Saccharomyces cerevisiae strain, screening method and application thereof
Through hybrid breeding, the brewer's yeast strains AMCC 31585 and AMCC 31580 were selected, which solved the problem of insufficient fermentation activity of brewer's yeast in sugar-free or low-sugar and high-concentration organic acid environments, achieving efficient fermentation and cost savings.
Patent Information
- Application Number
- CN202411329582.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-21
- Filing Date
- 2024-09-23
- Publication Date
- 2025-09-23
AI Technical Summary
The existing technology lacks a Saccharomyces cerevisiae strain that is tolerant to sugar and organic acids and their salts, and is unable to maintain good fermentation activity in a sugar-free or low-sugar environment, affecting the shelf life and production efficiency of baked products.
Through hybrid breeding methods, brewer's yeast strains AMCC 31585 and AMCC 31580 were screened out, which have excellent sugar tolerance and organic acid salt tolerance. Specifically, hybrid strains were obtained through self-pollination and growth curve analysis, shake flask fermentation and fermentation tank culture were performed to screen out yeast strains with high fermentation activity.
In a sugar-free or low-sugar and high-concentration organic acid environment, the cerevisiae strains AMCC 31585 and AMCC 31580 maintain high fermentation activity, improving the production efficiency and shelf life of baked products and reducing production costs.
Smart Images

Figure BDA0005057326660000071 
Figure BDA0005057326660000081 
Figure BDA0005057326660000091
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial screening and food fermentation technology, and in particular to a brewer's yeast strain, a screening method and applications thereof. Background Art
[0002] Brewer's yeast (Saccharomyces cerevisiae) is widely used in bread production as an excellent microbial fermentation agent and leavening agent. Because it is rich in amino acids, vitamins, and trace elements, it is also a biological nutrient that can increase the nutritional value of food. Fermented staple foods occupy a very important position in the Chinese diet, and brewer's yeast is widely used in the fermentation of pasta products, generally in sugar-free or low-sugar dough systems. Brewer's yeast strains with excellent fermentation properties can not only quickly rise the dough, improving production efficiency, but also reduce the amount of yeast added per unit mass of flour, saving production costs. In addition, in actual application scenarios, industrial users often add organic acids and their salts to bakery products to extend the shelf life. Calcium propionate is the most common organic acid salt. However, the addition of organic acids and their salts will undoubtedly affect the fermentation activity of yeast.
[0003] It can be seen that in order to meet the actual application scenarios and preservation needs of baked products, it is of great practical significance to develop brewer's yeast strains with excellent sugar tolerance, organic acid and salt resistance. Summary of the Invention
[0004] The problem existing in the existing technology is that the existing technology lacks strains that have excellent tolerance to the conditions of no sugar or different concentrations of low sugar, and the addition of higher concentrations of organic acids and their salts under different concentrations of low sugar.
[0005] To address the above problems, the present invention obtains two strains of Saccharomyces cerevisiae through hybrid breeding. The strains have excellent activity in the absence of sugar or in low sugar at different concentrations, as well as in the presence of higher concentrations of organic acids and their salts, and are widely applicable. Specifically, the present invention proposes the following technical solutions:
[0006] In a first aspect, the present invention provides a Saccharomyces cerevisiae strain, characterized in that the strain is Saccharomyces cerevisiae AMCC 31580 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231791.
[0007] In a second aspect, the present invention provides a Saccharomyces cerevisiae strain, characterized in that the strain is Saccharomyces cerevisiae AMCC 31585 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231792.
[0008] Preferably, the Saccharomyces cerevisiae strain is characterized in that the strain has low sugar tolerance, and / or organic acid tolerance, and / or organic acid salt tolerance;
[0009] Preferably, the organic acid comprises one or both of propionic acid and acetic acid;
[0010] Further preferably, the organic acid salt comprises one or a combination of two or more of calcium propionate, sodium propionate and sodium acetate;
[0011] More preferably, the organic acid salt comprises calcium propionate.
[0012] Preferably, the Saccharomyces cerevisiae strain is characterized in that the strain is obtained by self-pollination of sexual spores of a parent strain, and the parent strain is Saccharomyces cerevisiae AMCC 30537 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231790.
[0013] Preferably, the Saccharomyces cerevisiae strain is characterized in that the dry weight of the yeast milk of the Saccharomyces cerevisiae strain is 90-110%, preferably 95-110%, of the dry weight of the yeast milk of the parent strain.
