Method for producing laccase at high yield through liquid fermentation of funalia trogii and application of method

Abstract

The invention discloses a method for producing laccase at high yield through liquid fermentation of funalia trogii and application of the method, and belongs to the field of microbial fermentation. The technical problem to be solved by the invention is how to prepare laccase. The method for preparing the laccase, which is disclosed by the invention, comprises the following steps: carrying out liquid state fermentation culture in a liquid culture medium by utilizing Coriolis trogii LFB-F1, so as to obtain the laccase, and the preservation number of the Coriolis trogii LFB-F1 in the General Microbiological Culture Collection Center of the China Committee for Culture Collection of Microorganisms is CGMCC No.41779. The laccase is prepared by utilizing the Coriolis trogii LFB-F1 and utilizing the Coriolis trogii LFB-F1 to carry out fermentation culture on the Coriolis trogii LFB-F1. The method comprises the following steps: inoculating Coriosis trogii LFB-F1 into a propagation medium, fermenting for 2-4 days, adding an enzyme production medium in a liquid fed-batch manner, and continuously fermenting for 3-6 days, so that the yield of laccase reaches 1.9 * 10 < 4 > U / L.

Description

Technical Field

[0001] The invention belongs to the field of microbial fermentation, and particularly relates to a method for high-yield laccase by liquid fermentation of Poria cocos and application thereof. Background Art

[0002] Faced with the growing global demand for feed grains, the utilization of lignocellulosic biomass has shown great potential. Lignocellulosic biomass includes rice straw, wheat straw, corn straw, sugarcane bagasse, corn cobs, etc. Straw resources are very abundant, with the advantages of large scale, multiple categories, and wide range. In straw, cellulose, hemicellulose, and lignin are cross-linked to form a complex and stable network structure. Lignin contains abundant hydrogen bonds, methoxy groups, and polyaromatic rings, and is connected to hemicellulose and cellulose in a bridging manner to form a complex supramolecular structure. This structure allows lignin to wrap around cellulose layer by layer, hindering the subsequent degradation process. Therefore, the first problem to be solved in straw feed is the decomposition of lignin.

[0003] Laccase (ρ-diphenoloxidase, EC1.10.3.2) is a copper-containing polyphenol oxidase widely found in plants, animals, insects, bacteria, and fungi. It catalyzes the oxidation of substances such as o- and p-diphenol, polyphenols, and ascorbic acid by obtaining O₂, generating the corresponding benzoquinones and water. Laccase has broad substrate specificity and can catalyze the degradation of a variety of aromatic compounds. It can effectively decompose lignin, thereby processing biomass resources and promoting the conversion of straw into feed.

[0004] Inonotus rigidus, belonging to the phylum Basidiomycota, class Agaricaceae, order Polyporaceae, family Polyporaceae, and genus Lepidoptera, is a temperate white-rot fungus. It possesses a well-developed lignocellulose-degrading enzyme system, secreting cellulases, peroxidases, and laccases. Its rapid growth, high biomass, and rapid enzyme production make it suitable for large-scale production of cellulases and laccases. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to prepare laccase.

[0006] In order to solve the above technical problems, the present invention first provides a Coriolopsis trogii ) At least one of the following applications of LFB-F1: X1) Application in the preparation of laccase; X2) Application in degradation of lignocellulose; X3) Application in the preparation of biological feed; The hard-haired porphyra ( Coriolopsis trogii) The deposit number of LFB-F1 in the General Microbiology Center of China Culture Collection Administration is CGMCC No.41779.

[0007] The present invention also provides a method for preparing laccase, the method comprising: utilizing the Coriolopsis trogii ) LFB-F1 was fermented in liquid culture medium to obtain laccase.

[0008] In the above method, the liquid culture medium may be composed of a solvent and a solute, wherein the solvent is water, and the solute is starch, peptone, glucose, yeast extract, CuSO4·5H2O, MgCl2 and VB1.

[0009] Specifically, in the liquid culture medium, the solutes and their concentrations may be starch 0.5-4 g / 100 mL, peptone 0.25-3 g / 100 mL, glucose 0.5-2 g / 100 mL, yeast extract 0.5-3 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, respectively, with a pH value of 6.5.

[0010] In one embodiment of the present invention, the liquid culture medium is an expansion liquid culture medium, wherein the solutes and their concentrations are starch 2 g / 100 mL, peptone 0.5 g / 100 mL, glucose 0.5 g / 100 mL, yeast extract 0.8 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, and pH = 6.5±0.3.

[0011] In the above method, the fermentation culture can be carried out at 25-33°C (such as 25, 26, 27, 28, 29, 30, 31, 32, or 33°C).

[0012] In the above method, the culture time can be 1-10 days (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days, etc.).

[0013] The fermentation culture can be carried out in a shaking incubator.

[0014] The method further comprises adding an enzyme-producing medium to the liquid fermentation culture. The amount of the enzyme-producing medium added can be adjusted according to the specific circumstances. In one embodiment of the present invention, the amount of the enzyme-producing medium added is equal in volume to the liquid culture medium.

[0015] The enzyme production culture medium consists of a solvent and a solute, wherein the solvent is water, and the solutes are starch, peptone, molasses, beef extract, CuSO4.5H2O, MgCl2 and VB1.

[0016] In one embodiment of the present invention, the solutes and their concentrations in the enzyme production culture are: starch 1 g / 100 mL, peptone 0.5 g / 100 mL, molasses 2 g / 100 mL, beef extract 0.5 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, and pH = 6.5±0.3.

[0017] In the above method, the fermentation culture can be carried out at a ventilation ratio of 0.5 to 1.5 m 3 / m 3 min, such as 1.5 m 3 / m 3 ·min.

[0018] In one embodiment of the present invention, the fermentation culture is carried out in the enrichment liquid culture medium for 3 days, and the fermentation is continued for 4 days after the enzyme production medium is added.

[0019] The present invention also provides a method for degrading lignocellulose, the method comprising: Coriolopsis trogii ) LFB-F1 or its fermentation liquid is added to straw (such as corn straw) for cultivation to achieve the degradation of straw lignocellulose.

