection group and rAAV-NC recombinant adeno-associated virus infection group; D is a figure for virus titer detection results of cell supernatant at different times after inoculation of CVS-11 strain in rAAV-L5055 recombinant adeno-associated virus infection group and rAAV-NC recombinant adeno-associated virus infection group
[0035] Figure 9 Figure for body weight change rate of each group of mice at 21 days after challenge in Example 5;
[0036] Figure 10 Figure for survival rate change of each group of mice at 21 days after challenge in Example 5. DETAILED DESCRIPTION
[0037] The application will be further described in conjunction with the drawings and specific examples in the specification, which are only used to explain the application and are not used to limit the scope of the application. The test methods used in the following examples are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.
[0038] Example 1 Design and synthesis of siRNA
[0039] I. Experimental methods
[0040] Based on the CDS region of rabies CVS-11 strain G gene (accession number: GQ918139.1), sequences with AA initiation, CG base percentage content at 30%-55%, single base continuous repeat number <4 and length of 21 bases were screened, and 19 bases after AA were used as target sequences. siRNA targeting rabies CVS-11 strain G gene was designed using online software (https: / / sidirect2.rnai.jp / ), including si-G997, si-G193 and si-G672.
[0041] Based on the CDS region of the L gene of the rabies CVS-11 strain (Accession No. GQ918139.1), a sequence with an "AA" start, a percentage of CG bases of 30% to 55%, a number of consecutive single base repeats of <4, and a length of 21 bases was screened. The 19 bases after AA were used as a target sequence, and siRNA targeting the L gene of the rabies CVS-11 strain was designed using online software (https: / / sidirect2.rnai.jp / ), including si-L5055, si-L2157, and si-L5773.
[0042] Design of siNC: siNC used exactly the same base composition as si-G997, with AA fixed as the start, and the remaining 19 bases randomly arranged. BLAST comparison was performed to determine that the arrangement had no significant homology with rabies virus and known genes in the GenBank database, and was used as a negative control siNC.
[0043] II. Experimental results
[0044] The forward and reverse strands and nucleotide information of the siRNA designed in step one are shown in Table 1.
[0045] Table 1 Forward and reverse strands and nucleotide information of siRNA
[0046]
[0047] Example 2 Effect of siRNA on rabies virus in cells
[0048] I. Experimental methods
[0049] 1. Construction of experimental group cells
[0050] (1) Construction of NA cell plates
[0051] 1) NA cells were seeded in cell culture dishes and cultured in RPMI-1640 medium until the NA cells covered the culture dishes. The culture medium was discarded, and the culture dishes were washed with PBS three times. Then the PBS was discarded, 2 mL of trypsin with a concentration of 0.25% (w / w) was added to digest the cells for 30 s, the trypsin was discarded, and complete culture medium was added to suspend the cells, obtaining a cell suspension with a concentration of 200,000 cells / mL. The cell suspension was seeded into 12-well cell culture plates at 1 mL / well, and cultured at 37°C in 5% (w / w) CO2, obtaining the NA cell plates to be transfected.
[0052] 2) Two 1.5 mL EP tubes were labeled as A and B tubes, 100 μL of RPMI-1640 medium was added to each of the A and B tubes, then 2 μL of Lipofectamine TM3000 Transfection reagent and mix well, add 4 μL si-G997 shown in Example 1 with a concentration of 20 μM in B tube and mix well, then add the liquid in B tube into A tube and mix well, stand at 25 ℃ for 15 min, to obtain si-G997 transfection complex.
[0053] Replace si-G997 shown in Example 1 in B tube with si-G193, si-G672, si-L5055, si-L2157, si-L5773 and siNC shown in Example 1 in turn, to obtain si-G193 transfection complex, si-G672 transfection complex, si-L5055 transfection complex, si-L2157 transfection complex, si-L5773 transfection complex and siNC transfection complex.
[0054] 3) si-G997-NA cell plate: Discard the liquid in the NA cell plate to be transfected obtained in step 1), and wash with PBS for 2 times, then add 1640 culture medium at 500 μL / well, then add si-G997 transfection complex obtained in step 2) at 206 μL / well, and incubate at 37 ℃, 5% (w / w) CO2 for 6 h, then discard the liquid in the cell plate, to obtain si-G997-NA cell plate.
[0055] si-G193-NA cell plate: Replace si-G997 transfection complex in the process of constructing si-G997-NA cell plate with si-G193 transfection complex obtained in step 2), and the rest is the same, to obtain si-G193-NA cell plate.
[0056] si-G672-NA cell plate: Replace si-G997 transfection complex in the process of constructing si-G997-NA cell plate with si-G672 transfection complex obtained in step 2), and the rest is the same, to obtain si-G672-NA cell plate.
[0057] si-L5055-NA cell plate: Replace si-G997 transfection complex in the process of constructing si-G997-NA cell plate with si-L5055 transfection complex obtained in step 2), and the rest is the same, to obtain si-L5055-NA cell plate.
[0058] si-L2157-NA cell plate: Replace si-G997 transfection complex in the process of constructing si-G997-NA cell plate with si-L2157 transfection complex obtained in step 2), and the rest is the same, to obtain si-L2157-NA cell plate.
