Engineering TnpB nuclease and editing system and application thereof
By mutating the amino acid sequence of TnpB nuclease and constructing a mini gene editing system, the editing difficulty caused by the large size of the Streptomyces genome was solved, and efficient gene editing effects were achieved.
Patent Information
- Application Number
- CN202510597504.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-09-23
AI Technical Summary
The Streptomyces genome is large and has a high GC content. The proteins of the existing CRISPR-Cas system are large in size, resulting in low plasmid construction and transformation efficiency, which limits the efficiency and transformation space of Streptomyces gene editing.
Develop engineered TnpB nuclease, optimize amino acid sequence mutations, combine guide RNA and hepatitis D virus ribozyme, and construct a mini gene editing system that utilizes the DNA repair mechanism of Streptomyces for efficient editing.
The efficiency of gene editing in Streptomyces was significantly improved. The editing efficiency of wild-type TnpB was about 8%, while the efficiency of the modified TnpB nuclease in Streptomyces reached 41%, achieving efficient and precise gene editing.
Smart Images

Figure CN120683080A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, in particular to an engineered TnpB nuclease and an editing system and application thereof. Background Art
[0002] Streptomyces is the largest genus of actinomycetes. It is considered to be a group with great development value because it can produce a large number of valuable active secondary metabolites and its genome also contains rich silent biosynthetic gene clusters. Starting from genomic information, the "bottom-up" efficient and high-throughput development of new active secondary metabolites based on the concept of synthetic biology is the mainstream idea of natural product drug research and development. The key lies in having an efficient, accurate and convenient genetic manipulation system. However, due to its large genome (8-10Mb) and high GC content (generally GC content exceeds 70%), Streptomyces is very difficult to perform genetic manipulations such as gene editing compared to other microorganisms, and the means of genetic manipulation are very limited.
[0003] With the development of the CRISPR-Cas gene editing system and its application in Streptomyces, the problem of time-consuming and inefficient gene editing in Streptomyces has been alleviated to a great extent, effectively breaking the bottleneck of the lack of efficient genetic manipulation in the field of Streptomyces. It has become the main gene editing tool currently applicable to Streptomyces, achieving efficient and precise gene editing of the Streptomyces genome, and has been well applied in exploring new secondary metabolites of Streptomyces, increasing secondary metabolic production, and transforming metabolic pathways. However, there are still many problems to be solved in the current gene editing based on the CRISPR-Cas system. For example, the number of amino acids in the Cas9 or Cas12a protein exceeds 1000, that is, the number of nucleotides (pairs) encoding this effector protein is greater than 3000. It is difficult to effectively package so many nucleotides into some delivery systems, thereby affecting plasmid construction and transformation efficiency. The large size of Cas9 / Cas12a also limits the modification space of subsequent editing systems.
[0004] In order to break through the application limitations caused by the large size of proteins such as Cas9, researchers have conducted research and exploration from different directions: through systematic optimization and transformation of the CRISPR-Cas system to overcome shortcomings, such as modifying Cas9, optimizing guide RNA, using Cas9 orthologous enzymes and other measures; exploring the application of new gene editing technologies, such as developing prime editing; developing new CRISPR systems, and exploring and developing compact CRISPR proteins, including CasX (about 980 amino acids), Cas12f (400-700 amino acids), Cas12i (about 1000 amino acids), Cas12Φ (700-800 amino acids), Cas12m (604 amino acids), Cas12I (about 860 amino acids), Casλ (about 800 amino acids), etc. The TnpB protein is a programmable nuclease discovered in transposon systems in recent years. It may be the evolutionary ancestor of Cas12. It can be guided by a long non-coding RNA of approximately 150 nt to cut the DNA sequence near the 5' end of TTGAT. Its size is only about 1 / 3 of that of the Cas protein (about 400 amino acids), and it has attracted much attention from researchers at home and abroad. To date, TnpB nucleases have been successfully applied to endogenous gene editing in multiple species, including human cells, mouse embryos, monocotyledonous and dicotyledonous plants. Researchers have also conducted large-scale, systematic exploration and research on TnpB nucleases that are widely distributed in organisms, and identified a variety of TnpBs with targeted editing activity. Summary of the Invention
[0005] In response to the current lack of mini gene editing tools in Streptomyces, the present invention deeply analyzes the core components and mechanism of action of the small, programmable TnpB nuclease for gene editing, systematically explores potential TnpB nucleases, and through engineering modification, achieves cleavage of the target double strand. The system develops efficient mini gene editing tools suitable for Streptomyces, thereby achieving efficient and precise editing of the Streptomyces genome. The purpose of the present invention is to provide an engineered TnpB nuclease and its editing system and application.