[0014] Preferably, the brewer's yeast strain is characterized in that the fermentation activity of the yeast milk of the brewer's yeast strain in a dough system containing 0-15% sugar reaches 90-120%, preferably 95-120%, of the yeast milk of the parent strain.
[0015] Preferably, the Saccharomyces cerevisiae strain is characterized in that the fermentation activity of the active dry yeast of the Saccharomyces cerevisiae strain in a dough system containing 0-15% sugar reaches 95-120%, preferably 105-120% of the active dry yeast of the parent strain; and / or
[0016] The fermentation activity of the active dry yeast of the brewer's yeast strain in a dough system containing 0-15% sugar and 0.6-1% calcium propionate reaches 95-120%, preferably 105-120%, of the active dry yeast of the parent strain.
[0017] Preferably, the Saccharomyces cerevisiae strain is characterized in that the gene sequence of 26S rDNA of the Saccharomyces cerevisiae AMCC 30537 strain is shown as SEQ ID NO.1.
[0018] In a third aspect, the present invention provides a method for screening and obtaining Saccharomyces cerevisiae, the method comprising: forming sexual spores from a parent Saccharomyces cerevisiae and selfing a single spore of the same parent to obtain a hybrid strain, wherein the hybrid strain has:
[0019] The dry weight of the yeast milk of the hybrid bacteria is 90-110% of the dry weight of the yeast milk of the parent Saccharomyces cerevisiae;
[0020] The fermentation activity of the hybrid yeast milk reaches 90-120% of that of the parent yeast milk of brewer's yeast in a dough system containing 0-15% sugar.
[0021] Preferably, the method, wherein the hybrid bacteria has:
[0022] The dry weight of the yeast milk of the hybrid bacteria is 95-110% of the dry weight of the yeast milk of the parent Saccharomyces cerevisiae;
[0023] Preferably, the fermentation activity of the hybrid yeast milk in a dough system containing 0-15% sugar reaches 95-120% of that of the parent Saccharomyces cerevisiae yeast milk.
[0024] Preferably, the method, wherein the hybrid bacteria has:
[0025] The fermentation activity of the active dry yeast of the hybrid bacteria in a dough system containing 0-15% sugar reaches 95-120%, preferably 105-120% of the active dry yeast of the parent Saccharomyces cerevisiae; and / or
[0026] The fermentation activity of the active dry yeast of the hybrid bacteria in a dough system containing 0-15% sugar and 0.6-1% calcium propionate reaches 95-120%, preferably 105-120%, of the active dry yeast of the parent saccharomyces cerevisiae.
[0027] In a fourth aspect, the present invention provides a fermentation composition comprising the Saccharomyces cerevisiae strain or the Saccharomyces cerevisiae screened by the method described above.
[0028] In a fifth aspect, the present invention provides a bacterial agent comprising the Saccharomyces cerevisiae strain or the Saccharomyces cerevisiae screened by the method described.
[0029] In a sixth aspect, the present invention provides the use of the brewer's yeast strain or the brewer's yeast obtained by screening the method or the fermentation composition or the bacterial agent in food.
[0030] In a seventh aspect, the present invention provides a dough comprising the brewer's yeast strain or the brewer's yeast screened by the method described.
[0031] Preferably, the dough is characterized in that it is obtained by fermenting raw materials including the following parts by weight: 100-110 parts of flour, 0-15 parts of sugar, 46-65 parts of water and 1-2 parts of brewer's dry yeast; preferably, the raw materials also include 0-1 part of calcium propionate; further preferably, the raw materials also include 1-2 parts of salt.
[0032] In an eighth aspect, the present invention provides a method for preparing the dough, comprising: fermenting the brewer's yeast strain or the brewer's yeast screened by the method to obtain dough.
[0033] In a ninth aspect, the present invention provides a baked product comprising the dough or the dough prepared by the method.
[0034] Preferably, the baked product is one of steamed buns, dumplings, bread, biscuits and pot stickers.
[0035] The beneficial effects of the present invention include:
[0036] The cerevisiae AMCC 31585 strain and the cerevisiae AMCC 31580 strain provided by the present invention have excellent activity in the absence of sugar or in the presence of low sugar at different concentrations and in the presence of organic acids and salts thereof at relatively high concentrations. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 Shown are colony morphologies of Saccharomyces cerevisiae AMCC 31585 and Saccharomyces cerevisiae AMCC 31580;
[0038] Figure 2 Shown are microscopic images of Saccharomyces cerevisiae AMCC 31585 and Saccharomyces cerevisiae AMCC 31580 (microscope model Olympus CX43, magnification 400x);
[0039] Figure 3 Shown are growth curves of Saccharomyces cerevisiae AMCC 31585, Saccharomyces cerevisiae AMCC 31580, and the parent Saccharomyces cerevisiae AMCC 30537.
