Kiwi fruit tissue specific promoter and application thereof

Abstract

The invention provides a kiwi fruit tissue specific promoter and application thereof, and relates to the technical field of plant genetic engineering, the kiwi fruit tissue specific promoter is a promoter of an MLP (Achv4p27g041965) gene, the nucleotide sequence of the MLP (Achv4p27g041965) gene is as shown in SEQ ID NO: 1, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 2. The application of the specific promoter is to regulate and control the specific expression of a target gene in kiwi fruit tissues. The gene promoter disclosed by the invention can be applied to the specific high expression of kiwi fruit tissues, and can promote the specific expression of downstream genes in the middle development stage and the mature stage of kiwi fruits. When the gene promoter is applied to transgenic engineering, the expression level of the gene can be remarkably improved, the expression product of the target gene can be specifically accumulated in the later development period of the kiwi fruit, and meanwhile, the expression interference in other tissue parts is also avoided, so that the promoter has a good application prospect in the quality improvement and transgenic engineering of the kiwi fruit.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a kiwi fruit tissue-specific promoter and application thereof. Background Art

[0002] Transgenic engineering in plants relies on promoters to drive gene expression. The choice of promoter type determines the timing and location of gene expression, and the strength and specificity of the promoter are crucial factors influencing plant trait improvement. In the past, constitutive promoters, such as the cauliflower mosaic virus (CaMV) 35S promoter (CaMV35s) and the polyubiquitin gene Ubiquitin promoter, were commonly used in transgenic applications to drive expression of downstream genes, enabling target genes to be expressed in specific plant tissues.

[0003] Strong promoters such as CaMV35s and Ubi drive expression, resulting in high levels of target gene expression in all plant tissues. However, plant trait and quality improvement driven by these promoters can often be subject to various negative impacts, such as developmental stage- or tissue-specific limitations on target gene expression, or excessive gene expression levels induced by these constitutive promoters, which can affect plant growth and development. For studying fruit development, fruit-specific promoters such as the PG and E8 promoters have been reported in tomato research. However, the CaMV35s promoter remains the most widely used promoter in kiwifruit molecular breeding, with a lack of fruit-specific promoters. In research aimed at improving fruit quality and traits, target genes driven by these constitutive promoters are expressed not only throughout the fruit but also in all tissues except the fruit. This can interfere with fruit quality improvement to varying degrees and limit research at different stages of fruit development. Summary of the Invention

[0004] (1) Technical problems solved

[0005] In response to the shortcomings of the existing technology, the promoter used in the existing kiwifruit molecular breeding is still the CaMV35s promoter. The CaMV35s promoter will drive expression in all tissue parts including the fruit, resulting in interference with the improvement of fruit quality to a certain extent. The present invention provides a fruit-specific promoter derived from kiwifruit and its application, which solves the technical problem that the existing technology lacks a kiwifruit fruit-specific promoter to regulate the specific expression of the target gene in the kiwifruit fruit tissue.

[0006] (2) Technical solution

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0008] The kiwifruit fruit tissue-specific promoter is the MLP (Achv4p27g041965) gene promoter. The nucleotide sequence of the MLP (Achv4p27g041965) gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the promoter is shown in SEQ ID NO: 2.

[0009] A primer set for amplifying a kiwifruit fruit tissue-specific promoter, the nucleotide sequence of the primer set is shown in SEQ ID NO: 3-4.

[0010] Recombinant vector and Agrobacterium transformation strain of kiwifruit fruit tissue-specific promoter.

[0011] Furthermore, the recombinant vector is a pBI121:GUS vector or a pRI101:RUBY vector;

[0012] The pBI121:GUS vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the GUS gene in the pBI121 vector with the promoter sequence according to claim 1;

[0013] The pRI101:RUBY vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the RUBY gene in the pRI101 vector with the promoter sequence according to claim 1.

[0014] Furthermore, the pBI121:GUS recombinant vector described above was recombined using homologous recombination, and the homologous recombination primers were shown in SEQ ID NOs: 5-6.

[0015] The method for constructing the kiwifruit tissue-specific promoter as described above comprises the following steps:

[0016] Using DNA of kiwi fruit as a template, PCR amplification was performed using the primer set shown in SEQ ID NO: 3-4 to obtain the fruit-specific promoter derived from kiwi fruit.