[0006] The object of the present invention is achieved through the following technical solutions:
[0007] In a first aspect, the present invention provides an engineered TnpB nuclease suitable for Streptomyces, wherein the engineered TnpB nuclease has amino acid site mutations including positions 41, 42, 44, 45, 46, 50, 51, 53, 54, 56, 57, 58, 64, 65, 67, 69, 72, 81, 84, 85, 88, 91, 97, and 99 relative to the wild-type TnpB nuclease whose amino acid sequence is shown in SEQ ID NO.1.
[0008] As some specific embodiments of the present invention, the amino acid site mutations include: E41A, S42A, R44K, Q45E, D46S, M50L, I51T, A53G, A54Q, D56S, K57S, A58E, R64Q, E65A, G67E, A69S, Q81N, R84K, D85N, R88T, Q91K, A97V, K99Q; the amino acid sequence of the engineered TnpB nuclease is shown in SEQ ID NO.3.
[0009] As some specific embodiments of the present invention, the nucleotide sequence of the engineered TnpB nuclease is shown as SEQ ID NO.4.
[0010] As some specific embodiments of the present invention, the wild-type TnpB nuclease is a codon-optimized TnpB nuclease that can be expressed in Streptomyces, and its nucleotide sequence is shown in SEQ ID NO.2.
[0011] In a second aspect, the present invention provides an engineered TnpB nuclease-mediated Streptomyces mini-gene editing system, comprising the engineered TnpB nuclease described in any one of the above items, and a guide RNA.
[0012] As some specific embodiments of the present invention, the guide RNA includes an RNA backbone, a gene targeting segment, and a hepatitis delta virus (HDV) ribozyme; and is used to guide the engineered TnpB nuclease to move toward the target sequence.
[0013] As some specific embodiments of the present invention, the RNA backbone is a rationally designed RNA nucleotide sequence of the present invention, and its nucleotide sequence is shown in SEQ ID NO.5; the gene targeting segment is located at the 3' end of the RNA backbone, and is a nucleic acid fragment with a length of 12-40bp after the TAM sequence (5'-TTGAT) on the target gene; the nucleotide sequence of the hepatitis delta virus (HDV) ribozyme is shown in SEQ ID NO.7, which is used to stabilize the RNA backbone-gene targeting segment structure.
[0014] In a third aspect, the present invention provides a recombinant expression plasmid vector for expressing the above-mentioned Streptomyces mini gene editing system.
[0015] In a fourth aspect, the present invention provides a method for constructing a Streptomyces mini gene editing system, comprising: constructing a gene editing plasmid containing an apramycin resistance selection marker, wherein the gene editing plasmid is constructed by inserting the engineered TnpB nuclease and the guide RNA into the Escherichia coli-Streptomyces shuttle plasmid.
[0016] In a fifth aspect, the present invention provides an application of a Streptomyces mini gene editing system in mediating Streptomyces gene editing.
[0017] As some specific embodiments of the present invention, the method for gene editing of Streptomyces using the Streptomyces mini gene editing system comprises the following steps:
[0018] S1. Under non-inducing conditions, the gene-editing plasmid is transformed into the target host. The target gene is edited through the DNA repair mechanism of Streptomyces. Transformants carrying the gene knockout / insertion plasmid are obtained through antibiotic screening for plasmid-related resistance.