[0040] Culture collection information
[0041] The Saccharomyces cerevisiae AMCC 31585 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on September 25, 2023, with a deposit number of CCTCC NO: M 20231792. The deposit address is: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052.
[0042] The Saccharomyces cerevisiae AMCC 31580 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on September 25, 2023, with a deposit number of CCTCC NO: M 20231791. The deposit address is: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052.
[0043] The Saccharomyces cerevisiae AMCC 30537 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on September 25, 2023, with a deposit number of CCTCC NO: M 20231790. The deposit address is: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052.
[0044] The Saccharomyces cerevisiae AMCC 31194 strain used as a comparative test in Example 4 of the present invention was deposited in the China Center for Type Culture Collection on December 29, 2021, with the deposit number CCTCC NO: M20211684, the deposit address: Wuhan University, Wuhan, China, postal code: 430072; telephone: 027-68754052; and disclosed in the patent application with publication number CN117165456A. DETAILED DESCRIPTION
[0045] The Saccharomyces cerevisiae AMCC 31585 and Saccharomyces cerevisiae AMCC 31580 provided by the present invention are obtained by using the Saccharomyces cerevisiae AMCC 30537 strain (deposit number: CCTCC NO: M20231790) in the strain library of Angel Yeast Co., Ltd. as the experimental starting strain. By utilizing the sexual reproduction characteristics of yeast and self-pollination, progeny with hybrid vigor are selected, thereby obtaining new strains with excellent sugar-free, low sugar concentrations, and high concentrations of organic acids and their salts tolerance.
[0046] The low sugar content means that the yeast strain has a fermentation activity advantage in a dough system with ≤15% sugar, and further in a dough system with ≤12% sugar, including a dough system with, for example, no sugar, 0.01% sugar, 0.05% sugar, 0.1% sugar, 0.15% sugar, 0.2% sugar, 0.25% sugar, 0.3% sugar, 0.35% sugar, 0.4% sugar, 0.45% sugar, 0.5% sugar, 1% sugar, 2% sugar, 3% sugar, 4% sugar, 5% sugar, 6% sugar, 7% sugar, 8% sugar, 9% sugar, 10% sugar, 11% sugar, 12% sugar, 13% sugar, 14% sugar, 15% sugar, etc., as long as the sugar content is less than or equal to 15%.
[0047] First, single spores of the parent Saccharomyces cerevisiae strain AMCC 30537 were prepared using a yeast micromanipulator. Strong spores of different morphologies were screened and hybridization experiments were conducted in various combinations to obtain hybrids. Growth curves of the resulting hybrid strains were analyzed using the Bioscreen C automated growth curve analyzer, and those with significant growth advantages were selected. Shake flask fermentation experiments were conducted on the selected hybrid strains, with the net dry weight of the yeast milk of the hybrid strains and their fermentation activity in various dough systems serving as screening criteria. Specific screening criteria included: the net dry weight of the yeast milk of the hybrid strain reaching 90-110%, preferably 95-110%, of that of the parent strain; the yeast milk fermentation activity of the hybrid strain at 0% sugar reaching 95-120%, preferably 100-120%, of that of the parent strain in one hour; and the fermentation activity of the hybrid strain at 12% sugar reaching 90-120%, preferably 95-120%, of that of the parent strain in two hours.
[0048] The hybrid strain obtained in the above steps was then cultured in a 45L fermentation tank. The resulting yeast cells were then prepared into active dry yeast. The fermentation activity of the active dry yeast was then measured in various dough systems, including 0% sugar, 12% sugar, 0% sugar + 1% calcium propionate, and 12% sugar + 0.6% calcium propionate. The screening criteria were: no significant abnormalities during the active dry yeast preparation process; and fermentation activity of the active dry yeast in each dough system reaching 95%-120%, preferably 105-120%, of that of the parent strain.
[0049] Finally, the hybrid strain selected in the above steps was tested for different formula applications to measure the proofing time of dough in different systems. The shorter the proofing time of the dough, the faster it rises and the stronger its fermentation ability. The strain with the shortest fermentation time was selected as the target strain, thereby screening out the dominant strain.
