Neotrichinella albifloccum ETG-1-2-1 as well as culture method and application thereof as endophytic fungus of vietnamese sophora root

Abstract

The invention discloses a vietnamese sophora root endophytic fungus neochaetomium albiflocum ETG-1-2-1 as well as a culture method and application of the vietnamese sophora root endophytic fungus neochaetomium albiflocum ETG-1-2-1, the vietnamese sophora root endophytic fungus neochaetomium albiflocum ETG-1-2-1 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is April 27, 2025, and the preservation number is CGMCC NO: 41962. The invention further discloses a culture method and application of the vietnamese sophora root endophytic fungus neochaetomium albiflocum ETG-1-2-1. The endophytic fungus Neocrinipellis albiflocium ETG-1-2-1 of vietnamese sophora root is a new genus of marasmiae, can efficiently secrete extracellular enzymes such as cellulase, protease and lipase, and can generate secondary metabolites (such as flavonoids, alkaloids and the like) with antibacterial and antioxidant activity, and the endophytic fungus Neocrinipellis albiflocium ETG-1-2-1 of vietnamese sophora root is a new genus of marasmiae. The method can be applied to food, medicine or agriculture fields; and the method has the characteristics of simple culture conditions, high product activity, environmental friendliness and the like, and has a good industrialization prospect.

Description

Technical Field

[0001] The invention relates to an endophytic fungus from Sophora flavescens, Neocrinipsis albifloccum ETG-1-2-1, a culture method and application thereof, and belongs to the technical field of microorganisms. Background Art

[0002] Existing enzyme-producing microorganisms are mostly derived from soil or decaying plants, while endophytic fungi are underdeveloped. Amylases, cellulases, and proteases are primarily derived from industrial strains (such as Trichoderma and Bacillus), but these suffer from low enzyme activity and high production costs. Plant endophytic fungi, due to their specialized ecological niches, often produce unique metabolites, but the multifunctionality of endophytic fungi derived from the roots of Sophora flavescens has not been reported. Summary of the Invention

[0003] The invention provides an endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from the roots of Sophora flavescens, a culture method and an application thereof. The endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from the roots of Sophora flavescens has the ability to produce highly active extracellular amylase, cellulase, protease, alkaloids and flavonoids.

[0004] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0005] An endophytic fungus from the roots of Sophora flavescens was deposited in the General Microbiology Center of the China General Culture Collection (CGMCC) on April 27, 2025, with the deposit number CGMCC No. 41962. It was named Neocrinipopellis albifloccum ETG-1-2-1. The depository address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The above-mentioned endophytic fungus Neocriniplis albifloccum ETG-1-2-1 has the characteristics of rapid growth and production of highly active extracellular enzymes.

[0007] The fungus was isolated from the root tissue of Euchresta tubulosa and is a new genus of the family Corymboses. The strain was cultured on PDA medium at 28°C for 4 days, and the colony diameter was ≥4 cm. The fungus has the ability to produce highly active extracellular amylase, cellulase, protease, as well as alkaloids and flavonoids.

[0008] ITS sequence analysis (GenBank accession number PP702993) revealed that the endophytic fungus Neocriniplis albifloccum ETG-1-2-1 shared only 85% homology with Crinipellis wandoensis of the Crinipelliaceae family, leading to its taxonomic identification as a new genus of the Crinipelliaceae family. The sequencing results were as follows: 614 bp.

[0009] The culture method of the endophytic fungus Neocriniplis albifloccum ETG-1-2-1 is as follows: the culture medium is PDA or PDB culture medium; the culture conditions are: temperature 25-30°C, pH 5.0-7.0, shaker speed 100-150 rpm, and culture time 7-28 days.