[0019] S2. The transformants from step S1 were streaked onto a culture medium plate containing plasmid resistance antibiotics and promoter inducers, and cultured at a constant temperature until a single colony was visible;
[0020] S3. Randomly select the single clones in step S2 and perform colony PCR verification to obtain the edited strain.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] (1) The present invention provides a novel engineered TnpB nuclease. Compared with the corresponding wild-type TnpB, after engineering modification, it can recognize the 5'-TTGAT sequence and achieve efficient editing near the sequence in Streptomyces under the action of rationally designed guide RNA, which has great promotion and application value;
[0023] (2) The present invention provides a novel mini gene editing tool for Streptomyces, its construction method, and application. In Streptomyces, the possibility of wild-type TnpB editing near TTGAT is extremely low (about 8%), but the gene editing efficiency under the action of engineered TnpB is significantly improved, reaching 41%. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:
[0025] Figure 1 The plasmid maps of pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA* constructed in Example 1 are shown; the left figure is the plasmid map of pSTAGE-TnpB* / ωRNA*, and the right figure is the plasmid map of pSTAGE-eTnpB* / ωRNA*;
[0026] Figure 2 The figure shows the PCR electrophoresis results of some randomly selected single clones after endogenous gene editing in Streptomyces using pSTAGE-TnpB* / ωRNA*;
[0027] Figure 3 The figure shows the PCR electrophoresis results of some randomly selected single clones after endogenous gene editing in Streptomyces using pSTAGE-eTnpB* / ωRNA*;
[0028] Figure 4 A comparison of the editing efficiency of endogenous genes in Streptomyces using pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA*;
[0029] Figure 5 This figure shows the Sanger sequencing results of some single clones after endogenous gene editing in Streptomyces using pSTAGE-eTnpB* / ωRNA*. DETAILED DESCRIPTION
[0030] The present invention will be described in detail below with reference to specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those skilled in the art, several variations and improvements can be made without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.
[0031] The present invention uses the model strain Streptomyces coelicolor A3 (2) as the target strain, whose genome sequence number is GeneBank: GCA_008931305.1. The present invention uses SCO5087 (actI), a key gene for actinomycin synthesis in the above strain, as the endogenous gene target, and aims to edit SCO5087 to test the editing efficiency of the present invention.
[0032] Example 1: Construction of an efficient mini gene editing tool in Streptomyces
[0033] 1.1 Plasmid design and construction
[0034] Based on the codon preference of Streptomyces, the TnpB nuclease from Deinococcus radiodurans R1 was codon-optimized and named wild-type TnpB* nuclease. Its amino acid sequence is shown in SEQ ID NO.1, and the codon-optimized gene sequence is shown in SEQ ID NO.2.
[0035] The wild-type TnpB* nuclease was subjected to site-directed mutagenesis at the following sites: E41A, S42A, R44K, Q45E, D46S, M50L, I51T, A53G, A54Q, D56S, K57S, A58E, R64Q, E65A, G67E, A69S, Q81N, R84K, D85N, R88T, Q91K, A97V, K99Q to obtain an engineered TnpB* nuclease (eTnpB*). The amino acid sequence of the engineered TnpB* nuclease (eTnpB*) is shown in SEQ ID NO. 3, and the gene sequence is shown in SEQ ID NO. 4.
[0036] The guide RNA is named ωRNA* and includes the following core elements in the direction from the 5' to the 3' end: an RNA backbone (sequence shown in SEQ ID NO. 5), a gene targeting segment (sequence shown in SEQ ID NO. 6 when targeting SCO5087), and a hepatitis delta virus (HDV) ribozyme (sequence shown in SEQ ID NO. 7).
[0037] The above gene fragments were all synthesized by GenScript Biotech Co., Ltd.
[0038] The wild-type TnpB* and ωRNA* gene fragments synthesized above were used to replace the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 (https: / / doi.org / 10.1021 / acssynbio.5b00038), respectively, to obtain the plasmid pSTAGE-TnpB* / ωRNA*. Figure 1 As shown in the middle left picture.