[0050] The above screening yielded two hybrid strains, designated AMCC 31585 and AMCC 31580. These strains exhibited excellent dough fermentation activity in various dough systems and demonstrated good tolerance to sugars (0-12% sugar) and organic acids and their salts. Identification of these strains revealed the following:
[0051] The cells of the strain were observed to be oval in shape and budded under an optical microscope. The single colonies grown on the solid plate were spherical with a slightly raised center, milky white in color, loose in texture, easily picked up by the inoculation loop, with a smooth, dry surface and neat edges (see Figure 1 ).
[0052] The spore production of hybrid strains AMCC 31585 and AMCC 31580 was examined under the microscope. Figure 2 As shown in the figure, there are many spores in the microscope field and the spores are relatively full, indicating that it has the ability to produce spores, that is, it is a heterozygous strain.
[0053] The resulting hybrid strains AMCC 31585 and AMCC 31580 were named Saccharomyces cerevisiae AMCC 31585 and Saccharomyces cerevisiae AMCC 31580.
[0054] The parent strain, Saccharomyces cerevisiae AMCC 30537, is a strain of Saccharomyces cerevisiae bred by Angel Yeast Co., Ltd. The original strain was collected from Ulanqab City, Inner Mongolia Autonomous Region. The sample was diluted to an appropriate gradient and spread onto YPD solid medium. The culture was incubated at 30°C, and single colonies were picked and repeatedly streaked for purification. The resulting single colony was sampled for molecular biological identification using the 26S rDNA gene and compared against the NCBI database. The strain, designated AMCC 30537, was identified as Saccharomyces cerevisiae AMCC 30537. The 26S rDNA gene sequence of this strain is shown in SEQ ID NO. 1:
[0055] AACCGGGGATTGCCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGG TGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGG AAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGT GGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTAAAAAAACTAAAAACAATG
[0056] Observation under an optical microscope revealed that the colonies of the Saccharomyces cerevisiae strain had a cheese-like texture, a milky white color, a smooth and relatively dry surface, neat edges, an oval microscopic morphology, and budding reproduction.
[0057] The Saccharomyces cerevisiae AMCC31194 strain used in the comparative experiment in Example 4 was obtained by hybridization. The specific construction and identification methods of the strain have been disclosed in the patent application with publication number CN117165456A. The identification results of the strain are as follows: the Saccharomyces cerevisiae strain has a cheese-like texture, a milky white color, a smooth surface, neat edges, an oval microscopic morphology, and budding reproduction. The strain was deposited with the China Center for Type Culture Collection on December 29, 2021, with the deposit number CCTCC NO: M 20211684.
[0058] Unless otherwise specified, the various reagents and instruments used in the examples of the present invention are conventional commercially available products. The source information of the instruments and reagents used in the examples of the present invention is shown in Tables 1 and 2 below.
[0059] Table 1 Instruments used in the examples
[0060]
[0061]
[0062] Table 2 Reagents used in the examples
[0063] Reagents purity Commercial Source Yeast extract powder / Angel Yeast Peptone / Angel Yeast glucose Analytical pure AR Sinopharm Shanghai trial agar Biochemical reagents BR Huixing Potassium acetate Analytical pure AR Sinopharm Shanghai trial concentrated sulfuric acid Analytical pure AR Xilong Chemical Sodium hydroxide Analytical pure AR Sinopharm Wort culture medium / Haibo Bio 2×PCR Mix / Tiangen
[0064] The x% sugar or x% calcium propionate involved in the dough fermentation system in the embodiment of the present invention means that the mass ratio of sugar to flour or calcium propionate to flour in the dough is X:100.
[0065] The formula of the spore production medium used in the embodiment of the present invention is as follows by mass percentage: 1% potassium acetate, 0.1% yeast extract powder, 0.05% glucose, and 2% agar.
[0066] In the embodiment of the present invention, each strain of Saccharomyces cerevisiae was activated using YPD solid culture medium, the formula of which is as follows by mass percentage: 1% yeast extract powder, 2% peptone, 2% glucose, and 2% agar.
[0067] In the embodiment of the present invention, each strain of Saccharomyces cerevisiae was cultured in a YPD liquid culture medium, wherein the formula of the YPD liquid culture medium is as follows in percentage by mass: 1% yeast extract powder, 2% peptone, and 2% glucose.