[0020] Specifically, the culture can be performed at 28-30°C.

[0021] The present invention also provides a method for preparing straw biological feed, the method comprising: Coriolopsis trogii ) LFB-F1 or its fermentation liquid is added to straw (such as corn straw) for cultivation to obtain biological feed.

[0022] In the above method for preparing straw bio-feed, the added amount of the fermentation liquid can be 5 mL / 1000 g straw.

[0023] The above-mentioned method for preparing straw biological feed may include adding the Coriolopsis trogii ) Add auxiliary materials to the straw before LFB-F1. The auxiliary materials are composed of molasses, ammonium sulfate, and urea in a mass ratio of 1:1:1. The amount of the auxiliary materials added can be 1% of the mass of the straw.

[0024] The above method for preparing straw bio-feed may further include adding a mixture of Pediococcus pentosaceus and Pediococcus acidilactici before fermentation. In the mixture of Pediococcus pentosaceus and Pediococcus acidilactici, the content of Pediococcus pentosaceus is 3×10 9 CFU / mL, the content of Pediococcus acidilactici was 3×10 9 The amount of the mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici added can be 2 mL / 1000 g straw.

[0025] In the above method for preparing straw bio-feed, the culturing can be carried out at 23°C-45°C, such as 37°C.

[0026] In the above method for preparing straw bio-feed, the culturing time may be 21 days.

[0027] The present invention also provides a straw biological feed, which is prepared by the method for preparing the straw biological feed.

[0028] The application of the straw biological feed in improving the production performance of ruminants or improving the digestion and utilization rate of nutrients by ruminants also falls within the protection scope of the present invention.

[0029] The present invention is a pustularia sclerotiorum ( Coriolopsis trogii )LFB-F1 can produce laccase and can also be used in the preparation of straw bio-feed. Coriolopsis trogii )LFB-F1 mycelia and spores were inoculated into the propagation medium. After fermentation for 2 to 4 days, the liquid flow was added to the enzyme production medium and the fermentation was continued for 3 to 6 days. The laccase production reached 1.9×10 4 U / L. The two-stage liquid fermentation method for producing laccase has the advantages of a short fermentation cycle and high laccase yield. The fermented laccase can be used to prepare straw bio-feed, significantly reducing the lignocellulose content in the straw and improving the digestion and utilization efficiency of the straw bio-feed. This provides an effective biotechnology resource and method for the utilization of straw as feed.

[0030] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0031] Description of biological material deposit Abbreviation of the depository unit: CGMCC.

[0032] Name of depository unit: General Microbiology Center of China Culture Collection Administration of Microorganisms.

[0033] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0034] Date of preservation: January 17, 2025.

[0035] The registration number of the CGMCC Collection Center is: CGMCC No.41779.

[0036] Classification name: Coriolopsis trogii ).

[0037] Strain number: LFB-F1.

[0038] Description of biological material deposit Abbreviation of the depository unit: CGMCC.

[0039] Name of depository unit: General Microbiology Center of China Culture Collection Administration of Microorganisms.

[0040] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0041] Date of preservation: November 9, 2023.

[0042] The registration number of the CGMCC Collection Center is: CGMCC No.28922.

[0043] Classification name: Pediococcus acidilactici ( Pediococcus acidilactici ).

[0044] Strain number: A62.

[0045] Description of biological material deposit Abbreviation of the depository unit: CGMCC.

[0046] Name of depository unit: General Microbiology Center of China Culture Collection Administration of Microorganisms.

[0047] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0048] Date of preservation: November 9, 2023.

[0049] The registration number of the CGMCC Collection Center is: CGMCC No.28923.

[0050] Classification name: Bacillus subtilis ( Bacillus subtilis ).

[0051] Strain number: KO1.

[0052] Description of biological material deposit Abbreviation of the depository unit: CGMCC.

[0053] Name of depository unit: General Microbiology Center of China Culture Collection Administration of Microorganisms.

[0054] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0055] Date of preservation: November 9, 2023.

[0056] The registration number of the CGMCC Collection Center is: CGMCC No.28921.

[0057] Classification name: Pediococcus pentosaceus ( Pediococcus pentosaceus ).

[0058] Strain number: A7. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is the colony of strain LFB-F1.

[0060] Figure 2 The left image shows the results for strain LFB-F1, and the right image shows one of the four strains except LFB-F1.

[0061] Figure 3 This is a phylogenetic tree constructed based on the neighbor-joining method.

[0062] Figure 4 Distribution of carbohydrate-active enzyme genes in LFB-F1 of Pseudomonas aeruginosa.

[0063] Figure 5 This is the growth curve of LFB-F1.

[0064] Figure 6 This is the pH change curve of Pseudomonas aeruginosa LFB-F1.

[0065] Figure 7 To determine the acid resistance of F. hardycota LFB-F1.

[0066] Figure 8 This is to determine the temperature tolerance of the fungus LFB-F1.

[0067] Figure 9 The color and morphology of straw after degradation by the strains. A: Poresia rigida LFB-F1; B: Pediococcus acidilactici; C: Bacillus subtilis; D: blank control.

[0068] Figure 10 This is the optimization of the carbon source type and concentration in Example 6. “%” means “g / 100mL”.

[0069] Figure 11 This is the optimization of the type and concentration of the nitrogen source in Example 6. “%” means “g / 100mL”.

[0070] Figure 12 This is the optimization of the type and concentration of the inorganic salt in Example 6. “%” means “g / 100mL”.

[0071] Figure 13 This is the optimization of the inoculum amount in Example 8.

[0072] Figure 14 This is the optimization of the types of auxiliary materials in Example 8. TM: molasses; LSA: ammonium sulfate; NS: urea.

[0073] Figure 15 This is the optimization of the amount of auxiliary materials added in Example 8.

[0074] Figure 16 This is the optimization of the fermentation temperature in Example 8.

[0075] Figure 17 This is the optimization of the fermentation time in Example 8. DETAILED DESCRIPTION

[0076] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. The materials, reagents, and instruments used in the following examples were all commercially available unless otherwise noted. The quantitative experiments in the following examples were performed in at least three replicates.