[0039] The engineered eTnpB* and ωRNA* gene fragments synthesized above were used to replace the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 (https: / / doi.org / 10.1021 / acssynbio.5b00038), respectively, to obtain the plasmid pSTAGE-eTnpB* / ωRNA*. Figure 1 As shown in the middle right picture.
[0040] The constructed plasmids were all subjected to Sanger sequencing to ensure their correctness.
[0041] Example 2: Application of the Streptomyces Efficient Ultra-mini Editing System
[0042] 2.1 Conversion
[0043] The target plasmids pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA* constructed in Example 1 were respectively transformed into Escherichia coli ET12567 / pUZ8002 (https: / / doi.org / 10.1016 / 0378-1119(92)90549-5) as follows:
[0044] 200 ng of plasmids pSTAGE-eTnpB* / ωRNA* and pSTAGE-TnpB* / ωRNA* were added to 100 μL of thawed homemade competent cells E. coli ET12567 / pUZ8002 and the tube wall was gently tapped to mix; after standing on ice for 30 minutes, the tube was incubated in a 42°C water bath for 45 seconds and then immediately placed on ice for 2-3 minutes; then, antibiotic-free LB liquid medium was added and cultured at 200 rpm and 37°C for 1 hour; then, the tube was centrifuged at 5000 rpm for 5 minutes and 900 μL of supernatant was discarded; the cells were resuspended in the remaining culture medium and added to a 50 μg / mL culture medium containing kanamycin (25 μg / mL), chloramphenicol (12.5 μg / mL) and apramycin (50 μg / mL). LB solid plate and gently spread it evenly with a sterile spreader; after overnight culture at 37°C, pick a single colony and culture it in 20 mL of LB liquid medium containing kanamycin (25 μg / mL), chloramphenicol (12.5 μg / mL) and apramycin (50 μg / mL). When the culture OD600 is about 0.4, centrifuge at 5000 rpm for 5 minutes to collect the bacteria; add 20 mL of antibiotic-free LB liquid medium, centrifuge at 5000 rpm for 5 minutes, discard the supernatant, and repeat this step twice; finally, resuspend the bacteria in 2 mL of LB liquid medium.
[0045] 2.2 Binding transfer and resistance screening
[0046] Under non-inducing conditions, the plasmid from step 2.1 was transferred into Streptomyces coelicolor A3(2) by conjugation as follows:
[0047] Take the previously collected Streptomyces spores, centrifuge at 5000rpm for 5 minutes, discard the supernatant, and resuspend the cells in 2mL of 2×YT liquid medium. Place the centrifuge tube containing the spores in a 50℃ water bath for 10 minutes, then pre-germinate in a shaker at 200rpm and 30℃ for 30 minutes; take 500μL of the E. coli culture collected in step 2.1 and place it in a 1.5mL centrifuge tube containing 200μL of Streptomyces spore suspension, swirl and mix thoroughly; take 200μL of the mixture and evenly spread it on a MS plate; incubate the MS plate upside down at 30℃ in a 30℃ incubator. After 18 hours, cover the surface of the culture medium with apramycin (1mg) and nalidixic acid (1mg). After the surface is dry, continue to incubate the MS plate upside down at 30℃ until the conjugates grow (about 5 days). At this point, the successfully edited conjugates are obtained.
[0048] Example 3: Evaluation of gene editing efficiency
[0049] Single clones from step 2.2 were picked and streaked onto ISP2 solid medium containing plasmid-resistant antibiotics and 0.5 μg / mL thiostrepton. The cells were inverted and cultured at 30°C until visible bacteria were observed. A small amount of bacteria was transferred to a PCR tube containing 20 μL DMSO, incubated at 100°C for 15 minutes, and then refrigerated at -20°C for 30 minutes. This step was repeated twice to fully lyse the cells and obtain a cell lysate. The target site fragment was then amplified by PCR using the Novozymes 2× Rapid Taq Master Mix (Cat. No. P222-01) kit. The primer design is shown in Table 1, the PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.