[0068] Example 1 Strain Construction
[0069] The parent strain, Saccharomyces cerevisiae AMCC 30537, was activated and induced to produce sporulation. Single spores were picked using a yeast micromanipulator and then plated onto solid plates at 30°C. The number of spores plated was recorded. After single-spore colonies emerged, they were named dan1-dan82. The number of surviving spores was 82, and these 82 spores were identified by PCR to determine their MATa / α zygosity. The zygosity identification method involved colony PCR using primers MAT-a, MAT-α, and MAT-F. The PCR program consisted of 94°C pre-denaturation for 10 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds, followed by a final extension at 72°C for 10 minutes. The amplified product was detected by 1.5% (1.5g / 100mL) agarose gel electrophoresis. If a band was found at 404bp, the mating type was determined to be α type, and if a band was found at 544bp, the mating type was determined to be a type. The specific results are shown in Table 3. The primer sequences are:
[0070] MAT-a(5'-ACTCCACTTCAAGTAAGAGTTTG-3')(SEQ ID NO.2)
[0071] MAT-α(5'-GCACGGAATATGGGACTACTTCG-3')(SEQ ID NO.3)
[0072] MAT-F (5'-AGTCACATCAAGATCGTTTATGG-3') (SEQ ID NO. 4) survival rate (%) = (number of surviving spores / number of deposited spores) * 100%
[0073] Table 3 Single spore survival rate and zygotic distribution of parent strains
[0074]
[0075] The single spore prepared above was inoculated into a test tube containing YPD liquid medium, shaken at 30°C, cultured overnight, and then inoculated into a 100-well culture plate containing malt extract medium. The OD600 of each strain was monitored in real time using Bioscreen C. The instrument parameters were set as follows: temperature 30°C, culture time 24 h, wavelength 600 nm, and data were measured every 30 min. Growth efficiency was analyzed based on the plotted growth curve. The growth efficiency was calculated as follows:
[0076] Growth efficiency = (OD2-OD1) / (t2-t1)
[0077] OD1: OD600 value corresponding to the strain at t1;
[0078] OD2: OD600 value corresponding to the strain at t2;
[0079] t1: the starting time of the logarithmic growth phase;
[0080] t2: The end of the logarithmic growth phase.
[0081] The top six single spores in growth efficiency were selected (the growth efficiency and matching type of each strong spore are shown in Table 4), inoculated into YPD liquid medium, shaken at 30°C, and cultured overnight. Then, according to the hybridization combination (Table 5), single spores with different matching types were inoculated into test tubes containing YPD liquid medium, shaken at 30°C, cultured overnight, diluted and spread on YPD solid plates, cultured at 30°C overnight, and the growth of colonies was observed. The 120 spots with larger colonies were selected, marked, and named.
[0082] Table 4 Spore growth efficiency and matching of each strong
[0083]
[0084] Table 5 Hybrid combinations
[0085]
[0086] The colonies marked on the above plates were inoculated into YPD liquid culture medium, shaken at 30°C, and cultured overnight. The strains were then subjected to typing identification and sporulation tests. The screening criteria were: strains with double bands in the electrophoresis results and ascospores observed under a microscope after sporulation culture were identified as heterozygous strains.
[0087] Example 2 Growth curve determination
[0088] The constructed hybrid strain was inoculated into malt extract medium and cultured at 30°C for 24 h. The OD600 value of each strain at different times was determined by high-throughput measurement using the fully automatic growth curve analyzer Bioscreen C. The growth curve was drawn with time (h) as the horizontal axis and the corresponding OD600 value as the vertical axis. The growth efficiency was analyzed and calculated, and the top 40 hybrid strains in growth efficiency were selected.
[0089] The growth curves of the strains numbered as Saccharomyces cerevisiae AMCC 31585 and AMCC 31580 are shown in FIG. Figure 3 As shown, it can be seen that these two strains can grow rapidly in malt juice medium. Table 6 shows the growth efficiency of the parent strain and the Saccharomyces cerevisiae AMCC 31585 and AMCC 31580 strains. It can be seen that the growth efficiency of the obtained Saccharomyces cerevisiae AMCC 31585 and AMCC 31580 strains is significantly higher than that of the parent Saccharomyces cerevisiae AMCC 30537 strain.