[0077] SPSS 26.0 statistical software was used to process the data in the following examples, and a One-way ANOVA test was performed. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated an extremely significant difference, P < 0.001 (***) indicated an extremely significant difference, and P < 0.001 (****) indicated an extremely significant difference.

[0078] The Pediococcus acidilactici in the following examples is Pediococcus acidilactici ( Pediococcus acidilactici ) A62, recorded in Chinese patent ZL202410391819.9 (authorization announcement number CN 117987328 B), was deposited in the General Microbiology Center of China Culture Collection Administration on November 9, 2023, with the deposit number CGMCC No. 28922.

[0079] The Bacillus subtilis in the following examples is Bacillus subtilis ( Bacillus subtilis)KO1, recorded in Chinese patent ZL202410391819.9 (authorization announcement number CN 117987328 B), was deposited in the General Microbiology Center of China Culture Collection Administration on November 9, 2023, with the deposit number CGMCC No. 28923.

[0080] The Pediococcus pentosaceus in the following examples is Pediococcus pentosaceus ( Pediococcus pentosaceus ) A7, recorded in Chinese patent ZL202410391819.9 (authorization announcement number CN 117987328 B), was deposited in the General Microbiology Center of China Culture Collection Administration on November 9, 2023, with the deposit number CGMCC No. 28921.

[0081] Example 1: Isolation of Inonotus rigidus (1) Sample The samples used for strain isolation came from fungal fruiting bodies collected by the inventor in Beijing in June 2023.

[0082] (2) Preparation of culture medium Straw powder selective culture medium: straw powder 1 g / 100 mL, NH4NO3 0.2 g / 100 mL, KH2PO4 0.1 g / 100 mL, MgSO4 0.03 g / 100 mL, FeSO4 0.01 g / 100 mL, MnSO4 0.005 g / 100 mL, NaCl 0.5 g / 100 mL, agar 1.8 g / 100 mL, the balance is water, autoclave at 121°C for 20 min.

[0083] Potato dextrose agar medium (PDA solid medium): potato flour 0.6 g / 100 mL, glucose 2 g / 100 mL, agar 2 g / 100 mL, pH 5.4-5.8, the balance is water, autoclave at 121°C for 20 min.

[0084] (3) Strain isolation The fungal fruiting bodies were ground, added to PBS, and shaken for 20 minutes. After standing for 30 minutes, the supernatant was spread on a straw powder selective medium and cultured in a 28°C incubator for 96 hours. Initial observation of the strains was performed by colony morphology and microscopic examination. Strains with fast growth and large colony diameter were selected and streaked onto PDA solid medium plates for purification and cultivation for three generations.

[0085] Four fast-growing strains were isolated from the sample. The fastest growing one was a white fungus ( Figure 1 ), numbered LFB-F1.

[0086] (3) Screening of laccase production capacity After isolation and purification, colonies of the four strains with a diameter of 5-6 mm were taken from the edge and inoculated onto guaiacol culture plates (potato starch 0.6 g / 100 mL, glucose 2 g / 100 mL, agar 2 g / 100 mL, guaiacol 0.1% g / 100 mL, the balance water, autoclaved at 121°C for 20 minutes). The plates were cultured for 72 hours, and the diameter of the dark brown ring was measured. The brown ring of the strain LFB-F1 was the largest ( Figure 2 ).

[0087] (4) Strain identification For strain LFB-F1, the genome of the strain was further amplified by PCR using ITS, and the resulting product was sequenced. The amplification primers were: ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 1); ITS2: 5'-GCTGCGTTCTTCATCGATGC-3' (SEQ ID NO: 2).

[0088] Amplification and sequencing yielded the following sequence: 5'-CTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAAATGGGTTGTAGCTGGCTTCTCCGGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCATCGGGAGGTGTCGCGTCG TGTACGGCGAGGCGTTAACCGTGCCTATGTTTTACTACAAACGATTCAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGC-3'(SEQ ID NO: 3).

[0089] The obtained sequence was compared with the NCBI database by BLAST and found to be similar to that of Coriolopsis trogii ) has the highest sequence similarity, reaching 99.27%. The phylogenetic tree was constructed based on the neighbor-joining method. The results are as follows Figure 3 As shown in the figure, strain LFB-F1 and Pseudomonas aeruginosa clustered into a branch. Based on the results of its morphological characteristics, physiological and biochemical characteristics and phylogenetic analysis, it was finally determined that the strain was Pseudomonas aeruginosa ( Coriolopsis trogii ), the strain was recorded as Pseudomonas aeruginosa ( Coriolopsis trogii) LFB-F1, which was deposited in the General Microbiology Center of China Culture Collection Administration on January 17, 2025, with the deposit number CGMCC No. 41779.

[0090] (5) Whole genome sequencing Genomic DNA was extracted from LFB-F1, and its genome was sequenced, assembled, and gene prediction and lignin-degrading enzyme analysis were performed. The total genome length of LFB-F1 is 38.7Mb, with a GC content of 54.93%. The carbohydrate-active enzyme genes in the genome were analyzed using the CAZy database. The distribution of carbohydrate enzymes in LFB-F1 is shown in the following figure: Figure 4 shown.

[0091] GHs: Glycoside Hydrolases, GTs: Glycosyltransferases, PLs: Polysaccharide Lyases, AAs: Auxiliary Activities, CEs: Carbohydrate Esterases, CBMs: Non-catalytic carbohydrate-binding modules.

[0092] Example 2: Study on the biological characteristics of Pseudomonas aeruginosa LFB-F1 (1) Growth curve Culture the fungus LFB-F1 on PDA solid medium for 7 days. Scrape an appropriate amount of spores and hyphae from the plate and dilute to the appropriate concentration with PBS buffer. Inoculate 1 mL of the culture into 100 mL of PDA liquid medium and incubate at 30°C and 200 rpm for 10 days. Collect the culture at different times, centrifuge, discard the supernatant, and then dry and weigh.