[0059] si-L5773-NA cell plate: replace si-G997 transfection complex in si-G997-NA cell plate construction process with si-L5773 transfection complex obtained in step 2), and the rest is the same, to obtain si-L5773-NA cell plate.
[0060] siNC-NA cell plate: replace si-G997 transfection complex in si-G997-NA cell plate construction process with siNC transfection complex obtained in step 2), and the rest is the same, to obtain siNC-NA cell plate.
[0061] (2) Construction of BHK-21 cell plate
[0062] Replace NA cells in step (1) with BHK-21 cells, and the rest is the same, to obtain to-be-transfected BHK cell plate, si-G997-BHK cell plate, si-G193-BHK cell plate, si-G672-BHK cell plate, si-L5055-BHK cell plate, si-L2157-BHK cell plate, si-L5773-BHK cell plate and siNC-BHK cell plate.
[0063] 2. Direct immunofluorescence detection
[0064] According to MOI = 0.1, inoculate rabies virus CVS-11 strain into to-be-transfected HA cell plate, si-G997-NA cell plate, si-G193-NA cell plate, si-G672-NA cell plate, si-L5055-NA cell plate, si-L2157-NA cell plate, si-L5773-NA cell plate, siNC-NA cell plate, to-be-transfected BHK cell plate, si-G997-BHK cell plate, si-G193-BHK cell plate, si-G672-BHK cell plate, si-L5055-BHK cell plate, si-L2157-BHK cell plate, si-L5773-BHK cell plate and siNC-BHK cell plate obtained in step 1 respectively, and use RPMI-1640 culture medium to culture for 48 h, then discard the liquid, wash each cell plate once with PBS, add 80% (v / v) acetone to each cell plate at 500 μL / well, and place it at -20°C for 30 min, then discard the acetone, wash each cell plate 3 times with PBS, add fluorescein isothiocyanate (FITC) labeled anti-rabies virus N protein fluorescent antibody to each cell plate at 400 μL / well, and place it at 4°C for 16 h, then discard the fluorescein isothiocyanate (FITC) labeled anti-rabies virus N protein fluorescent antibody and wash 3 times with PBS, add PBS to each cell plate at 1 mL / well, and then place each cell plate under a fluorescence microscope for observation.
[0065] 3. Fluorescent quantitative PCR detection
[0066] The si-G997-NA cell plates, si-G193-NA cell plates, si-G672-NA cell plates, si-L5055-NA cell plates, si-L2157-NA cell plates, si-L5773-NA cell plates, siNC-NA cell plates, si-G997-BHK cell plates, si-G193-BHK cell plates, si-G672-BHK cell plates, si-L5055-BHK cell plates, si-L2157-BHK cell plates, si-L5773-BHK cell plates and siNC-BHK cell plates obtained in step 1 were inoculated with rabies virus CVS-11 strain at MOI = 0.1, respectively, and cultured in RPMI-1640 medium for 48 h, then the liquid in each cell plate was discarded, washed once with PBS, and then 1 mL / well of Trizol was added to each cell plate, the cells were blown, and the supernatant in each cell plate was collected to obtain si-G997-NA supernatant, si-G193-NA supernatant, si-G672-NA supernatant, si-L5055-NA supernatant, si-L2157-NA supernatant, si-L5773-NA supernatant, siNC-NA supernatant, si-G997-BHK supernatant, si-G193-BHK supernatant, si-G672-BHK supernatant, si-L5055-BHK supernatant, si-L2157-BHK supernatant, si-L5773-BHK supernatant and siNC-BHK supernatant.
[0067] RNA of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK and siNC-BHK were obtained by using HiPure Universal RNA Mini Kit (Magen, R4130-02) according to the kit instructions.
[0068] The si-G997-NA cDNA, si-G193-NA cDNA, si-G672-NA cDNA, si-L5055-NA cDNA, si-L2157-NA cDNA, si-L5773-NA cDNA, siNC-NA cDNA, si-G997-BHK cDNA, si-G193-BHK cDNA, si-G672-BHK cDNA, si-L5055-BHK cDNA, si-L2157-BHK cDNA, si-L5773-BHK cDNA and siNC-BHK cDNA were obtained by using the EasyScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) Reversal Kit (Aubio, AU341-02) and the RNA of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK and siNC-BHK as templates, mixing uniformly according to the reverse transcription system shown in Table 2, incubating at 42°C for 15 min, and heating at 85°C for 5 s.
[0069] Table 2 Reverse transcription system
[0070] Components Amount Template (RNA) 1 μg 5x EasyScript All-in-One SuperMix for qPCR 4 μL gDNA Remover 1 μL RNase-free Water qS up to 20 μL Total volume 20 μL
[0071] Using cDNA from si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK, and siNC-BHK as templates, respectively, PerfectStart Green qPCR was performed. The SuperMix Quantitative PCR kit (TransGen Biotech, AQ601-01-V2) was used to perform qPCR fluorescence amplification according to the kit instructions, yielding the following fluorescent amplification products: si-G997-NA (corresponding to the G gene of CVS-11), si-G193-NA (corresponding to the G gene of CVS-11), si-G672-NA (corresponding to the G gene of CVS-11), si-L5055-NA (corresponding to the L gene of CVS-11), si-L2157-NA (corresponding to the L gene of CVS-11), si-L5773-NA (corresponding to the L gene of CVS-11), siNC-NA, and si-G997- The following fluorescent amplification products were analyzed: BHK fluorescent amplification products (corresponding to the G gene of CVS-11), si-G193-BHK fluorescent amplification products (corresponding to the G gene of CVS-11), si-G672-BHK fluorescent amplification products (corresponding to the G gene of CVS-11), si-L5055-BHK fluorescent amplification products (corresponding to the L gene of CVS-11), si-L2157-BHK fluorescent amplification products (corresponding to the L gene of CVS-11), si-L5773-BHK fluorescent amplification products (corresponding to the L gene of CVS-11), and siNC-BHK fluorescent amplification products. The Ct values of each fluorescent amplification product were observed using a fluorescence inverted microscope, and the transcription level (i.e., mRNA level) of the G gene or L gene of each fluorescent product was calculated according to the 2-ΔΔCt method.