[0010] The endophytic fungus Neocriniplis albifloccum ETG-1-2-1 can be used to produce highly active extracellular amylase, extracellular protease, and extracellular cellulase. The extracellular amylase activity is ≥15 U / mL (measured using soluble starch as a substrate, pH 7.0, and 37°C); the extracellular cellulase activity is ≥13.36 U / mL (measured using CMC-Na as a substrate, pH 7.0, and 37°C); and the extracellular protease activity is ≥1.26 U / mL (measured using skim milk powder as a substrate, pH 7.5, and 40°C).

[0011] Enzyme production conditions: PDB medium, temperature 25-30°C, pH 5.0-7.0.

[0012] The endophytic fungus Neocriniplis albifloccum ETG-1-2-1 is used in the food industry for starch hydrolysis, cellulose degradation, or protein hydrolysis, and in agriculture as a feed additive or organic fertilizer fermentation agent.

[0013] The endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 can be used to produce alkaloids, flavonoids, tetracyclines, stilbenes, terpenes, and steroidal compounds. Alkaloids include oxymatrine, trigonelline, norarecoline, pilocarpine, piperine, and gelsinine; flavonoids include hesperetin, daidzein, glycitein, isorhamnetin, 3-methoxyflavone, naringenin, formononetin, and troxerutin; tetracyclines include chlortetracycline and minocycline; stilbenes include isodanthein; terpenes include (-)-oxyaromatic styrene, ethyl chrysanthemate, perillic acid, and carvone; and steroids include corticosterone, 11β-hydroxyglucosidone, and deoxycorticone.

[0014] The above-mentioned endophytic fungus Neocriniplis albifloccum ETG-1-2-1 is used in the medical field for antibacterial, anti-inflammatory or antioxidant purposes, or for preparing antibacterial, anti-inflammatory or antioxidant drugs (based on its alkaloid and flavonoid components).

[0015] The preparation containing the endophytic fungus Neocriniplis albifloccum ETG-1-2-1 is in the form of freeze-dried fungus powder or liquid fermentation agent.

[0016] The endophytic fungus Neocriniplis albifloccum ETG-1-2-1 of the present application has a regular circular colony with circumferential divergent growth. The colony is white and circular from the center to the periphery, with sparse white hyphae on the growth surface and a fast growth rate (diameter ≥8 cm after 8 days of constant temperature culture at 28°C).

[0017] The “%” in this application, unless otherwise specified, refers to mass percentage.

[0018] The technologies not mentioned in this invention are all referred to the prior art.

[0019] The endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from the roots of Sophora flavescens is a new genus of the family Apiaceae. It can efficiently secrete extracellular enzymes such as cellulase, protease and lipase, and produce secondary metabolites (such as flavonoids and alkaloids) with antibacterial and antioxidant activities. It can be applied to fields such as food, medicine or agriculture. In the food industry, it can replace traditional chemical methods for starch hydrolysis, starch saccharification and juice clarification, and is more environmentally friendly and efficient. In the medical field, it can be used to develop anticancer or antioxidant drugs of natural origin. The strain has the characteristics of simple culture conditions, high product activity, and environmental friendliness, and has good industrialization prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Colony morphology (a), reverse (b) and microscopic structure (c) of strain ETG-1-2-1, magnification 400 times;

[0021] Figure 2 : A phylogenetic tree of the endophytic fungus Neocrinipalbifloccum ETG-1-2-1 from the roots of Sophora flavescens was constructed based on ITS-PCR sequences (the numbers at the branches are bootstrap values, indicating the reliability; the distance scale indicates the sequence divergence; the branch length indicates the genetic distance of the clade; the letters and numbers after the strain names are the accession numbers of each strain in Genbank);

[0022] Figure 3 :The growth of endophytic fungus ETG-1-2-1 and the changes of enzyme activity area;

[0023] Figure 4 The extracellular amylase (a), cellulase (b), and protease (c) activities were determined by the clearing zone method;

[0024] Figure 5 Curves of enzyme activities of amylase (a), cellulase (b) and protease (c) changing with time;

[0025] Figure 6 Figure 2 Antioxidant activity of ETG-1-2-1. DETAILED DESCRIPTION

[0026] In order to better understand the present invention, the content of the present invention is further illustrated below in conjunction with the examples, but the content of the present invention is not limited to the following examples.