[0093] The results showed that the biomass of LFB-F1 reached its maximum on the 8th day of growth and then began to decline slowly ( Figure 5 ), so the fermentation time was selected as 8d.

[0094] (2) Changes in pH of fermentation broth LFB-F1 was activated and cultured in PDA liquid medium. The activated LFB-F1 was inoculated into PDA liquid medium at a 5% (v / v) inoculum and cultured at 30°C and 200 rpm. Samples were taken at different time points, and the culture liquid was centrifuged at 12000 rpm and room temperature for 5 min. The supernatant was taken for pH measurement.

[0095] The results showed that the pH of LFB-F1 continued to decrease during the growth period, reaching a minimum of 3.7 on the 6th day, and then increased slightly ( Figure 6 ).

[0096] (3) Acid resistance test LFB-F1 was activated in PDA liquid medium. The activated LFB-F1 was inoculated at a 5% (v / v) inoculum into PDA liquid medium at pH values ​​of 1.5, 2.5, 3.5, 4.5, 5.5, 6.5, and 7.0. The culture was conducted at 30°C and 200 rpm for 8 days. The cells were then collected, filtered, dried, and weighed.

[0097] The results showed that when the initial pH value of the culture medium was 5.5, the biomass of the strain reached its maximum value, which was about 110 mg ( Figure 7 ).

[0098] (4) Optimum growth temperature The hard-hidden pore fungus LFB-F1 was activated and cultured in PDA liquid culture medium. The activated hard-hidden pore fungus LFB-F1 was inoculated at a 5% (v / v) inoculation rate into culture medium at temperatures of 25°C, 30°C, 37°C, 40°C, 45°C, and 50°C, respectively. The culture was carried out at 200 rpm for 7-8 days. After culture, the bacteria were collected, filtered, dried, and weighed.

[0099] The results showed that when the temperature was 37℃, the biomass of the strain reached its maximum value, about 122 mg ( Figure 8 ).

[0100] Example 3: Determination of laccase activity produced by liquid fermentation of Porites fasciatus LFB-F1 (1) Preparation of liquid culture medium for propagation: starch 2 g / 100 mL, peptone 0.5 g / 100 mL, glucose 0.5 g / 100 mL, yeast extract 0.8 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, pH = 6.5 ± 0.3, the balance is water.

[0101] (2) Fermentation culture: Inoculate the hard-hidden Porites LFB-F1 into PDA solid culture medium and culture at 28°C until the mycelium covers the plate; add 10 mL of PBS solution to the solid culture medium, scrape the mycelium and spores to make a suspension, and inoculate 1% of the suspension into a conical flask containing a propagation liquid culture medium for fermentation. The fermentation conditions are 28°C, a rotation speed of 150 rpm, and a culture time of 6 days to obtain the hard-hidden Porites fermentation liquid.

[0102] (3) Determination of laccase activity by ABTS method: 100 μL of the fermentation supernatant of P. rigidus was mixed with 900 μL of pH 3.0 citric acid-sodium hydrogen phosphate buffer solution, preheated at 30°C for 3 min, and then mixed with an equal volume of 2 mmol / L ABTS aqueous solution preheated at 30°C, reacted at 30°C for 10 min, and the OD was measured. 420 One unit of laccase activity was defined as the amount of enzyme that oxidized 1 μmol ABTS per minute.

[0103] The laccase activity in the fermentation broth of Pseudomonas aeruginosa was determined to be 2102 U / L.

[0104] (4) Preparation of a dry powder preparation of P. fusca: The fermentation broth of P. fusca obtained in step (2) was mixed uniformly at a mass ratio of fermentation broth to carrier of 0.8:1, and then dried and crushed at low temperature (50-60°C) to obtain a dry powder preparation of P. fusca. The carrier was obtained by mixing bran and glucose at a mass ratio of 3:1.

[0105] Example 4: Determination of laccase activity produced by solid-state fermentation of Porites fasciatus (1) Fermentation matrix: soybean meal, CuSO4·5H20, biotin and water were mixed. The content of each substance was 100 parts by mass of soybean meal, 0.1 parts by mass of CuSO4·5H20, and 0.09 parts by mass of biotin. The moisture content of the fermentation matrix was 70%, and the pH was 5.5.

[0106] (2) After culturing LFB-F1 in a propagation liquid medium at 28°C and 150 rpm for 4 days, it was inoculated into the fermentation matrix at a 20% inoculum size (i.e., 20 ml / 100 g) and cultured at 30°C for 8 days to obtain the fermentation product.

[0107] (3) Take 5 g of fermentation product and add an appropriate amount of distilled water. Oscillate on a shaker at 200 rpm at 28°C for 1 h. Centrifuge at 5000 rpm at 4°C for 10 min. Collect the supernatant and determine the laccase activity according to the method of "ABTS method for determining laccase activity" in Example 3.

[0108] At the same time, 5 g of fermentation product was weighed and dried to constant weight, and then weighed to calculate the water content. The mass of the wet solid matrix (i.e., fermentation product) minus the water content was the mass of the dry matrix, and the laccase activity per gram of dry matrix (U / g) was calculated.

[0109] The laccase activity in the solid-state fermentation of the Mycelium sclerotium was determined to be 2983 U / g.

[0110] Example 5: Ability of Inonotus rigidus to degrade corn straw lignocellulose In this example, the degradation of corn stalks was carried out using P. rigidus LFB-F1, Pediococcus acidilactici, and Bacillus subtilis, respectively, with no bacteria added as a blank control. The steps were as follows: (1) Inoculate LFB-F1 into PDA solid medium and culture at 28°C until the mycelium covers the plate; add 10 mL of PBS solution to the solid medium, scrape the mycelium and spores to make a suspension, and inoculate 1% of the suspension into a conical flask containing a propagation liquid medium for fermentation at 28°C, a rotation speed of 150 rpm, and a culture time of 6 days to obtain the fermentation liquid of LFB-F1; Pediococcus acidilactici was cultured in MRS medium at 37°C, 60 rpm, and 24 h to obtain a fermentation broth of Pediococcus acidilactici. Bacillus subtilis was cultured in BPY medium at 37° C., a rotation speed of 180 rpm, and a culture time of 36 h to obtain a Bacillus subtilis fermentation solution.