[0090] Table 6 Growth efficiency data of parent and new strains
[0091]
[0092] Example 3 Shake flask fermentation test
[0093] The preferred hybrid strains obtained in Example 2 were subjected to shake flask fermentation experiments. The preferred strains were inoculated into shake flasks containing fermentation medium and cultured overnight at 30°C. The precipitate collected after centrifugation was the yeast milk of the strain. The mass of the yeast milk of the strain was weighed to obtain the biomass. The moisture content (%) of the yeast milk of the strain was measured using a rapid moisture meter. The net dry weight (g / L) and relative percentage (%) of the net dry weight of each strain during the shake flask stage were calculated according to the following formula:
[0094] Net dry weight (g / L) = mass of yeast milk × (1-water %)
[0095] Net dry weight relative percentage (%) = (net dry weight of hybrid new strain / net dry weight of parent strain) * 100%
[0096] The sucrase activity of yeast milk of each strain was determined by DNS (dinitrosalicylic acid) colorimetry, and the dry weight was calculated based on the moisture content of the yeast milk determined above, with the unit being U / g.
[0097] Table 7 shows the proportions of various raw material components in different dough systems (calculated based on the mass of flour as 100%). Doughs from these systems were prepared to test the fermentation activity of the preferred strains. Specifically, the mass of yeast extract required for the preferred strains was calculated and weighed. Flour, salt, sugar, and water were weighed according to the dough recipe shown. The dough was then mixed evenly in a dough mixer to produce the dough. The total volume of carbon dioxide produced by yeast fermentation at 30°C, representing the fermentation activity of the strain, was directly measured using an SJA fermentation instrument. The results are expressed in milliliters (mL). The total gas production of 280g of dough in the 0% sugar system was measured over 1 hour, while the total gas production of 70g of dough in the 12% sugar system was measured over 2 hours.
[0098] Table 7 Ratio of each raw material component in different dough systems (%)
[0099]
[0100] The relative percentage of dough fermentation activity of each strain compared to the parent strain was calculated according to the following formula:
[0101] Relative percentage of dough fermentation activity (%) = (dough fermentation activity of hybrid new strain / dough fermentation activity of parent strain) * 100%
[0102] As shown in Table 8, during the shake flask stage, the net dry weights of Saccharomyces cerevisiae strains numbered AMCC 31585 and AMCC 31580 were 12.99 g / L and 14.18 g / L, respectively, representing 92.8% and 101.3% of the parent strain, Saccharomyces cerevisiae AMCC 30537. The sucrase activity of Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580 was 1079.91 U / g and 1878.07 U / g, respectively, exceeding 88% of the parent strain, Saccharomyces cerevisiae AMCC 30537. Related research has shown that yeast strains with lower sucrase activity exhibit higher fermentation activity in sugar-sweetened dough. However, excessive sucrase activity can cause a rapid increase in monosaccharide concentration, which, in turn, leads to decreased fermentation activity due to increased osmotic pressure.
[0103] Table 8 Net dry weight data and sucrase activity data of the parent and new strains
[0104]
[0105]
[0106] In the shake flask stage, after overnight culture, the net dry weight of the other preferred hybrid strains obtained in Example 2 was between 10.47-14.55 g / L, which was 74.8%-103.9% of that of the parent strain Saccharomyces cerevisiae AMCC 30537; and the sucrase enzyme activity was 82.8%-182.3% of that of the parent strain Saccharomyces cerevisiae AMCC 30537.
[0107] As shown in Table 9, in the shake flask stage, the 0% sugar 1-h dough fermentation activities of Saccharomyces cerevisiae AMCC 31585 and AMCC 31580 strains were 1082 mL and 1125 mL, respectively, which were 2.2% and 5.9% higher than those of the parent strain AMCC 30537; the 12% sugar 2-h dough fermentation activities were 215 mL and 162 mL, respectively, which were 120.1% and 90.5% of those of the parent strain AMCC 30537, respectively.
[0108] Table 9 Fermentation activity data of each strain in different dough systems
[0109]
[0110] In the shake flask stage, after overnight culture, the 0% sugar dough system activity of the other preferred hybrid strains obtained in Example 2 was 88.6%-114.1% of that of the parent strain Saccharomyces cerevisiae AMCC 30537, and the 12% sugar dough system activity was 64.2-126.8% of that of the parent strain Saccharomyces cerevisiae AMCC 30537.