[0072] The nucleotide sequence of the forward primer CVS-G-F in the qPCR fluorescence quantification process is shown in SEQ ID NO: 15, and the nucleotide sequence of the reverse primer CVS-G-R is shown in SEQ ID NO: 16 when the cDNA of si-G997-NA, the cDNA of si-G193-NA, the cDNA of si-G672-NA, the cDNA of si-G997-BHK, the cDNA of si-G193-BHK or the cDNA of si-G672-BHK is used as a template; the nucleotide sequence of the forward primer CVS-L-F in the qPCR fluorescence quantification process is shown in SEQ ID NO: 17, and the nucleotide sequence of the reverse primer CVS-L-R is shown in SEQ ID NO: 18 when the cDNA of si-L5055-NA, the cDNA of si-L2157-NA, the cDNA of si-L5773-NA, the cDNA of si-L5055-BHK, the cDNA of si-L2157-BHK or the cDNA of si-L5773-BHK is used as a template; the nucleotide sequence of the forward primer GAPDH-F in the qPCR fluorescence quantification process is shown in SEQ ID NO: 19, and the nucleotide sequence of the reverse primer GAPDH-R is shown in SEQ ID NO: 20 when the cDNA of siNC-NA or the cDNA of siNC-BHK is used as a template; the primer information used in the qPCR fluorescence quantification process is shown in Table 3.
[0073] Table 3 Primer information used in the qPCR fluorescence quantification process
[0074] Name Nucleotide information (5'-3') CVS-G-F (SEQ ID NO: 15) TCCCTGGAGCCCTATTGACA CVS-G-R (SEQ ID NO: 16) ACCCGTTCACTTTGATGGCT CVS-L-F (SEQ ID NO: 17) TCTCTCAAAGTGGGCGGAAC CVS-L-R (SEQ ID NO: 18) ACATCTCCGGCTCCTGTTTG GAPDH-F (SEQ ID NO: 19) CGTCCCGTAGACAAAATGGT GAPDH-R (SEQ ID NO: 20) TTGATGGCAACAATCTCCAC
[0075] 4、TCID 50 Detection
[0076] The si-G997-NA cell plate, the si-G193-NA cell plate, the si-G672-NA cell plate, the si-L5055-NA cell plate, the si-L2157-NA cell plate, the si-L5773-NA cell plate and the siNC-NA cell plate obtained in step 1 were inoculated with the rabies virus CVS-11 strain at a MOI of 0.1, respectively, and after being cultured in RPMI-1640 medium for 48 h, the supernatants of the cell plates were collected to obtain si-G997-NA virus liquid, si-G193-NA virus liquid, si-G672-NA virus liquid, si-L5055-NA virus liquid, si-L2157-NA virus liquid, si-L5773-NA virus liquid and siNC-NA virus liquid.
[0077] NA cells in good growth condition were passaged into 96-well plates and cultured in a constant temperature incubator at 37°C and 5% (w / w) CO2 to obtain NA cell 96-well plates with a cell density of 10,000 cells / well.
[0078] Next, the si-G997-NA virus solution was serially diluted 10-fold using RPMI 1640 medium (dilution factor 10). -1 ~10 -8 Si-G997-NA virus solution of various dilutions was seeded into NA cell 96-well plates at 100 μL / well (4 replicates per dilution). The plates were incubated at 37°C, 5% (w / w) CO2 in RPMI-1640 medium containing 5% (v / v) serum for 48 h. The medium was discarded, and the plates were washed with PBS at 100 μL / well. The PBS was discarded, and 80% (v / v) acetone was added at 100 μL / well. The plates were fixed at -20°C for 30 min, and the acetone was discarded. After washing three times with PBS, 50 μL of anti-rabies virus N protein fluorescent antibody (Fujirebio) was added to each well in the dark. Diagnostic (product number 800-092) dilution buffer (fluorescent antibody and PBS mixed at a volume ratio of 1:400), incubated at 4°C for 16 h, supernatant discarded, washed 3 times with PBS, then added 100 μL / well of PBS, observed fluorescence under a fluorescence microscope, and wells where fluorescence was detected were marked as positive wells. The viral titer (TCID) in NA cells infected with si-G997-NA virus solution was calculated using the Karber method. 50 ).
[0079] Replace the si-G997-NA virus solution with si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, and siNC-NA virus solution, respectively. Calculate the viral titers in NA cells infected with si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, and siNC-NA virus solution, respectively, using the method described above.