[0111] (2) Take 6 g of finely ground corn straw and add 5 mL of each fermentation solution. Add 5 mL of distilled water as a blank control. The fermentation substrate is viscous and muddy. Incubate in a constant temperature incubator at 30°C for 5 days.

[0112] (3) Take 25 mL of pH 5.5 PBS solution to soak the fermented straw. After fully mixing, place the solid-liquid mixture in a 4°C refrigerator and soak for 24 hours. Place the solid-liquid mixture in a vacuum filter and filter it. Dry the filter residue at 65°C for 3 days. Turn it over every 24 hours and weigh the total weight (i.e., total dry weight). Carefully separate the straw substrate from the colony, weigh the total weight of the residue (i.e., the separated straw substrate and colony), and calculate the weight loss rate.

[0113] The calculation formula for weight loss rate is: L=(m2-m1) / m0×100%, where m2 is the total dry weight; m1 is the total weight of the residue; and m0 is the dry weight of the straw.

[0114] The degradation rates (i.e., weight loss rates) of each strain are shown in Table 1. The degradation rate of LFB-F1 was 38%, which was significantly higher than that of other strains. During the degradation process, LFB-F1 also grew significantly in the straw ( Figure 9 ).

[0115] Table 1. Straw degradation efficiency of each strain

[0116] Note: n=3; Data in the same row with different shoulder letters indicate significant differences (P<0.05), while data with the same shoulder letters or no shoulder letters indicate no significant differences (P>0.05).

[0117] Example 6: Optimization of conditions for producing laccase by liquid fermentation of Poria coccidis The components and concentrations of the culture medium were optimized based on the following: starch 2 g / 100 mL, peptone 0.5 g / 100 mL, glucose 0.5 g / 100 mL, yeast extract 0.8 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, pH 6.5 ± 0.3, with the balance being water.

[0118] (1) Screening of carbon source types: replace the "starch" in the propagation liquid culture medium with the following carbon sources: sucrose 1 g / 100 mL, lactose 1 g / 100 mL, 1% (v / v) glycerol, starch 1 g / 100 mL, and glucose 1 g / 100 mL.

[0119] LFB-F1 was inoculated into PDA solid medium and cultured at 28°C until the mycelium covered the plate. 10 mL of PBS solution was added to the solid medium, and the mycelium and spores were scraped to make a suspension. The suspension was inoculated at a 1% inoculum into liquid culture medium containing different carbon sources for fermentation at 28°C and 150 rpm for 6 days to obtain the fermentation broth of LFB-F1.

[0120] The laccase activity in the obtained fermentation broth was detected according to the ABTS method for determining laccase activity in Example 3.

[0121] The results showed that when starch was used as a carbon source, the laccase activity was much higher than that of other carbon sources, and starch was the best carbon source for the fermentation of LFB-F1. Figure 10 ).

[0122] (2) Starch concentration screening: Starch was used as the carbon source for the propagation liquid culture medium. The starch concentration was set at 0.5 g / 100 mL, 1 g / 100 mL, 2 g / 100 mL, 3 g / 100 mL, and 4 g / 100 mL. Fermentation of LFB-F1 was performed according to the method in step (1) above, and the laccase activity was detected.

[0123] The results showed that the maximum laccase activity was achieved when the starch concentration was 2 g / 100 mL. Therefore, the optimal starch concentration in the fermentation medium of LFB-F1 was 2 g / 100 mL ( Figure 10 ).

[0124] (3) Nitrogen source selection: The peptone in the propagation liquid medium was replaced with the following nitrogen sources: peptone 0.5 g / 100 mL, yeast powder 0.5 g / 100 mL, ammonium sulfate 0.5 g / 100 mL, sodium nitrate 0.5 g / 100 mL, and ammonium chloride 0.5 g / 100 mL. Fermentation of LFB-F1 was carried out according to the method in step (1) above, and the laccase activity was detected.

[0125] The results showed that when peptone was used as a nitrogen source, the laccase activity was much higher than that of other nitrogen sources, and peptone was the best nitrogen source for the fermentation of LFB-F1. Figure 11 ).

[0126] (4) Nitrogen source concentration screening: Peptone was used as the nitrogen source for the propagation liquid culture medium. The peptone concentrations were set at 0.25 g / 100 mL, 0.5 g / 100 mL, 1 g / 100 mL, 2 g / 100 mL, and 3 g / 100 mL. Fermentation of LFB-F1 was performed according to the method in step (1) above, and the laccase activity was detected.

[0127] The results showed that the maximum activity of laccase was achieved when the peptone concentration was 0.5 g / 100 mL. Therefore, the optimal concentration of peptone in the fermentation medium of LFB-F1 was 0.5 g / 100 mL ( Figure 11 ).

[0128] (5) Screening of inorganic salt ions: The "CuSO4·5H2O" in the propagation liquid culture medium was replaced with the following inorganic salts: NaCl 0.02 g / 100 mL, MgCl2 0.02 g / 100 mL, KH2PO4 0.02 g / 100 mL, and CuSO4·5H2O 0.02 g / 100 mL, respectively. Fermentation of LFB-F1 was carried out according to the method in step (1) above, and the laccase activity was detected.

[0129] The results showed that when CuSO4·5H2O was used as an inorganic salt, the laccase activity was much higher than that of other inorganic salts, and CuSO4·5H2O was the best inorganic salt for the fermentation of LFB-F1. Figure 12 ).

[0130] (6) Screening of the amount of inorganic salt added: CuSO4·5H2O was used as the inorganic salt in the propagation liquid culture medium. The concentration of CuSO4·5H2O was set at 0.0025 g / 100 mL, 0.005 g / 100 mL, 0.01 g / 100 mL, 0.02 g / 100 mL, and 0.03 g / 100 mL. Fermentation of LFB-F1 was carried out according to the method in step (1) above, and the laccase activity was detected.