[0027] Example 1: Strain isolation and identification

[0028] The roots of Sophora flavescens were collected from Tianping Mountain, Bada Gongshan National Nature Reserve, Zhangjiajie City, Hunan Province (collection time: July 2023). The endophytic fungus Neocriniplis albifloccum ETG-1-2-1 from the roots of Sophora flavescens was isolated by conventional tissue separation method. The specific operation was as follows: the roots of the collected Sophora flavescens were rinsed under tap water (to remove dust and impurities on the surface), the surface moisture was absorbed with sterile filter paper, and the roots were placed on a clean bench and disinfected with 75% ethanol for 1 min, 2.5% sodium hypochlorite for 3 min, 75% ethanol for 30 s, and rinsed with sterile water. After disinfection, blot the surface of the material dry with sterile filter paper. Use sterilized scissors to cut the treated sample into approximately 0.5 cm x 0.5 cm tissue blocks. After air drying, randomly select six tissue blocks from each of the three locations, grouping three blocks together. Place the cross-sections of the cuttings firmly against PDA plates (pH 5.6 ± 0.2) containing 150 mg / L each of penicillin G and kanamycin. Incubate the plates upside down at 28°C for 7 days. Observe and record bacterial growth around the tissue blocks. The presence of hyphae around the tissue blocks is important for verifying disinfection effectiveness: apply the sterile water used in the final rinse to the PDA plate and incubate the plate at 28°C for 7 days. If no bacterial colonies develop, the surface disinfection is deemed satisfactory and the isolated strain originates from the interior of the Sophora flavescens root.

[0029] Newly grown hyphae from the tissue block incision were purified on fresh PDA medium. Based on differences in colony morphology, color, and growth time, hyphae from the edge of each colony were transferred to PDA (pH 5.6±0.2) plates containing 150 mg / L penicillin G and kanamycin for re-cultivation. After three purifications, isolated endophytic fungi were pooled, numbered, and their growth characteristics recorded. The endophytic fungus Neocriniplis albifloccum (ETG-1-2-1) was isolated from a root tissue block of Sophora flavescens. After 7 days of culture, the strain was numbered (ETG-1-2-1) and transferred to PDA slants and plates. Cultured in a 28°C incubator for 7 days, the slant-cultured strains were stored in a 4°C refrigerator, and the plate-cultured strains were used for colony morphology observation and ITS rDNA sequence analysis.

[0030] Colony morphology observation: Observe and record the size, color, texture, surface patterns, edge shape, presence of exudate, and odor of the plate-cultured strain. ETG-1-2-1 colonies are regular circles with circumferentially divergent growth. The colonies are white and circular from the center to the periphery, with sparse white hyphae on the growth surface. They grow rapidly (diameter ≥ 8 cm after 8 days of constant temperature culture at 28°C).

[0031] Morphological identification of hyphae and spores: Endophytic fungal strains stored on PDA slant culture were streaked twice onto PDA plates for activation, then inoculated onto PDA plates and incubated at 28°C for 7 days. The microscopic morphology of hyphae and spores was observed using the sticky-slip method. A drop of lactic acid carbolic acid cotton blue stain (10 g of carbolic acid, 10 mL of lactic acid, 20 mL of glycerol, 0.02 g of cotton blue, and 10 mL of distilled water) was placed on a clean glass slide. A piece of clean transparent adhesive tape (approximately 1 × 1.5 cm) was cut and, using tweezers, gently grasped the edge of the colony with the sticky surface. The hyphae were then placed, sticky-side down, onto the glass slide with the stain. A drop of lactic acid carbolic acid cotton blue stain was then placed on the tape and covered with a coverslip. The morphology of hyphae, conidia, and spores was observed under a biological microscope (PX43 FS6). Microscopic observation of the hyphae morphology of ETG-1-2-1 revealed that the hyphae had obvious intervals, abundant branches, and interlaced growth, and microconidia grew laterally on the hyphae.