[0080] II. Experimental Results
[0081] 1. Direct immunofluorescence detection results
[0082] The following are images of fluorescence microscopy observations of each cell plate during direct immunofluorescence detection:Figure 1 As shown in the results, it is shown that the fluorescent spots in the cell plates transfected with si-G997, si-G193, si-G672 and si-L5055 are significantly reduced compared with the negative control (siNC, i.e. cell plates transfected with siNC) and the viral control (viral control, i.e. cell plates to be transfected), indicating that the transfected cells can significantly inhibit the proliferation of the rabies virus (CVS-11 strain);
[0083] 2. Results of fluorescence quantitative PCR detection
[0084] The results of fluorescence quantitative PCR detection are shown in the following figures: Figure 2 As shown in the results, it is shown that the fluorescent spots in the cell plates transfected with si-G997, si-G193, si-G672 and si-L5055 are significantly reduced compared with the negative control (siNC, i.e. cell plates transfected with siNC) and the viral control (viral control, i.e. cell plates to be transfected), indicating that the transfected cells can significantly inhibit the proliferation of the rabies virus (CVS-11 strain);
[0085] The results show that the mRNA levels of the rabies virus L gene in the NA cells and BHK-21 cells transfected with si-L5055 are significantly decreased compared with the negative control (siNC), while the mRNA levels of the rabies virus L gene in the NA cells and BHK-21 cells transfected with si-L2157 or si-L5773 do not decrease and even increase;
[0086] Compared with the negative control (siNC), the mRNA levels of the rabies virus G gene in the NA cells and BHK-21 cells transfected with si-G193, si-G672 and si-G997 are significantly decreased.
[0087] The results show that both si-G997 and si-L5055 can effectively interfere with the transcriptional expression of rabies virus genes in cells. Among them, si-G997 can significantly inhibit the transcriptional expression of the G gene of rabies virus (CVS-11 strain), and si-L5055 can significantly inhibit the transcriptional expression of the L gene of rabies virus (CVS-11 strain).
[0088] 3. TCID 50 Test results
[0089] TCID 50 The test results are shown in the image below. Figure 3 As shown, A represents the TCID in NA cells infected with si-G997-NA virus fluid. 50 TCID in NA cells infected with si-G193-NA virus fluid 50 TCID in NA cells infected with si-G672-NA virus 50 TCID in NA cells infected with siNC-NA viral fluid 50 The results are shown in Figure B, where B represents TCID in NA cells infected with si-L5055-NA virus fluid. 50 TCID in NA cells infected with si-L2157-NA virus 50 TCID in NA cells infected with si-L5773-NA virus 50 TCID in NA cells infected with siNC-NA viral fluid 50 The result image.
[0090] The results showed that TCID levels in NA cells infected with siNC-NA virus were significantly lower than those in the negative control (i.e., TCID levels in NA cells infected with siNC-NA virus fluid). 50 Compared to si-G997-NA virus solution, the viral titer in NA cells infected with si-L5055-NA virus solution was significantly reduced; while the viral titer in NA cells infected with other viral solutions did not show significant changes.
[0091] The results show that si-G997 and si-L5055 can significantly inhibit the replication of rabies virus (CVS-11 strain); while si-G193, si-G672, si-L2157 and si-L5775 cannot inhibit the replication of rabies virus.
[0092] Example 3: Construction of lentiviruses packaging siRNA
[0093] I. Experimental Methods
[0094] 1. Construction of lentivirus rAAV-G997 containing si-G997 (siRNA-G)
[0095] (1) Construction of expression plasmid:
[0096] 1) Synthesize si-G997-F with nucleotide sequence as shown in SEQ ID NO: 21 and si-G997-R with nucleotide sequence as shown in SEQ ID NO: 22 as insertion site at Xba I and Kpn I enzyme cutting sites of pEU6 vector; wherein the total amount of si-G997-F or si-G997-R is greater than or equal to 2OD.
[0097] wherein the structure of si-G997-F is: 5'-Xba I sticky end + sense + loop + antisense + transcription termination site + Kpn I sticky end - 3';
[0098] The structure of si-G997-R is: 5'-Kpn I sticky end + transcription termination site complementary sequence + sense + loop + antisense + Xba I complementary sticky end - 3'.
[0099] 2) Put the annealing system shown in Table 4 into a PCR tube, mix well by blowing, and then anneal to obtain double-stranded DNA.
[0100] Table 4 Annealing system
[0101] Components Volume si-G997-F (SEQ ID NO: 21, 100 μM) 5 μL si-G997-R (SEQ ID NO: 22, 100 μM) 5 μL T4 DNA Ligase 10x Buffer 5 μL Deionized water 35 μL Total volume 50 μL
[0102] Annealing program: 95℃, 2min; 95℃, 20s, 70 cycles, each cycle decreasing by 1℃.
[0103] The pEU6 vector is linearized by double enzyme cutting with Xba I endonuclease and Kpn I endonuclease, and connected according to the connection system shown in Table 5 to obtain the recombinant pEU6 vector.
[0104] Table 5 Connection system
[0105]
[0106]
[0107] Connection program: 22℃, 30min; 65℃, 10min.