[0131] The results showed that the maximum laccase activity was achieved when the concentration of CuSO4·5H2O was 0.02 g / 100 mL, and there was no significant difference in laccase activity compared with that at 0.01 g / 100 mL CuSO4·5H2O ( Figure 12 ). 0.01 g / 100 mL CuSO4·5H2O was selected for subsequent experiments.

[0132] In summary, the optimal liquid medium formula for propagation was as follows: starch 2 g / 100 mL, peptone 0.5 g / 100 mL, glucose 0.5 g / 100 mL, yeast extract 0.8 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, pH = 6.5 ± 0.3, and the balance was water.

[0133] Example 7: Expansion culture of Pseudomonas aeruginosa LFB-F1 was inoculated into PDA solid medium and cultured at 28°C until mycelium covered the plate. 10 mL of PBS solution was added to the solid medium, mycelium and spores were scraped to prepare a suspension, and 1% inoculum was inoculated into the optimal propagation liquid medium containing Example 6 for fermentation. The fermentation conditions were 25-33°C, and the ventilation ratio was 0.5-1.5 m 3 / m 3 ·min, rotation speed 200-700 rpm, after fermentation in the optimal propagation liquid medium for 2-4 days, feeding is carried out, and an enzyme production medium with an equal volume to the optimal propagation liquid medium is fed into the fermentor, and fermentation is continued for 3-6 days to obtain a fermentation liquid of Pseudomonas aeruginosa.

[0134] The enzyme production medium consists of: starch 1 g / 100 mL, peptone 0.5 g / 100 mL, molasses 2 g / 100 mL, beef extract 0.5 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, VB1 0.001 g / 100 mL, pH = 6.5±0.3, and the balance is water.

[0135] The laccase activity in the obtained fermentation broth was detected according to the ABTS method for determining laccase activity in Example 3.

[0136] The results showed that when the total fermentation time reached 7 to 10 days, the laccase activity tended to be stable and reached a maximum value of 1.9×10 4 U / L, the fermentation temperature at this time is 30℃, and the ventilation ratio is 1.5 m 3 / m 3 ·min, the rotation speed was 400 rpm, and the fermentation was carried out in the optimal expansion liquid medium for 3 days. After adding the enzyme production medium, the fermentation was continued for 4 days.

[0137] After the fermentation is completed, the bacterial liquid of the hard-histotrichum sclerotium is filtered or not filtered to obtain a crude laccase enzyme liquid, and the crude enzyme liquid is dried at low temperature to obtain a crude laccase preparation.

[0138] Example 8: Preparation of straw biofeed The crude laccase enzyme solution obtained in Example 7 was mixed with the kneaded corn straw at a ratio of 1‰ to 9‰ (v / w, i.e., mL / 1000 g corn straw), or the crude laccase preparation was mixed with the kneaded corn straw at a ratio of 0.1‰ to 0.5‰ (w / w, i.e., g / 1000 g corn straw). After mixing, 2% to 8% (v / w, i.e., mL / 1000 g corn straw) of a mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated into the straw, and the moisture content was controlled at 60% to 70%, and anaerobic enzyme cooperative fermentation was carried out.

[0139] Among them, the content of Pediococcus pentosaceus in the mixture of Pediococcus pentosaceus and Pediococcus acidilactici was 3×10 9 CFU / mL, the content of Pediococcus acidilactici was 3×10 9 CFU / mL.

[0140] In order to obtain a higher degradation rate of lignocellulose in straw, the fermentation conditions were optimized, including: (1) Addition amount of crude laccase solution: 1‰, 3‰, 5‰, 7‰, and 9‰ (v / w) crude laccase solution were mixed with kneaded corn straw, and a mixture of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated at a 2% (v / w) inoculation rate. The water content was controlled at 60%-70% for bacterial-enzyme synergistic fermentation. The fermentation time was 21 days and the fermentation temperature was 37°C to obtain straw bio-feed. The acid detergent fiber content in the obtained straw bio-feed was detected.

[0141] The results showed that when the inoculation amount was 5‰, the acid detergent fiber of straw biofeed was significantly lower than that of other treatment groups, so the addition amount of 5‰ was selected as the optimal addition amount for subsequent experiments ( Figure 13 ).

[0142] (2) Types of auxiliary materials: Molasses + ammonium sulfate, molasses + urea, and molasses + ammonium sulfate + urea were added to corn straw as auxiliary materials at a rate of 1% (w / w, i.e., g / 1000g corn straw). The crude laccase solution was added at a rate of 5‰ (v / w). A mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated at a rate of 2% (v / w). The water content was controlled at 60%–70% for bacterial and enzyme synergistic fermentation. The fermentation time was 21 days and the fermentation temperature was 37°C to obtain straw bio-feed. The acid detergent fiber content in the obtained straw bio-feed was determined. The control (CON) was prepared without the addition of auxiliary materials.

[0143] Molasses + ammonium sulfate: The mass ratio of molasses to ammonium sulfate is 1:1.

[0144] Molasses + urea: The mass ratio of molasses to urea is 1:1.

[0145] Molasses + ammonium sulfate + urea: The mass ratio of molasses, ammonium sulfate and urea is 1:1:1.

[0146] The results showed that when the auxiliary materials were molasses + ammonium sulfate + urea, the acid detergent fiber was lower than that of other treatment groups, so these three were selected as auxiliary materials to be added into the feed ( Figure 14 ).

[0147] (3) Amount of auxiliary materials added: Auxiliary materials (molasses + ammonium sulfate + urea) were added at 1%, 2%, 3%, 4%, and 5% respectively. The crude laccase enzyme solution was added at a rate of 5‰ (v / w). A mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated at a rate of 2% (v / w). The water content was controlled at 60%-70% for bacterial-enzyme synergistic fermentation. The fermentation time was 21 days and the fermentation temperature was 37°C to obtain straw bio-feed. The acid detergent fiber content in the obtained straw bio-feed was determined. The control (CON) was set without the addition of auxiliary materials.