[0050] Table 1 PCR amplification primers targeting SCO5087 (actI)
[0051] Primers Sequence (5'-3') serial number T-SCO5087-F GTCGCCTGCTTCGACGCGAT SEQ ID NO.8 T-SCO5087-R CCTCCAGCGGAACGTAGTCG SEQ ID NO.9
[0052] Table 2 PCR reaction system
[0053] system 15 μL <![CDATA[ddH2O]]> 6.0μL Forward primer (10 μM, SCO5087-LH-F) 0.6μL Reverse primer (10 μM, SCO5087-R) 0.6μL 2×RapidTaqMasterMix 7.5 μL Cell lysis buffer (containing DMSO) 0.3μL
[0054] Table 3 PCR reaction procedure
[0055]
[0056] The editing results of pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA* on the SCO5087 gene of Streptomyces coelicolor A3(2) strain were verified. If the target gene SCO5087 (actI) was successfully edited, the theoretical PCR band size during electrophoresis detection would be different from that of the wild-type Streptomyces coelicolor A3(2) strain or the Sanger sequencing results would be different from those of the wild-type.
[0057] The PCR amplification products of randomly selected monoclonal clones were subjected to 1% agarose gel electrophoresis. The detection results of some monoclonal clones were as follows: Figure 2 and Figure 3 shown. Figure 2 Lane 1-11 and Figure 3 Lanes 1-20 represent some single clones randomly picked after E. coli containing pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA* were combined and transferred with S. coelicolor A3(2), and WT represents the wild-type Streptomyces coelicolor A3(2) strain without gene editing. The results showed that the PCR bands of different sizes existed in the randomly selected resistant strains compared with the wild-type strains, and it can be seen that Figure 3 The proportion of single clones with different band sizes from the wild-type strain was significantly higher than that of Figure 2 .
[0058] Since it relies on the NHEJ repair system of Streptomyces itself, editing can cause insertions or deletions of random fragment sizes. If the size of the randomly picked monoclonal PCR product is different from the wild type, the monoclonal is considered to be successfully edited. Figure 2 The absence of PCR products in Lanes 3 and 4 indicates that the strain was successfully edited, likely due to the deletion of a larger fragment. Whole-genome resequencing of the resistant strains that showed no PCR products confirmed that the target gene SCO5087 (actI) had indeed been successfully edited.
[0059] All the PCR products of single clones randomly picked after the transfer of E. coli of pSTAGE-TnpB* / ωRNA* and pSTAGE-eTnpB* / ωRNA* to S. coelicolor A3(2) were identified by agarose gel electrophoresis, and the identification results were statistically analyzed. Figure 4As shown, the results showed that 8.3% of the single clones in the pSTAGE-TnpB* / ωRNA* editing group had their target gene SCO5087 successfully edited, while in the pSTAGE-eTnpB* / ωRNA* editing group, the proportion of single clones with the target gene SCO5087 successfully edited reached 41.0%, which was significantly improved compared with the pSTAGE-TnpB* / ωRNA* gene editing efficiency. This further proved that the pSTAGE-eTnpB* / ωRNA* plasmid can efficiently edit the target gene SCO5087 (actI) in the Streptomyces model strain S. ceolicolorA3(2).
[0060] The PCR products were purified and recovered using the WeiZan Plasmid Purification Kit (Cat. No. DC201) and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for Sanger sequencing analysis. The Sanger sequencing results of resistant strains #4, #13, and #29 are shown in Figure 5 Medium (resistant strains #4 and #13 correspond to Figure 3 Lane 4 and Lane 13 in Figure 5 The sequencing results further showed that the target gene SCO5087 of the resistant strain was successfully edited compared with the wild-type strain.
[0061] The above results fully demonstrate that the new mini gene editor pSTAGE-eTnpB* / ωRNA* obtained in the present invention can effectively mediate Streptomyces genome editing. The engineered TnpB* nuclease and its Streptomyces mini gene editing system can greatly improve the efficiency of gene editing near TTGAT.