[0017] The method for verifying transient transformation of kiwifruit comprises the steps of transforming the Agrobacterium transformation strain of the above-mentioned recombinant vector into kiwifruit.

[0018] For example, the application of the above-mentioned kiwifruit tissue-specific promoter or primer set or recombinant vector and Agrobacterium transformation strain to mediate expression and regulate the expression of downstream target genes in kiwifruit fruit.

[0019] Furthermore, the application is specifically to regulate the specific expression of target genes in kiwi fruit tissues.

[0020] Furthermore, the application is more specifically to regulate the high-level specific expression of the target gene in the middle and late stages of kiwi fruit tissue.

[0021] (3) Beneficial effects

[0022] The present invention provides a kiwifruit tissue-specific promoter and its application. Compared with the existing technology, it has the following advantages:

[0023] The present invention cloned the MLP (Achv4p27g041965) gene promoter from kiwifruit. This promoter can be used for high tissue-specific expression in kiwifruit fruit, initiating the specific expression of downstream genes during the mid-development and ripening stages of kiwifruit fruit development. Application of this gene promoter in transgenic engineering can significantly increase gene expression levels, allowing the expression product of the target gene to accumulate specifically in the late developmental stages of kiwifruit while simultaneously avoiding expression interference in other tissues. Therefore, this promoter has promising application prospects in kiwifruit quality improvement and transgenic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The GUS staining diagram of kiwi fruit tissues in Example 2 and Comparative Example 1 of the present invention to verify the promoter activity of each gene, and the blank control diagram of Comparative Example 2;

[0026] Figure A is a GUS staining image driven by the CaMV35s promoter; Figure B is a GUS staining image driven by the MLP gene promoter; Figure C is a blank control image in which the CaMV35s promoter in the pBI121 vector is removed.

[0027] Figure 2 This is a quantitative analysis of the expression level of the MLP (Achv4p27g041965) gene in different tissue parts of kiwifruit in Example 3 of the present invention.

[0028] Figure 3 This is a quantitative analysis diagram of the expression level in fruit tissue driven by different gene promoters in Example 3 of the present invention.

[0029] Figure 4 Specificity verification diagrams of using different gene promoters to drive expression in kiwifruit leaf disk tissue and root tissue respectively in Example 4, Comparative Example 3 and Comparative Example 4 of the present invention;

[0030] Among them, Figure A is a GUS staining verification diagram driven by the CaMV35s promoter; Figure B is a GUS staining verification diagram driven by the MLP gene promoter; Figure C is a blank control diagram in which the CaMV35s promoter in the pBI121 vector is removed.

[0031] Figure 5 This is a visualization diagram of the expression of the RUBY gene driven by the specific MLP gene promoter in kiwi fruit in Example 5 of the present invention;

[0032] Among them, Figure A is a visualization diagram of the expression of the RUBY gene driven by the MLP gene promoter in kiwi fruit; Figure B is a blank control group. DETAILED DESCRIPTION

[0033] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0034] The embodiments of the present application provide a kiwifruit fruit tissue-specific promoter and its application. The CaMV35s promoter is used in the existing kiwifruit molecular breeding. The CaMV35s promoter drives expression in all tissue parts including the fruit, resulting in interference with the fruit quality improvement to a certain extent. The present invention provides a specific promoter derived from kiwifruit fruit tissue and its application, which solves the technical problem of the existing technology that lacks a kiwifruit fruit-specific promoter to regulate the specific expression of the target gene in the kiwifruit fruit tissue.

[0035] In order to better understand the above technical solution, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.

[0036] The kiwifruit variety used in Examples 1 to 4 and Comparative Examples 1 to 4 of the present invention is Actinidia chinensis - Hongyang.

[0037] The kiwifruit variety used in Example 5 of the present invention is Actinidia pubescens - Walter.