[0148] The results showed that when the amount of auxiliary materials added was 1% (mass percentage), the acid detergent fiber content of straw biofeed was the lowest and the degradation effect was the best. Therefore, the amount of auxiliary materials added was 1% (mass percentage). Figure 15 ).

[0149] (4) Fermentation temperature: The auxiliary materials were 1% (mass percentage) molasses + ammonium sulfate + urea, the addition amount of crude laccase was 5‰ (v / w), and the mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated at a 2% (v / w) inoculation rate. The water content was controlled at 60%-70% for bacterial-enzyme synergistic fermentation. The fermentation temperature was set at 23°C, 37°C, and 45°C for 21 days to obtain straw bio-feed. The acid detergent fiber content in the straw bio-feed was detected.

[0150] The results showed that when the fermentation temperature was 37℃, the acid detergent fiber degradation effect of straw biofeed was the best, so 37℃ was selected as the fermentation temperature ( Figure 16 ).

[0151] (5) Fermentation time: The auxiliary materials were 1% (mass percentage) molasses + ammonium sulfate + urea, the addition amount of crude laccase solution was 5‰ (v / w), and the mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated at a 2% (v / w) inoculation rate. The water content was controlled at 60%-70% for bacterial and enzyme synergistic fermentation. The fermentation temperature was 37°C, and the fermentation time was set to 3 days, 7 days, 14 days, 21 days, and 30 days respectively to obtain straw bio-feed. The acid detergent fiber content in the straw bio-feed was detected.

[0152] The results showed that the fermentation was basically completed at 21 days, and the acid detergent fiber content did not change significantly after 21 days, so 21 days was selected as the fermentation time ( Figure 17 ).

[0153] Therefore, the best fermentation method for preparing straw biofeed using corn straw is as follows: Molasses + ammonium sulfate + urea were used as auxiliary materials in an addition amount of 1% (mass percentage). The crude laccase enzyme solution obtained in Example 7 was mixed with kneaded corn straw at a ratio of 5‰ (v / w). After mixing, 2% (v / w) of a mixture of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated into the straw. The moisture content was controlled at 60% to 70% for anaerobic bacterial enzyme cooperative fermentation. The fermentation temperature was 37°C and the fermentation time was 21 days.

[0154] Example 9: Effect of Inonotus rigidus on the in vivo and in vitro degradation rate of straw biofeed (1) Effect of in vitro degradation rate Before morning feeding, rumen fluid from at least three cows was mixed and preheated (39°C). After filtering through gauze, digestive fluid was prepared at a volume ratio of rumen fluid to artificial rumen nutrient solution of 1:2. CO2 was continuously introduced and stirred. The digestive fluid was dispensed into digestive tubes (60 mL) and quickly placed in a preheated (39°C) water bath shaker. Unfermented corn straw and 3.0 g of the straw biofeed prepared under the optimal fermentation conditions described in Example 8 were used as fermentation substrates and placed into the digestive tubes. The neutral and acidic detergent fiber contents were measured at 0, 4, 8, 12, 24, 48, and 72 hours.

[0155] Before in vitro degradation, the NDF and ADF of corn straw were 68.4% and 38.6%, respectively, while those of the straw biofeed were 58.8% and 31.9%, respectively. This indicates that both NDF and ADF were significantly reduced in the straw biofeed prepared with laccase and lactic acid bacteria. After 72 hours of in vitro degradation, the NDF and ADF of corn straw were 78.5% and 43.7%, respectively, while those of the straw biofeed were 76.0% and 44.7%, respectively, with no significant difference. The weight of the straw residue after degradation was 1.92 g, with a straw degradation rate of 36.0%. The weight of the straw biofeed residue was 1.47 g, with a degradation rate of 51.0%.

[0156] (2) Influence of in vivo degradation rate Weigh 5 g of crushed straw or straw-based biofeed, passed through a 2 mm sieve, and place it into a pre-numbered nylon bag. Set seven time points: 0 h, 6 h, 12 h, 24 h, 36 h, 48 h, and 60 h. Place the nylon bag into the rumen of a cow fitted with a rumen cannula, following the principle of simultaneous placement and point-of-use. At the corresponding time point, remove the nylon bag and rinse it with tap water until the water flowing out of the bag is clear and bright. Dry the nylon bag at 65°C for 48 h, remove it, weigh it, transfer it to a sealed bag, and measure its neutral and acid detergent fiber content.

[0157] Before in vivo degradation, the NDF and ADF of straw were 68.7% and 40.1%, respectively, while those of straw bio-feed were 59.3% and 31.1%, respectively. After 60 hours of in vivo degradation, the NDF and ADF of straw were 76.3% and 44.2%, respectively, while those of straw bio-feed were 75.4% and 42.8%, respectively, with no significant difference. The weight of the straw residue after degradation was 1.70 g, with a straw degradation rate of 43.3%; the weight of the straw bio-feed residue was 1.23 g, with a degradation rate of 59.0%.

[0158] Example 10: Application of straw biofeed in maintaining cattle growth performance and improving apparent digestibility 1. Preparation of straw biofeed and detection of nutritional components Corn straw was shredded, and molasses + ammonium sulfate + urea (mass ratio of 1:1:1) was added as auxiliary materials in an amount of 1% (mass percentage). The crude laccase enzyme solution obtained in Example 7 was mixed with the shredded corn straw at a ratio of 5‰ (v / w). After mixing, 2% (v / w) of a mixed solution of Pediococcus pentosaceus and Pediococcus acidilactici was inoculated into the straw to control the moisture content to 60%-70%. The straw was placed in a feed fermentation bag, sealed with a sealing machine, and fermented with bacteria and enzymes for synergistic fermentation at a fermentation temperature of 37°C. The fermentation was carried out for 21 days to obtain straw biofeed.

[0159] The nutrient changes of the fermented straw feed were detected. The results are shown in Table 2. There were no significant differences in dry matter, crude protein, and crude ash before and after straw feed fermentation, but the contents of neutral detergent fiber and acid detergent fiber decreased significantly (P < 0.05).