[0108] 3) Transform 10 μL of the recombinant pEU6 vector obtained in step 2) into E. coli competent cells DH5a for culture, select 5 E. coli DH5a monoclonal colonies transformed with the recombinant pEU6 vector, and identify them using the U6 upstream identification primer having the nucleotide sequence set forth in SEQ ID NO: 23 and the U6 downstream identification primer having the nucleotide sequence set forth in SEQ ID NO: 24 (amplification fragment length: 666 bp), and record the electrophoresis bands, and the recombinant pEU6 vector identified correctly is the expression plasmid pEU6-si-G997.
[0109] (2) Construction of a packaging plasmid
[0110] 1) Insert the EGFP fluorescent protein into the Xba I site of the pAAV-CMV Verctor vector (Takara, item number 6230) to obtain the pAAV-EGFP vector.
[0111] Use the Hind III enzyme cleavage site of the pAAV-EGFP vector as the insertion site, and synthesize the CMV-U6-G997-F having the nucleotide sequence set forth in SEQ ID NO: 25 and the CMV-U6-G997-R having the nucleotide sequence set forth in SEQ ID NO: 26.
[0112] 2) Use the Thermo Hind III fast endonuclease to cleave the pAAV-EGFP vector to obtain the linearized pAAV-EGFP vector.
[0113] Use the pEU6-si-G997 plasmid obtained in step (1) as the template, and use the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Novozyme) to amplify the G997 siRNA expression frame according to the instructions thereof in combination with the CMV-U6-G997-F having the nucleotide sequence set forth in SEQ ID NO: 25 and the CMV-U6-G997-R having the nucleotide sequence set forth in SEQ ID NO: 26.
[0114] Use the T4 DNA ligase to ligate the G997 siRNA expression frame and the linearized pAAV-EGFP vector to obtain the recombinant pAAV-EGFP vector.
[0115] 3) Take 10 μL of the recombinant pAAV-EGFP vector obtained in step 2) and transform E. coli DH5a competent cells for culture, select 8 E. coli DH5a monoclonal colonies transformed with the recombinant pAAV-EGFP, and identify them using the CMV-U6-siRNA upstream identification primer with the nucleotide sequence shown in SEQ ID NO: 27 and the CMV-U6-siRNA downstream identification primer with the nucleotide sequence shown in SEQ ID NO: 28 (amplification fragment length is 934 bp). The recombinant pAAC-EGFP vector identified correctly is the packaging plasmid pAAV-si-G997.
[0116] (3) Construction of recombinant adeno-associated virus rAAV-G997
[0117] 1) After culturing the E. coli DH5a monoclonal colonies transformed with the recombinant pAAV-EGFP in LB medium at 37°C for 16 h, obtain bacterial liquid; then inoculate 200 mL of ampicillin-resistant LB medium with the bacterial liquid at a volume ratio of 1:100, and incubate at 37°C for 16 h. Extract the plasmid using a plasmid extraction kit (OMEGA) according to the instructions, and obtain 300 μg of pAAV-si-G997 plasmid.
[0118] 2) Prepare two 50 mL centrifuge tubes, labeled as A tube and B tube; add 120 μg of pAAV-si-G997 obtained in step 2, 120 μg of pHelper, and 120 μg of pRC2-mi342 to the A tube, and use high-glucose DMEM to supplement the liquid volume in the A tube to 15 mL, and mix well.
[0119] Add 720 μL of transfection reagent lipo293TM to the B tube, and use high-glucose DMEM to supplement the liquid volume in the B tube to 15 mL, and mix well.
[0120] Pour the liquid in the B tube into the A tube, mix well, and let it stand at 25°C for 15 min to obtain 30 mL of transfection complex. Then add 3 mL of the transfection complex to each of 10 15 mm culture dishes inoculated with HEK-293T cells (cell density ≥ 90%), and incubate at 37°C in a 5% (v / v) CO2 incubator for 72 h. After the incubation, collect the culture liquid in each culture dish into a separate 50 mL centrifuge tube, trypsinize the adherent cells at the bottom of each culture dish, discard the trypsin, and blow the adherent cells in each culture dish with a pipette to mix them with the culture liquid in each culture dish. Centrifuge at 800 r / min for 5 min, discard the supernatant, and resuspend the precipitate in 10 mL of high-glucose DMEM containing 10% (v / v) FBS. Then inoculate 10 15 mm culture dishes with the resuspended cells, and incubate at 37°C in a 5% (v / v) CO2 incubator for 48 h. After the incubation, collect the culture liquid in each culture dish into a separate 50 mL centrifuge tube, and use a plasmid extraction kit (OMEGA) to extract the plasmid according to the instructions to obtain 300 μg of pAAV-si-G997 plasmid. The recombinant adeno-associated virus rAAV-G997 was purified and collected according to the instructions of the AAV2 Purification Kit (TAKARA) to obtain the recombinant adeno-associated virus rAAV-G997.
[0121] (4) Virus titer test of the recombinant adeno-associated virus rAAV-G997
[0122] 1 μL of the rAAV-G997 obtained in step (3) and 6 μL of deionized water were mixed, followed by the addition of 1 μL of DNase and 1 μL of RNase. After uniform mixing, the mixture was placed at 37°C for 30 min of digestion. After the digestion was completed, the mixture was denatured at 100°C for 10 min. Then, 1 μL of proteinase K was added, and the mixture was digested at 56°C for 1 h. Subsequently, the mixture was centrifuged at 10,000 r / min for 10 min, and the supernatant was collected as the rAAV-G997 nucleic acid sample.