[0032] After observing the colony morphology of the plate culture strains, they were sent to Chengdu Luoning Biological Co., Ltd. for ITS rDNA (Internal transcribed spacer region) sequence analysis. The strains were identified based on the morphological characteristics of the fungi and molecular biology methods (NCBI-BLAST sequence alignment), and a phylogenetic tree was constructed.

[0033] The single bacterial plate was sent with an ice pack. The assay steps were as follows: (1) DNA of endophytic fungi from Sophora flavescens was extracted according to the instructions of the Tianmo Biotechnology Fungal Genome Extraction Kit; (2) universal primers ITS1 / ITS4 were selected for PCR amplification (ITS1: 5'-GGTCATTTAGAGGAAGTAA-3'; ITS4: 5'-AGCCTSCSCTTANTDATATGC-3'; PCR amplification system (50 μL): DNA template 2 μL, Forward Primer 2.5 μL, Reverse Primer 2.5 μL, 2X PCR Bestaq MasterMix 25 μL H2O 18 μL. PCR reaction conditions: 95°C pre-denaturation for 5 min, 94°C denaturation for 45 s, 50°C annealing for 30 s, 72°C 45 s, for a total of 30 cycles, 72°C extension for 1 min, and termination at 4°C. (3) PCR product detection and purification; (3) Sequencing: The recovered PCR product was sequenced using ABI3730XL. The sequencing results were compared with the relevant strain sequences in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) by BLAST. The sequence is as follows (614 bp):

[0034] GGGGTAACGATCAACAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCCAAA

[0035] GCCTTCACGGGCGGCGGTTGACTACGTCTACCTCACACCTTAAAGTATGTTAACGAA

[0036] TGTAATCATGGTCTTGACAGACCCTAAAAAGTTAATACAACTTTCGACAACGGATCT

[0037] CTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA

[0038] GAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGG

[0039] GGCATGCCTGTTTGAGTGTCATTAAATACCATCAACCCTCTTTTGACTTCGGTCTCGA

[0040] GAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTTAAAT

[0041] GTATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATAATTTCTACGTCGTT

[0042] GACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCT

[0043] TGACTGAGACTAGCGACTTGTGCGCTAACTTTTGACTTGACCTCAAATCAGGTAGGA

[0044] CTACCCGCTGAACTTAAGCATATCAAAAGCGGGAGAAGGAAA

[0045] The strains with the highest similarity were used to identify the species of each endophytic fungus strain. The strains were then submitted online to the GenBank database to obtain accession numbers. The phylogenetic tree (accession number PP702993) showed the highest homology to Crinipellis wandoensis, a genus in the Marasmiaceae family, with only 85% homology. The strains were then taxonomically identified as a new genus within the Marasmiaceae family and named Neocrinipellis albifloccum ETG-1-2-1.

[0046] Example 2: Extracellular enzyme activity experiment

[0047] (1) Evaluation of extracellular enzyme activity of endophytic fungi by clear zone method