[0062] The culture medium used in the above examples is as follows:
[0063] LB medium: Weigh 10g tryptone, 5g yeast extract, and 10g sodium chloride, dissolve in 1L ddH2O, sterilize at 115°C for 30 minutes, and store at room temperature until ready to use. If preparing solid medium, add 2% agar powder.
[0064] MS medium: Weigh 10 g soybean cake powder, 10 g tryptone, and 10 g agar powder, dissolve in 500 mL tap water, and sterilize at 115°C for 30 min.
[0065] ISP2 medium: Weigh 10 g malt extract, 4 g yeast extract, and 4 g glucose, dissolve in 1 L ddH2O, adjust pH to 7.4, sterilize at 115°C for 30 min, and store at 4°C until used. If preparing solid medium, add 2% agar powder.
[0066] 2×YT medium: Weigh 16 g tryptone, 10 g malt extract, and 5 g sodium chloride, dissolve in 1 L ddH2O, adjust the pH to 7.0, sterilize at 115°C for 30 min, and store at 4°C until use.
[0067] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. An engineered TnpB nuclease suitable for Streptomyces, characterized in that: The engineered TnpB nuclease has amino acid site mutations at positions 41, 42, 44, 45, 46, 50, 51, 53, 54, 56, 57, 58, 64, 65, 67, 69, 72, 81, 84, 85, 88, 91, 97, and 99 relative to the wild-type TnpB nuclease whose amino acid sequence is shown in SEQ ID NO.
1.
2. The engineered TnpB nuclease according to claim 1, characterized in that The amino acid site mutations include: E41A, S42A, R44K, Q45E, D46S, M50L, I51T, A53G, A54Q, D56S, K57S, A58E, R64Q, E65A, G67E, A69S, Q81N, R84K, D85N, R88T, Q91K, A97V, K99Q; the amino acid sequence of the engineered TnpB nuclease is shown in SEQ ID NO.
3.
3. The engineered TnpB nuclease according to claim 2, characterized in that The nucleotide sequence of the engineered TnpB nuclease is shown in SEQ ID NO.
4.
4. An engineered TnpB nuclease-mediated Streptomyces mini-gene editing system, characterized in that: The invention comprises the engineered TnpB nuclease according to any one of claims 1 to 3, and a guide RNA.
5. The Streptomyces mini gene editing system according to claim 4, characterized in that The guide RNA includes an RNA backbone, a gene targeting segment, and a hepatitis D virus ribozyme.
6. The Streptomyces mini gene editing system according to claim 5, characterized in that The nucleotide sequence of the RNA backbone is shown in SEQ ID NO.5; the gene targeting segment is located at the 3' end of the RNA backbone and is a nucleic acid fragment with a length of 12-40 bp following the TAM sequence on the target gene; the nucleotide sequence of the hepatitis D virus ribozyme is shown in SEQ ID NO.
7.
7. A recombinant expression plasmid vector, characterized in that: Used to express the Streptomyces mini gene editing system as described in claim 4.
8. A method for constructing a Streptomyces mini-gene editing system according to claim 4, characterized in that: include: A gene editing plasmid containing an apramycin resistance selection marker is constructed. The gene editing plasmid is constructed by inserting the engineered TnpB nuclease and the guide RNA into the Escherichia coli-Streptomyces shuttle plasmid.
9. An application of the Streptomyces mini gene editing system as described in claim 4 in mediating Streptomyces gene editing.
10. The use according to claim 9, characterized in that The method for mediating Streptomyces gene editing comprises the following steps: S1. Under non-inducing conditions, the gene-editing plasmid is transformed into the target host. Transformants carrying the gene knockout / insertion plasmid are obtained through the DNA repair mechanism of Streptomyces itself and antibiotic screening for plasmid-related resistance. S2. The transformants from step S1 were streaked onto a culture medium plate containing plasmid resistance antibiotics and promoter inducers, and cultured at a constant temperature until a single colony was visible; S3. Randomly select the single clones in step S2 and perform colony PCR verification to obtain the edited strain.