[0123] The pAAV-EGFP plasmid was used as a standard. The copy number of the pAAV-EGFP plasmid was diluted to 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, and 10 4 copies / μL, respectively, to obtain pAAV-EGFP plasmids with different copy numbers.
[0124] The pAAV-EGFP plasmids with different copy numbers were used as templates, respectively. The AAV titer-EGFP-F nucleotide sequence shown in SEQ ID NO: 29 and the AAV titer-EGFP-R nucleotide sequence shown in SEQ ID NO: 30 were used to perform the fluorescent quantitative PCR amplification according to the fluorescent quantitative PCR amplification system shown in Table 6 to obtain the fluorescent quantitative PCR products of the pAAV-EGFP plasmids with different copy numbers. The Ct values of the fluorescent quantitative PCR products of the pAAV-EGFP plasmids with different copy numbers were detected. The Ct values of the fluorescent quantitative PCR products of the pAAV-EGFP plasmids with different copy numbers were used as the vertical coordinates, and the copy numbers were used as the horizontal coordinates to draw a standard curve graph, and the standard curve equation was calculated.
[0125] Table 6 Fluorescent quantitative PCR amplification system
[0126] Components Volume Template 1 μL AAV titer-EGFP-F (SEQ ID NO: 29, 10 μM) 1 μL AAV titer-EGFP-R (SEQ ID NO: 30, 10 μM) 1 μL 2x PerfectStart Green qPCR SuperMix 10 μL Nuclease-free Water 7 μL Total volume 20 μL
[0127] Amplification program: 94°C, 30 s; 94°C, 5 s, 60°C, 30 s, 40 cycles; 95°C, 10 s; 65-95°C, with a ramping rate of 0.5°C / 0.05 s, melting curve.
[0128] The rAAV-G997 nucleic acid sample is used as the template of the fluorescence quantitative PCR amplification system described in Table 6 to perform fluorescence quantitative PCR amplification, and the fluorescence quantitative PCR amplification product of the rAAV-G997 nucleic acid sample is obtained. The Ct value of the fluorescence quantitative PCR amplification product of the rAAV-G997 nucleic acid sample is detected, and the copy number (vg / mL) of the rAAV-G997 nucleic acid sample is calculated in combination with the standard curve.
[0129] 2. Construction of recombinant adeno-associated virus rAAV-L5055 packaging si- L5055 (siRNA-L)
[0130] The si-G997-F with the nucleotide sequence as shown in SEQ ID NO: 21 and the si-G997-R as shown in SEQ ID NO: 22 in step 1(1) are replaced by the si-L5055-F as shown in SEQ ID NO: 31 and the si-L5055-R as shown in SEQ ID NO: 32, and the pEU6-si-L5055 is prepared according to the method shown in step 1(1).
[0131] The CMV-U6-G997-F with the nucleotide sequence as shown in SEQ ID NO: 25 and the CMV-U6-G997-R as shown in SEQ ID NO: 26 in step 1(2) are replaced by the CMV-U6-L5055-F with the nucleotide sequence as shown in SEQ ID NO: 33 and the CMV-U6-L5055-R as shown in SEQ ID NO: 34, and the pEU6-si-G997 is replaced by the pEU6-si-L5055, and the pAAV-si-L5055 is prepared according to the method shown in step 1(2).
[0132] The pAAV-si-G997 in step 1(3) is replaced by the pAAV-si-L5055, and the recombinant adeno-associated virus rAAV-L5055 is prepared according to the method shown in step 1(3).
[0133] The viral titer of the recombinant adeno-associated virus rAAV-L5055 is obtained according to the method shown in step 1(4).
[0134] 3. Construction of recombinant adeno-associated virus rAAV-NC packaging si-NC (siNC)
[0135] The si-G997-F with the nucleotide sequence as shown in SEQ ID NO: 21 and the si-G997-R as shown in SEQ ID NO: 22 in step 1(1) are replaced by the si-NC-F as shown in SEQ ID NO: 35 and the si-NC-R as shown in SEQ ID NO: 36, and the pEU6-si-NC is prepared according to the method shown in step 1(1).
[0136] The nucleotide sequence of CMV-U6-G997-F as shown in SEQ ID NO: 25 and CMV-U6-G997-R as shown in SEQ ID NO: 26 in step 1(2) were replaced by the nucleotide sequence of CMV-U6-NC-F as shown in SEQ ID NO: 37 and CMV-U6-NC-R as shown in SEQ ID NO: 38, and pEU6-si-G997 was replaced by pEU6-si-NC, to prepare pAAV-si-NC according to the method shown in step 1(2).
[0137] The pAAV-si-G997 in step 1(3) was replaced by pAAV-si-NC, to prepare the recombinant adeno-associated virus rAAV-NC according to the method shown in step 1(3).
[0138] The viral titer of the recombinant adeno-associated virus rAAV-NC was obtained according to the method shown in step 1(4).
[0139] II. Experimental results
[0140] The identification result of the expression plasmid is shown in Figure 4 Fig. 1, lanes 1-5 are the identification results of pEU-si-L5055, lanes 6-10 are the identification results of pEU6-si-G997, and lanes 11-15 are the identification results of pEU6-si-NC.