[0038] Example 1: Obtaining the Kiwifruit Fruit Tissue-Specific MLP (Achv4p27g041965) Gene Promoter

[0039] 1.1 Primer design

[0040] The MLP (Achv4p27g041965) gene, a gene specifically and highly expressed in the middle and late stages of fruit development, was screened from the Hongyang kiwifruit database. The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The MLP (Achv4p27g041965) gene sequence was obtained and the promoter sequence of the gene was cloned. The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0041] Amplification primers were designed based on the sequence of the kiwifruit MLP (Achv4p27g041965) gene promoter. The upstream primer sequence is shown in SEQ ID NO: 3, and the downstream primer sequence is shown in SEQ ID NO: 4. Specifically, they are as follows:

[0042] Upstream primer (SEQ ID NO: 3): (direction 5'-3')

[0043] proMLP-F: AGCATTACCAAACGGAGCCTCAATC;

[0044] Downstream primer (SEQ ID NO: 4): (direction 5'-3')

[0045] MLP-CDS-R:GATGACAGAGCCAACGGTGC.

[0046] 1.2 PCR amplification

[0047] Perform PCR amplification using the upstream and downstream primers designed in step 1.1 to obtain PCR products.

[0048] PCR reaction system (50 μL): 2× Phanta Flash Master Mix (Dye Plus) 25 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, DNA template 1 μL, ddH2O 21 μL.

[0049] PCR reaction conditions: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 30 s, and 32 cycles.

[0050] The PCR product was recovered by agarose gel electrophoresis. The results showed that a DNA fragment of 2000 bp was obtained by PCR amplification. The nucleotide sequence of the 2000 bp DNA fragment was sequenced as shown in SEQ ID NO.2.

[0051] Example 2: Verification of transient expression of GUS gene driven by specific MLP gene promoter in kiwi fruit tissue

[0052] The promoter sequence of the MLP gene cloned in Example 1 was ligated into the pBI121 vector using homologous recombination to replace the conventional CaMV35s promoter and drive the expression of the GUS gene.

[0053] The sequences of the homologous recombination primers are shown in SEQ ID NO: 5 and SEQ ID NO: 6, and are as follows:

[0054] SEQ ID NO:5: (Direction 5'-3')

[0055] HRSproMLP-F: upstream homology arm 20 bp+AGCATTACCAAACGGAGCCTCAATC;

[0056] SEQ ID NO:6: (Direction 5'-3')

[0057] HRSproMLP-R: downstream homology arm 20bp+CTTTCTTTAGCTACTTATTTCCCA.

[0058] PCR reaction conditions: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 30 s, and 32 cycles.

[0059] After the recombinant plasmid is successfully constructed, it is transferred into Agrobacterium tumefaciens for expression verification. Mark the injection points around the kiwifruit fruit, use a 1mL sterile syringe to draw up the resuspended bacterial solution and inject it into the kiwifruit fruit in the direction of the mark and arrow, so that the Agrobacterium bacteria spread in the fruit. First inject along the direction of the fruit stele, then inject in a circle around the fruit. Insert the syringe needle into the fruit about 4mm to start the injection. After each injection point, wait a few seconds for the bacteria to spread to prevent excessive resuspended bacterial solution from being reflected. Place the injected fruit in a box with moist filter paper on the bottom, cover with plastic wrap to keep it moist, and then transfer it to a light incubator (24℃, 16h light / 8h dark photoperiod) for 3 days of culture.

[0060] Prepare GUS staining working solution, slice the injected fruit along the marked direction, transfer it to GUS staining working solution, place it under negative pressure with a vacuum pump for 10 minutes, and then stain it in a 37°C constant temperature incubator overnight. Observe the staining results and decolorize the next day, take photos and record the results. Figure 1 shown.

[0061] Depend on Figure 1 As can be seen in Figure B, 3 days after transient expression in the fruit, the fruit sections showed strong indigo staining, and the staining was relatively uniform throughout the fruit tissue, with the color in the center of the fruit tissue being darker.

[0062] Comparative Example 1 is different from Example 2 in that:

[0063] The pBI121 vector connected to the CaMV35s promoter sequence to drive GUS gene expression was used as the control group. After staining, the results were as follows Figure 1 As shown in Figure A.

[0064] Depend on Figure 1 As can be seen in Figure A, 3 days after transient expression in the fruit, indigo staining was observed in the fruit slices, but the color was not as obvious as that in Example 2, and the staining was concentrated in the edge area of ​​the fruit tissue.