[0048] Preparation of solid culture media (solid) with different substrates: ① Inorganic salt starch agar medium: Measure 200 g of purified water, heat and boil, weigh 10 g of soluble starch, slowly add it to it, and stir continuously until completely dissolved to obtain a starch solution; weigh 1 g of dipotassium hydrogen phosphate, 1 g of magnesium sulfate heptahydrate, 2 g of ammonium sulfate, 2 g of calcium carbonate, 1 mg of ferrous sulfate, 1 mg of manganese chloride, 1 mg of zinc sulfate, 1 g of sodium chloride, and 20 g of agar, add 800 g of purified water, heat and stir continuously until completely dissolved to obtain an inorganic salt agar solution; combine the starch solution and the inorganic salt agar solution, add purified water, dilute to 1 L, and stir evenly. ② Sodium Carboxymethyl Cellulose Agar Medium: Measure 500g of purified water, bring to a boil, then weigh 20g of sodium carboxymethyl cellulose and add it, stirring continuously until completely dissolved to obtain a sodium carboxymethyl cellulose solution. Weigh 0.5g of magnesium sulfate, 1g of potassium dihydrogen phosphate, 0.5g of sodium chloride, and 20g of agar into 500g of purified water, heat and stir continuously until completely dissolved to obtain an inorganic salt agar solution. Combine the sodium carboxymethyl cellulose solution and the inorganic salt agar solution, add purified water, and adjust the volume to 1L. Stir thoroughly. ③ Skim Milk Powder Agar Medium: Prepare Solution A and Solution B separately. Solution A: Weigh 3g of skim milk powder and add 100mL of water, stirring thoroughly. Solution B: Add 0.5g of sodium chloride and 2g of agar to 100mL of water, heating and stirring until completely dissolved. Sterilize Solution A and Solution B separately and mix thoroughly under aseptic conditions.

[0049] Endophytic fungal strains from refrigerated PDA plate culture medium were inoculated with 7 mm diameter pieces from the edge of the new PDA plate culture medium and cultured at 28°C for 7 days. A 7 mm piece of bacterial cake was then inoculated from the edge of the new colony into the center of the different substrate solid culture media prepared above and cultured at 28°C for 7 days. The clear zone formed on the skim milk powder agar medium and the diameter of the fungal colony were measured. Inorganic salt starch agar medium was stained with 1% dilute iodine solution. The starch turned blue when exposed to iodine. The formation of clear zones was observed and the diameters of the clear zones and fungal colonies were measured. Sodium carboxymethyl cellulose (CMC-Na) agar medium was stained with Congo red reagent for 15 minutes and then decolorized with 0.1 mol / L sodium chloride solution for 15 minutes. The formation of light yellow clear zones was observed, the clear zones and the diameters of the fungal colonies were measured, and the enzyme activity zone (ZA) was calculated to evaluate the enzyme production of endophytic fungi.

[0050] The enzyme activity zone (ZA) was used to evaluate the enzyme production of endophytic fungi. The specific criteria are: ZA between 0.9 and 1 is weak; ZA between 0.89 and 0.80 is relatively weak; ZA between 0.79 and 0.70 is relatively strong; and ZA less than 0.69 is strong. According to this system, the lower the ZA value, the higher the enzyme activity.

[0051] The calculation formula is as follows:

[0052]

[0053] The strain ETG-1-2-1 was inoculated into inorganic salt starch agar medium, sodium carboxymethyl cellulose agar medium or skimmed milk powder agar medium and cultured for 7 days. The colony diameter and transparent zone diameter were measured every day and the enzyme activity zone (ZA value) was calculated. The measurement results were as follows: Figure 3 ,Depend on Figure 3 As can be seen, the colonies and clear zones gradually increased in size, indicating a rapid growth rate. The ZA values ​​for extracellular amylase were less than 0.69 for the first three days, indicating strong enzyme activity. CMCase reached its optimal ZA value of 0.599 on the third day. Protease had ZA values ​​less than 0.60 after the second day, indicating strong enzyme activity.

[0054] (2) Liquid culture method to evaluate the extracellular enzyme activity of endophytic fungi