[0141] The results show that the electrophoresis bands of 666 bp appear in the electrophoresis identification results of the expression plasmids pEU6-si-G997, pEU6-si-5055 and pEU6-si-NC, which are the same as the size of the amplified fragments of the U6 upstream identification primer (SEQ ID NO: 23) and the U6 downstream identification primer (SEQ ID NO: 24), indicating that pEU6-si-G997, pEU6-si-5055 and pEU6-si-NC are successfully constructed.
[0142] The identification result of the packaging plasmid is shown in Figure 5 Fig. 2, lanes 1-8 are the identification results of pAAV-si-G997, lanes 9-16 are the identification results of pAAV-si-L5055, and lanes 17-24 are the identification results of pAAV-si-NC.
[0143] The results show that: the electrophoresis identification results of the packaged plasmids pAAV-si-G997, pAAV-si-L5055 and pAAV-si-NC all appear 934bp electrophoresis bands, which are the same as the size of the amplified fragments of the CMV-U6-siRNA upstream identification primer (SEQ ID NO: 27) and CMV-U6-siRNA (SEQ ID NO: 28), indicating that pAAV-si-G997, pAAV-si-L5055 and pAAV-si-NC are successfully constructed.
[0144] The fluorescence curve of pAAV-EGFP with different copy numbers is shown in Figure 6 The standard curve is shown in Figure 7
[0145] The results show that: the standard curve is shown in formula I;
[0146] Formula I: y = -0.3223x + 11.338; x is the ct value, and the copy number is 10 y copies / μL.
[0147] The results show that: the copy number of the recombinant adeno-associated virus rAAV-G997 is 4.9x10 11 vg / mL, the copy number of the recombinant adeno-associated virus rAAV-L5055 is 2.5x10 11 vg / mL, and the copy number of the recombinant adeno-associated virus rAAV-NC is 4x10 10 vg / mL.
[0148] Example 4 Test of the effect of lentivirus on the replication ability of RABV
[0149] I. Experimental method
[0150] rAAV-G997 recombinant adeno-associated virus infection group: the NA cells were cultured in a 12-well plate until the cell density in each well was 80%-90%, then 500μL / well of serum-free RPMI-1640 medium was added after the liquid in the well plate was discarded, then the rAAV-G997 prepared in Example 3 was added at a MOI of 1000 (100vg / cell), and the plate was placed in a 37℃, 5% (v / v) CO2 incubator for 2h adsorption, then the complete culture medium was replaced, and the culture was continued for 24h, then the liquid was discarded, 500μL of serum-free medium was added, and the CVS-11 strain was inoculated into the culture medium at a MOI of 0.1, and the plate was placed in a 37℃, 5% (v / v) CO2 incubator for 1h adsorption, then the complete culture medium was replaced, and the culture was continued, to obtain the rAAV-G997 recombinant adeno-associated virus infection group of NA cells.
[0151] rAAV-L5055 recombinant adeno-associated virus infection group: rAAV-G997 in the rAAV-L5055 recombinant adeno-associated virus infection group was replaced by rAAV-L5055 prepared in Example 3, and the rest was treated exactly the same, to obtain rAAV-L5055 recombinant adeno-associated virus infection group NA cells.
[0152] rAAV-NC recombinant adeno-associated virus infection group: rAAV-G997 in the rAAV-NC recombinant adeno-associated virus infection group was replaced by rAAV-NC prepared in Example 3, and the rest was treated exactly the same, to obtain rAAV-NC recombinant adeno-associated virus infection group NA cells.
[0153] The cell supernatant in the culture medium of the rAAV-G997 recombinant adeno-associated virus infection group, the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group at 24h, 48h, 72h and 96h after inoculation of the CVS-11 strain was collected respectively, and the virus titer of the cell supernatant at different times after inoculation of the CVS-11 strain was detected according to the "TCID 50 detection" method shown in Step 1 of Example 1.
[0154] The NA cells in the culture medium of the rAAV-G997 recombinant adeno-associated virus infection group, the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group at 24h, 48h, 72h and 96h after inoculation of the CVS-11 strain were collected respectively, and the transcription level of each recombinant adeno-associated virus infection group was detected according to the "fluorescence quantitative PCR detection" method shown in Step 1 of Example 1, including the transcription level of the G gene of the rAAV-G997 recombinant adeno-associated virus infection group, the transcription level of the L gene of the rAAV-L5055 recombinant adeno-associated virus infection group and the transcription level of the G gene and the L gene of the rAAV-NC recombinant adeno-associated virus infection group.
[0155] II. Experimental results
[0156] The virus titer detection results of the cell supernatant at different times after inoculation of the CVS-11 strain and the transcription level detection results of each recombinant adeno-associated virus infection group are shown in Figures 1 and 2 respectively. Figure 8A is the result of G gene transcription level of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; B is the result of L gene transcription level of the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; C is a graph of the virus titer detection result of the cell supernatant of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group at different times after inoculation of the CVS-11 strain; D is a graph of the virus titer detection result of the cell supernatant of the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group at different times after inoculation of the CVS-11 strain.