[0111] Example 4 Small-scale fermentation process test
[0112] The selected strains screened from shake flask fermentation experiments were scaled up in a 45L fermenter, followed by isolation, washing, filtration, and drying to produce active dry yeast. According to the dough recipes shown in Table 10, flour, salt, sugar, water, and active dry yeast were weighed to prepare doughs of different systems. The total amount of carbon dioxide produced at 30°C was measured using the SJA method, representing the fermentation activity of the active dry yeast at this temperature and in the corresponding dough system. Results are expressed in milliliters (mL). The different dough systems included a 0% sugar dough system (total gas production per 280g dough over 1h); a 12% sugar dough system (total gas production per 280g dough over 2h); a 0% sugar + 1% calcium propionate dough system (total gas production per 280g dough over 2h); and a 12% sugar + 0.6% calcium propionate dough system (total gas production per 280g dough over 2h).
[0113] Table 10 Ratio of each raw material component in different dough systems (%)
[0114]
[0115] No significant abnormalities occurred during the dry yeast preparation process for the Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580. The fermentation activity of their active dry yeast in different dough systems is shown in Table 11, and the relative percentage activity data are shown in Table 12. The results showed that compared to the parent Saccharomyces cerevisiae strain AMCC 30537, the active dry yeast fermentation activities of Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580 were higher than those of the parent strain in the 1-hour fermentation of 0% sugar, with advantages of 4.3% and 6.1%, respectively. The fermentation activities of Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580 were higher in the 2-hour fermentation of 12% sugar, with advantages of 4.6% and 11.6%, respectively. The fermentation activities of Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580 strains in the 2-hour fermentation of 0% sugar and 1% calcium propionate were higher in the 2-hour fermentation of 9.4% and 17.4%, respectively. The fermentation activities of Saccharomyces cerevisiae strains AMCC 31585 and AMCC 31580 strains in the 2-hour fermentation of 12% sugar and 0.6% calcium propionate were higher in the 2-hour fermentation of 18.8% and 18.7%, respectively. This shows that the cerevisiae AMCC 31585 and AMCC 31580 strains still have good fast-rising performance under different dough system conditions, and are suitable for dough systems with 0-12% sugar or 0-12% sugar and added organic acids and their salts.
[0116] Table 11 Fermentation activity data of active dry yeast in different dough systems
[0117]
[0118] Table 12 Active dry yeast activity relative percentage data
[0119]
[0120] The fermentation activity of dry yeast of other strains in each dough system was not outstanding, lower than the dough fermentation activity of the parent strain Saccharomyces cerevisiae AMCC 30537, and did not meet the optimization standard.
[0121] Example 5 Application Test
[0122] The dominant strains screened during the pilot phase were evaluated in application testing. Three formulations of dry yeast from the dominant strains were tested and evaluated: a 0% sugar formulation, a 12% sugar formulation, and a preservative formulation. The time required for dough to reach the same set height (i.e., fermentation time) was recorded. The parent strain, AMCC 30537, was used as a control. Fermentation time was used as an indicator; shorter fermentation times indicated faster rise times and more advantageous yeast strain properties under that dough system. The ratios of the various raw material components in each formulation are shown in Table 13, and the percentages of fermentation times relative to the control strain are shown in Table 14.
[0123] Table 13 Ratio of different raw material components in each application formula (%)
[0124]
[0125] Table 14 Relative percentage data of fermentation time of each strain
[0126]
[0127]
[0128] The results showed that compared to the control strain, strains AMCC 31585 and AMCC 31580 had superior fermentation times in all application recipes, indicating that they had superior rise speeds in different dough systems. Application tests further demonstrated that strains AMCC 31585 and AMCC 31580 exhibited excellent sugar tolerance (0-12% sugar) and tolerance to organic acids and their salts. The resulting hybrid strain AMCC 31580 was named Saccharomyces cerevisiae AMCC 31580, and the resulting hybrid strain AMCC 31585 was named Saccharomyces cerevisiae AMCC 31585.
[0129] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A yeast strain characterized by: The strain is Saccharomyces cerevisiae AMCC 31580 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 20231791.
2. A yeast strain characterized by: The strain is Saccharomyces cerevisiae AMCC 31585 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 20231792.
3. The saccharomyces cerevisiae strain according to claim 1 or 2, characterized in that The strain has low sugar tolerance, and / or organic acid tolerance, and / or organic acid salt tolerance; Preferably, the organic acid comprises one or both of propionic acid and acetic acid; Further preferably, the organic acid salt comprises one or a combination of two or more of calcium propionate, sodium propionate and sodium acetate; More preferably, the organic acid salt comprises calcium propionate.