[0055] Using a 7mm hole puncher, take the edge of the activated colony cake (the activation process is: take the endophytic fungal strain of the refrigerated PDA plate medium, take a 7mm diameter piece from the edge and inoculate it into a new PDA plate medium, and culture it at a constant temperature of 28℃ for 7 days), and inoculate it into 125mL inorganic salt starch liquid medium, skim milk powder liquid medium, and sodium carboxymethyl cellulose liquid medium respectively. The formula is the same as the corresponding solid culture medium in (1), except that agar is not added. Five bacterial cakes are inoculated into each bottle of culture medium. After culture at 28℃ and 120r / min for 2, 3, 4, 5, and 6 days, the cakes are taken out and centrifuged at 4℃ and 10000r / min for 25 minutes. The supernatant obtained is the crude enzyme liquid. The crude enzyme liquid obtained from the skim milk powder liquid medium is tested for extracellular protease activity, the crude enzyme liquid obtained from the inorganic salt starch liquid medium is tested for extracellular amylase activity, and the crude enzyme liquid obtained from the sodium carboxymethyl cellulose liquid medium is tested for carboxymethyl cellulose (CMC) enzyme activity.

[0056] The results of enzyme activity determination were as follows Figure 5 ,Depend on Figure 5 It can be seen that the extracellular amylase (DNS method) had the highest enzyme activity on the fourth day, reaching 16.1U / mL (measured at pH 7.0, 37℃); the extracellular cellulase (DNS method) had the highest enzyme activity on the third day, reaching 13.36U / mL (measured at pH 7.0, 37℃); the extracellular protease (Folin-phenol method) had the highest protease activity on the second day, reaching 1.26U / mL (measured at pH 7.5, 40℃).

[0057] Example 3: Experiment on the production of bioactive ingredients by fermentation

[0058] The strain, stored refrigerated on PDA slant medium, was inoculated onto PDA plates and cultured at 28°C for 7 days. 0.5 cm × 0.5 cm pieces of bacteria were cut from the edge of the colony and inoculated into 200 mL of PDB medium. The culture was incubated in a vertical shaking incubator at 28°C, 120 rpm, and protected from light for 15 days. The fermentation broth was filtered under reduced pressure and extracted three times with an equal volume of ethyl acetate. The resulting ethyl acetate extracts were combined and concentrated under reduced pressure on a rotary evaporator to obtain the ethyl acetate fraction of the fermentation product. This sample was analyzed by high-performance liquid chromatography-mass spectrometry (LC-MS / MS). The main active ingredients are listed in Table 1.

[0059] Table 1 Detection of some active ingredients in endophytic fungi by LC-MS

[0060]

[0061] Alkaloids are the main medicinal ingredients in Sophora flavescens plants, among which ETG-1-2-1 produces oxymatrine, trigonelline, etc. In addition, flavonoids such as hesperetin and naringenin were also detected.

[0062] Example 4: Study on the activity of fermentation products

[0063] The fermentation product preparation method is as in Example 3

[0064] Antibacterial activity study

[0065] 1) Preparation of bacterial liquid: Inoculate E. coli and Staphylococcus aureus into beef extract peptone liquid medium → incubate at 37°C for 24 hours → take 0.1 mL and incubate on beef extract peptone agar plate for 12 hours, wash and set aside. Inoculate Candida albicans into PDB liquid medium → incubate at 28°C for 24 hours → take 0.1 mL and incubate on PDA medium for 12 hours, following the same procedure as above. Use a UV-visible spectrophotometer to measure the OD values ​​of the three E. coli, Staphylococcus aureus, and Candida albicans at 600nm, i.e. OD 600 , select the appropriate dilution ratio, i.e. OD 600 The measured value is about 0.1 and the number of colonies is about 1.0×10 6 cfu / mL, which is the test bacterial solution.

[0066] 2) Determination of antibacterial activity: Add 100 μL of beef extract peptone broth to each well of a 96-well cell culture plate. Add 200 μL of the fermentation product diluted to 20 mg / mL to the first well, mix thoroughly, and dilute the mixture in a 1:1 ratio to the tenth column. Discard any excess liquid, then add the test bacteria, the working bacteria to the eleventh column, and the liquid culture medium to the twelfth column. Perform three parallel controls for each fermentation product. Incubate the plates in a 37°C incubator for 24 hours. Measure the OD at 600 nm. The minimum inhibitory concentration (MIC) of the fermentation product is the critical value at which the absorbance does not increase.