[0157] The results show that: (1) at each time point after inoculation of the CVS-11 strain, the virus titer in the NA cells of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-L5055 recombinant adeno-associated virus infection group is significantly lower than that in the rAAV-MC recombinant adeno-associated virus infection group;
[0158] (2) the transcription level (mRNA level) of the G gene of the rabies CVS-11 in the NA cells of the rAAC-G997 recombinant adeno-associated virus infection group is significantly lower than that in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group; the transcription level (mRNA level) of the L gene of the rabies CVS-11 in the NA cells of the rAAC-L5055 recombinant adeno-associated virus infection group is significantly lower than that in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group.
[0159] It is shown that the recombinant adeno-associated virus rAAV-G997 and the recombinant adeno-associated virus rAAV-L5055 can significantly inhibit the replication of the rabies virus and reduce the virus titer;
[0160] The NA cells of the rAAV-G997 recombinant adeno-associated virus infection group are not infected by the rabies virus or the replication of the rabies virus in the cells is significantly inhibited; the NA cells of the rAAV-G997 recombinant adeno-associated virus infection group are not infected by the rabies virus or the replication of the rabies virus in the cells is significantly inhibited.
[0161] Example 5 Test of the protection of the recombinant adeno-associated virus on the mice infected with RABV
[0162] I. Experimental method
[0163] 30 SPF Kunming mice with a weight of 20 g were randomly divided into rAAV-G997 group, rAAV-L5055 group and rAAV-NC group, 10 mice per group; and a control group containing 10 SPF Kunming mice with a weight of 20 g was set.
[0164] rAAV-G997 group: the recombinant adeno-associated virus rAAV-G997 prepared in Example 3 was injected into the SPF Kunming mice at a dose of 2 x 10 11 vg / kg through intracranial injection, and 48 h after the injection, the SPF Kunming mice were infected with the rabies virus CVS-11 strain through muscle injection at a MOI of 0.1.
[0165] rAAV-L5055 group: the recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with the rAAV-L5055 prepared in Example 3, and the rest of the treatment was the same.
[0166] rAAV-NC group: the recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with the rAAV-NC prepared in Example 3, and the rest of the treatment was the same.
[0167] Control group: the SPF Kunming mice were infected with the rabies virus CVS-11 strain through muscle injection at a MOI of 0.1.
[0168] After the SPF Kunming mice in each group were infected, the average body weight and the number of deaths of the mice in each group were recorded every day, and the recording was continued for 21 days, and the body weight change rate and the survival rate of the mice in each group were calculated.
[0169] II. Experimental results
[0170] The body weight change rate chart of the mice in each group 21 days after infection is shown in Figure 9 The results show that the onset time of the SPF Kunming mice in the rAAV-G997 group was the 9th day after infection, the onset time of the SPF Kunming mice in the rAAV-L5055 group was the 9th day after infection, and the onset time of the SPF Kunming mice in the rAAV-NC group was the 8th day after infection.
[0171] The body weight of the SPF Kunming mice in the rAAV-G997 group and the rAAV-L5055 group steadily increased with time, and there was no sharp fluctuation; the body weight of the SPF Kunming mice in the rAAV-NC group and the control group fluctuated significantly within 21 days, and the body weight of the mice was significantly lower than that of the SPF Kunming mice in the rAAV-G997 group and the rAAV-L5055 group.
[0172] The results show that the body weight of the mice infected with the recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and the recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L) can steadily increase after the mice are infected with the rabies virus CVS-11 strain, and the body weight of the mice does not fluctuate sharply.
[0173] The survival rate of the mice in each group after the mice are infected for 21 days is shown in the graph of FIG. 6. Figure 10 The results show that the survival rate of the mice in the rAAV-G997 group is 90%, the survival rate of the mice in the rAAV-L5055 group is 90%, the survival rate of the mice in the rAAV-NC group is 50%, and the survival rate of the mice in the control group is 60% after the mice are infected for 21 days.
[0174] The results show that the recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and the recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L) can protect the mice from the rabies virus CVS-11 strain.
[0175] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not intended to limit the scope of protection of the present application. For those skilled in the art, on the basis of the above description and ideas, other different forms of changes or modifications can also be made, and it is not necessary or possible to exhaust all the embodiments. Any modification, equivalent replacement and improvement made within the spirit and principles of the present application shall be included in the scope of protection of the claims of the present application.
Claims
1. An siRNA-L targeting and inhibiting L gene of rabies virus, characterized in that, The nucleotide sequence of the sense strand of the siRNA-L is shown as SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is shown as SEQ ID NO:
4.
2. Use of the siRNA-L of claim 1 in the preparation of a drug for inhibiting rabies.
3. Use according to claim 2, characterized in that, The rabies virus is rabies CVS-11 strain.
4. Use according to claim 2, characterized in that, The inhibition of rabies is the inhibition of the expression of L gene.
5. A pharmaceutical composition for inhibiting rabies, characterized by comprising the compound of claim 1 or 2 as an active ingredient. The siRNA-L shown in claim 1 is contained.
6. The pharmaceutical composition of claim 5, wherein, A pharmaceutically acceptable adjuvant is further included.
7. The pharmaceutical composition of claim 6, wherein, The drug composition is administered intracranially, by intramuscular injection and / or intravenous injection.
Citation Information
Patent Citations
Rabies virus vector systems and compositions and methods thereof
CN101287838A
Construction of recombinant rabies virus of double-expression G gene and biological property analysis thereof
CN101768575A