4. The Saccharomyces cerevisiae strain according to any one of claims 1 to 3, characterized in that The strain is obtained by self-pollination of sexual spores of a parent strain, wherein the parent strain is Saccharomyces cerevisiae AMCC30537 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231790.
5. The saccharomyces cerevisiae strain according to claim 4, characterized in that The dry weight of the yeast milk of the Saccharomyces cerevisiae strain is 90-110%, preferably 95-110%, of the dry weight of the yeast milk of the parent strain.
6. The saccharomyces cerevisiae strain according to claim 4 or 5, characterized in that The fermentation activity of the yeast milk of the saccharomyces cerevisiae strain in a dough system containing 0-15% sugar reaches 90-120%, preferably 95-120%, of the yeast milk of the parent strain.
7. The Saccharomyces cerevisiae strain according to any one of claims 4 to 6, characterized in that The active dry yeast of the Saccharomyces cerevisiae strain has a fermentation activity in a dough system containing 0-15% sugar of 95-120%, preferably 105-120% of that of the parent strain; and / or The fermentation activity of the active dry yeast of the brewer's yeast strain in a dough system containing 0-15% sugar and 0.6-1% calcium propionate reaches 95-120%, preferably 105-120%, of the active dry yeast of the parent strain.
8. The Saccharomyces cerevisiae strain according to any one of claims 4 to 7, characterized in that in, The gene sequence of the 26S rDNA of the Saccharomyces cerevisiae AMCC 30537 strain is shown in SEQ ID NO.
1.
9. A method for screening and obtaining brewer's yeast, the method comprising: The parent yeast Saccharomyces cerevisiae is formed into sexual spores and a single spore of the same parent is self-pollinated to obtain a hybrid strain having: The dry weight of the yeast milk of the hybrid bacteria is 90-110% of the dry weight of the yeast milk of the parent Saccharomyces cerevisiae; The fermentation activity of the hybrid yeast milk reaches 90-120% of that of the parent yeast milk of brewer's yeast in a dough system containing 0-15% sugar.
10. The method according to claim 9, wherein: The hybrid bacteria have: The dry weight of the yeast milk of the hybrid bacteria is 95-110% of the dry weight of the yeast milk of the parent Saccharomyces cerevisiae; Preferably, the fermentation activity of the hybrid yeast milk in a dough system containing 0-15% sugar reaches 95-120% of that of the parent Saccharomyces cerevisiae yeast milk.
11. The method according to claim 9 or 10, wherein: The hybrid bacteria have: The fermentation activity of the active dry yeast of the hybrid bacteria in a dough system containing 0-15% sugar reaches 95-120%, preferably 105-120% of the active dry yeast of the parent Saccharomyces cerevisiae; and / or The fermentation activity of the active dry yeast of the hybrid bacteria in a dough system containing 0-15% sugar and 0.6-1% calcium propionate reaches 95-120%, preferably 105-120%, of the active dry yeast of the parent bacteria Saccharomyces cerevisiae.
12. A fermentation composition comprising the Saccharomyces cerevisiae strain according to any one of claims 1 to 8 or the Saccharomyces cerevisiae screened by the method according to any one of claims 9 to 11.
13. A bacterial agent comprising the Saccharomyces cerevisiae strain according to any one of claims 1 to 8 or the Saccharomyces cerevisiae screened by the method according to any one of claims 9 to 11.
14. Use of the Saccharomyces cerevisiae strain according to any one of claims 1 to 8, the Saccharomyces cerevisiae screened by the method according to any one of claims 9 to 11, the fermentation composition according to claim 12, or the microbial agent according to claim 13 in food.
15. A dough obtained by fermenting flour with the Saccharomyces cerevisiae strain according to any one of claims 1 to 8 or the Saccharomyces cerevisiae screened by the method according to any one of claims 9 to 11.
16. A method for preparing the dough of claim 15, comprising: The yeast strain according to any one of claims 1 to 8 or the yeast obtained by screening according to any one of claims 9 to 11 is fermented to obtain dough.
17. A baked product obtained by baking the dough according to claim 15 or the dough prepared by the method according to claim 16.
18. The baked product according to claim 17, wherein The baked product is one of steamed buns, dumplings, bread, biscuits and pot stickers.
Citation Information
Patent Citations
Saccharomyces cerevisiae strain, screening method and application thereof
CN117165456A