[0160] Table 2. Changes in nutritional components of straw feed before and after fermentation

[0161] 2. Animal testing Forty-five healthy, normally developed Angus steers weighing approximately 450 kg were selected for the experiment. They were randomly divided into three groups of 15 steers each according to their weight. Group 1 was the control group (C), which was fed with untreated corn straw as roughage; Group 2 was the silage control group (FC), which was fed with half of the roughage consisting of silage corn straw and half of the roughage consisting of untreated corn straw; and Group 3 was the experimental group (T), which was fed with half of the roughage consisting of the straw biofeed in step (1) and half of the roughage consisting of untreated corn straw. The pre-feeding period was 15 days, and the experimental period was 90 days. During the experimental period, the ratio of concentrate to roughage was 50:50, and the steers were fed once a day in the morning and evening, with an interval of 10 to 12 hours. The experimental concentrate used a mixed concentrate (consisting of corn, corn germ meal, flax cake, stone powder, salt and premix). The formula and nutritional composition are shown in Table 3.

[0162] The test data were analyzed by ANOVA using SPSS 26.0, with multiple comparisons performed using Tukey and Dunnett's method. Graphs were generated using GraphPad 8.0 software. The test data are presented as mean values. P < 0.05 indicated a significant difference, and P > 0.05 was considered no significant difference.

[0163] Table 3. Feed composition and nutritional content of concentrate

[0164] Among them, the premix is ​​a 5% premix specially made for CP beef cattle.

[0165] 1) Effects of straw-based biofeed on growth performance of beef cattle The results are shown in Table 4. During the entire experimental period (1 to 90 days), there were no significant differences in daily weight gain and feed-to-weight ratio between the FC and T groups. However, the T group gained 0.20 kg more per day than the C group, with an average gain of 9.9 kg per head over the experimental period, which has significant economic value. The T group gained 0.12 kg more per day than the FC group. The T group had the highest dry matter intake during the experiment, indicating that the straw biofeed improved the palatability of the feed, making the cattle more willing to eat it. Compared with the C group, the FC and T groups had significantly lower feed-to-weight ratios ( P＜ 0.05). Therefore, the growth performance of beef cattle fed with the straw biological feed in step (1) is significantly better than that of beef cattle fed with untreated straw, and the feed-to-weight ratio is significantly reduced, which has significant economic benefits; and compared with other silage straws, the ADG of beef cattle fed with the straw biological feed in step (1) is also higher and the feed-to-weight ratio is also lower.

[0166] Table 4. Effects of straw biofeed on growth performance of beef cattle

[0167] Note: In Table 4, data in the same row with different shoulder letters indicate significant differences (P < 0.05), while data with the same shoulder letters or no shoulder letters indicate no significant differences (P > 0.05).

[0168] 2) Effect of straw biofeed on apparent digestibility of beef cattle The effects of straw biofeed on the apparent digestibility of nutrients in beef cattle are shown in Table 5. There were significant differences in dry matter, gross energy, and crude fiber between the FC and T groups, and the apparent digestibility was significantly different from that of the C group (P < 0.05). This suggests that the structural changes of corn straw after fermentation with the crude laccase extract of Poria crassa and lactic acid bacteria increased the softness and swelling of the straw, facilitating rumen digestion in beef cattle.

[0169] Table 5. Effects of straw biofeed on apparent digestibility of nutrients in beef cattle

[0170] Note: In Table 5, data in the same row with different shoulder letters indicate significant differences (P < 0.05), while data with the same shoulder letters or no shoulder letters indicate no significant differences (P > 0.05).

[0171] In summary, the present invention demonstrates that the laccase produced by the fungus LFB-F1 is high in yield, has a short fermentation cycle, high laccase yield, and low fermentation cost. The fermented laccase, when used to prepare straw bio-feed, significantly reduces the lignocellulose content in the straw and improves the digestibility and utilization efficiency of the straw bio-feed, providing an effective biotechnology resource and method for the utilization of straw as feed.

[0172] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Psoralea rigida Coriolopsis trogii ) At least one of the following applications of LFB-F1: X1) Application in the preparation of laccase; X2) Application in degradation of lignocellulose; X3) Application in the preparation of biological feed; The hard-haired porphyra ( Coriolopsis trogii ) The deposit number of LFB-F1 in the General Microbiology Center of China Culture Collection Administration is CGMCC No.41779.

2. A method for preparing laccase, characterized in that: The method comprises: utilizing the hard-hidden porphyra ( Coriolopsis trogii ) LFB-F1 was fermented in liquid culture medium to obtain laccase.

3. The method according to claim 2, wherein: The liquid culture medium consists of a solvent and a solute, wherein the solvent is water, and the solutes are starch, peptone, glucose, yeast extract, CuSO4.5H2O, MgCl2 and VB1.

4. The method according to claim 3, wherein: In the liquid culture medium, the solutes and their concentrations are starch 0.5-4 g / 100 mL, peptone 0.25-3 g / 100 mL, glucose 0.5-2 g / 100 mL, yeast extract 0.5-3 g / 100 mL, CuSO4·5H2O 0.01 g / 100 mL, MgCl2 0.005 g / 100 mL, and VB1 0.001 g / 100 mL, respectively, and the pH value is 6.

5.

5. The method according to any one of claims 2 to 4, characterized in that: The fermentation culture is carried out at 25-33°C.

6. The method according to any one of claims 2 to 5, characterized in that: The method further comprises adding an enzyme-producing medium to the liquid fermentation culture.

7. A method for degrading lignocellulose, characterized in that: The method comprises: Coriolopsis trogii ) LFB-F1 or its fermentation liquid is added to straw for cultivation to achieve the degradation of lignocellulose.

8. A method for preparing straw bio-feed, characterized in that: The method comprises: Coriolopsis trogii ) LFB-F1 or its fermentation liquid is added to straw for cultivation to obtain biological feed.

9. A straw bio-feed, characterized by: The straw biological feed is prepared by the method according to claim 8.

10. Use of the straw biological feed according to claim 9 in improving the production performance of ruminants or improving the digestibility and utilization rate of nutrients by ruminants.

Images