[0067] The results showed that the minimum inhibitory concentrations of the ethyl acetate extract of ETG-1-2-1 against Escherichia coli, Staphylococcus aureus and Candida albicans were 2.5 mg / mL, 2.5 mg / mL and 1.25 mg / mL, respectively, showing a strong antibacterial effect.

[0068] Antioxidant research

[0069] 1) Ability to scavenge hydroxyl free radicals

[0070] Prepare solutions of Vc and fermentation products at different concentrations → Take 2 mL of extract, 6 mmol / L ferrous sulfate, and hydrogen peroxide in test tubes → Add 6 mmol / L salicylic acid to the first group and measure the absorbance at 510 nm, A2 → Do not add salicylic acid to the second group and measure A3. Replace the fermentation product solution with ethanol in the third group and measure A1. Each sample was measured in parallel three times. The -OH radical scavenging rate calculation formula (2) is:

[0071]

[0072] Wherein: A1 is the absorbance value of the solution without fermentation product; A2 is the absorbance value of the solution with fermentation product added; A3 is the absorbance value without salicylic acid.

[0073] 2) Clear ABTS capabilities

[0074] Prepare ABTS solution and K2S2O8 solution in a 1:1 ratio. Incubate in the dark for 16 hours to prepare ABTS working solution. Take 100 μL of sample solution and add 100 μL of ABTS working solution. Measure the optical density at 734 nm (OD1). Replace the ABTS working solution (OD2) with anhydrous ethanol and measure the optical density of the sample or vitamin C solution (OD0). Perform three replicates. Calculation formula (3) is:

[0075]

[0076] See the results Figure 6 ,Depend on Figure 6 It can be seen that the present invention has a significant ability to scavenge hydroxyl radicals and ABTS.

Claims

1. An endophytic fungus from Sophora flavescens, Neocriniplis albifloccum ETG-1-2-1, characterized by: It was deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit date being April 27, 2025, and the deposit number being CGMCC NO:41962.

2. The endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1, characterized in that: Its rDNA-ITS nucleotide sequence is: .

3. A method for culturing the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 of Sophora flavescens according to claim 1 or 2, characterized in that: The culture medium is PDA or PDB medium; the culture conditions are: temperature 25-30°C, pH 5.0-7.0, shaking speed 100-150 rpm, and culture time 7-28 days.

4. A use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1 or 2, characterized in that: Used to produce extracellular amylase, extracellular protease and extracellular cellulase.

5. The use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 4, characterized in that: Extracellular amylase activity ≥15U / mL; extracellular cellulase activity ≥13.36U / mL; extracellular protease activity ≥1.26U / mL.

6. A use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1 or 2, characterized in that: Used for starch hydrolysis, cellulose degradation or protein hydrolysis.

7. A use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1 or 2, characterized in that: As feed additive or organic fertilizer fermentation agent.

8. A use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1 or 2, characterized in that: Used to produce alkaloids, flavonoids, tetracyclines, stilbenes, terpenes and steroids.

9. The use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 8, characterized in that: Alkaloids include oxymatrine, trigonelline, norarecoline, pilocarpine, piperine, and gelsinine; flavonoids include hesperetin, daidzein, glycitein, isorhamnetin, 3-methoxyflavone, naringenin, formononetin, and troxerutin; tetracyclines include chlortetracycline and minocycline; stilbenes include isodanthein; terpenes include (-)-oxyaromatic styrene, ethyl chrysanthemate, perillic acid, and carvone; and steroids include corticosterone, 11β-hydroxysaccharide ketone, and deoxycorticone.

10. A use of the endophytic fungus Neocrinipsis albifloccum ETG-1-2-1 from Sophora flavescens according to claim 1 or 2, characterized in that: Used for antibacterial, anti-inflammatory or antioxidant purposes, or for preparing antibacterial, anti-inflammatory or antioxidant drugs.

Images