[0065] Comparative Example 2 is different from Example 2 in that:

[0066] The blank control group was treated with pBI121 vector without CaMV35s promoter, and the results of GUS gene expression staining were shown in Figure 2. Figure 1 As shown in Figure C.

[0067] Depend on Figure 1 As can be seen in Figure C, the fruit tissue is not stained and can be used as a blank control group to highlight Figure 1 A picture in the middle Figure 1 The staining results in Figure B.

[0068] It can be seen from the staining results of Example 2, Comparative Example 1 and Comparative Example 2 that after 3 days of transient expression in the fruit, the pBI121 vector of the recombinant MLP gene promoter sequence can drive the specific expression of the GUS gene in kiwi fruit tissue, and the expression effect is significantly better than that driven by the CaMV35s promoter sequence.

[0069] Example 3: Quantitative analysis of the expression level of the MLP gene in different tissues of kiwifruit

[0070] 1.1 Quantitative analysis was performed on fruit samples, leaves, and root tissues of kiwifruit 30, 120, and 180 days after pollination to verify the expression level of the MLP gene.

[0071] The primer pair for quantitative analysis of MLP gene expression level is shown in SEQ ID NO: 7 and SEQ ID NO: 8:

[0072] SEQ ID NO:7: (Direction 5'-3')

[0073] qRT.MLP-F:GTGGCTCTGTCATCTTCTTCAAAT;

[0074] SEQ ID NO:8: (Direction 5'-3')

[0075] qRT.MLP-R:ATGTCACCGAGTTGTGTTCCC.

[0076] The results of quantitative analysis of gene expression levels were as follows Figure 2 As shown, the expression level of the MLP gene in roots and leaves was extremely low, remaining low until 30 days after pollination. However, the expression level in fruit was approximately 2,000-fold and 200,000-fold higher than that in roots and leaves at 120 and 180 days after pollination, respectively. This indicates that MLP gene expression is fruit tissue-specific and reaches extremely high levels during the late stages of fruit development.

[0077] 1.2 Quantitative analysis of expression levels in fruit tissues driven by different gene promoters

[0078] Quantitative analysis was performed on the kiwifruit tissues of Example 1, Comparative Example 1, and Comparative Example 2 to verify the expression levels of different genes. The results are as follows: Figure 3 shown.

[0079] Figure 3 The quantitative analysis showed that the expression level of the MLP gene promoter in fruit tissue was significantly different from that of the CaMV35s promoter in fruit tissue. The expression activity of the MLP gene promoter was about 3.3 times that of the CaMV35s promoter, indicating that the MLP gene promoter had significantly excellent expression activity in kiwifruit fruit tissue.

[0080] Example 4: Specific verification of MLP gene promoter-driven expression in different tissues of kiwifruit

[0081] The promoter sequence of the MLP gene was homologously recombined into the pBI121 vector to replace the CaMV35s promoter and drive the expression of the GUS gene. The homologous recombination primers were the same as those used in Example 2.

[0082] The vacuum infiltration inoculation method was used. Kiwifruit leaves were cleaned and then punched into 16mm diameter circular discs. These discs were then immersed in an Agrobacterium suspension and transferred to a vacuum pump for three cycles at a negative pressure of 0.08 MPa for 10 minutes, allowing the bacterial solution to penetrate from all sides. The leaves were then decanted with filter paper and transferred to 1 / 2 MS solid culture medium. The discs were then incubated at 24°C under a 16h / 8h photoperiod for three days.

[0083] The kiwifruit tissue was soaked with K599 Agrobacterium carrying the recombinant vector and then transferred to 1 / 2MS medium for hairy root induction.

[0084] In order to confirm the tissue expression pattern of the GUS gene, histochemical staining was performed. The transiently expressed leaf discs and fruit slices and induced hairy roots were immersed in staining buffer under vacuum for 30 minutes and then incubated at 37°C overnight. The staining time was adjusted appropriately according to the size of the tissue sample. After decolorization with ethanol, the samples were observed and photographed. The results are shown in Figure 2. Figure 4 As shown in Figure B.

[0085] Depend on Figure 4 As can be seen from Figure B, the GUS gene expression driven by the MLP gene promoter appears very light indigo in the leaves after leaf disc staining, indicating that the promoter activity in the leaves is extremely low, indicating that the MLP gene promoter has almost no expression activity in the leaves.

[0086] The same staining results as those in leaves were obtained using hairy root-mediated rapid transformation of kiwifruit. The hairy roots showed a very light indigo color, indicating that the promoter activity in the hairy roots was extremely low, indicating that the MLP gene promoter had almost no expression activity in the hairy roots.

[0087] Comparative Example 3 is different from Example 4 in that:

[0088] The pBI121 vector connected to the CaMV35s promoter sequence to drive the GUS gene expression was used as the control group. After staining the leaf disc and hairy roots, the results were as follows: Figure 4 As shown in Figure A.

[0089] Figure 4 Figure A in the middle shows that the CaMV35s promoter has a good gene expression effect in leaf disks and hairy roots. After staining, the leaf disks and hairy roots appear dark indigo, indicating that the CaMV35s promoter has no fruit tissue expression specificity.

[0090] Comparative Example 4 is different from Example 4 in that:

[0091] The blank control group was treated with pBI121 vector without CaMV35s promoter, and the results of GUS gene expression staining were shown in Figure 2. Figure 4 As shown in Figure C.

[0092] from Figure 4 As can be seen in Figure C, the GUS gene without promoter drive is not expressed in the leaf disc and hairy root. The leaf disc and hairy root are not stained and can be used as blank control group, highlighting the Figure 4 A picture in the middle Figure 4 The staining results in Figure B.

[0093] From the staining results of Example 4, Comparative Example 3, and Comparative Example 4, it can be seen that after leaf disc staining, the CaMV35s promoter drives strong GUS expression, resulting in obvious indigo staining. In contrast, the indigo color of the MLP gene promoter is not obvious, indicating that the activity of the MLP gene promoter in the leaves is extremely low.

[0094] The same results were obtained by using hairy root-mediated rapid transformation of kiwifruit. Only the control group with CaMV35s promoter showed obvious GUS staining results, while the MLP gene promoter had almost no expression activity in the roots. Figure 1 The transient expression in fruit tissues indicated that the MLP gene promoter had fruit-specific expression activity.

[0095] Example 5: Visualized expression of the RUBY gene driven by a specific MLP gene promoter in kiwifruit

[0096] The MLP gene promoter sequence was homologously recombined into the pRI101 vector to replace the CaMV35s promoter sequence and drive RUBY gene expression. The steps for transient expression by injection into Actinidia chinensis fruit were the same as in Example 2. After 3 days of expression culture, the kiwifruit was cut open to observe the accumulation of red in the flesh. An empty vector without the CaMV35s promoter was used as a blank control group. The results are shown in Figure 2. Figure 5 shown.

[0097] from Figure 5 It can be seen that red accumulation occurs in kiwifruit fruit tissue and is concentrated in the middle area of ​​the fruit tissue, indicating that the MLP gene promoter has excellent expression activity in fruit tissue.

[0098] In summary, compared with the existing technology, the present invention has the following beneficial effects:

[0099] 1. The present invention cloned the MLP (Achv4p27g041965) gene promoter from kiwifruit. This promoter can be used for tissue-specific high expression in kiwifruit fruit, initiating the specific expression of downstream genes during the mid-development and ripening stages of kiwifruit fruit development. Application of this gene promoter in transgenic engineering can significantly increase gene expression levels, allowing the expression product of the target gene to accumulate specifically in the late developmental stages of kiwifruit while also avoiding expression interference in other tissues. Therefore, this promoter has promising application prospects in kiwifruit quality improvement and transgenic engineering.

[0100] 2. Quantitative analysis of MLP gene expression levels examined early, mid, and late expression in roots, leaves, and fruit. Results showed that MLP gene expression levels were extremely low in roots and leaves, remaining low until 30 days after pollination. However, expression levels in fruit were approximately 2,000-fold and 200,000-fold higher than in roots and leaves at 120 and 180 days after pollination, respectively. This suggests that MLP gene expression is fruit-tissue specific and reaches extremely high levels during the late stages of fruit development.

[0101] 3. Leaf disc staining revealed strong GUS expression driven by the CaMV35s promoter, resulting in intense indigo staining of the leaves. In contrast, the weak indigo staining from the MLP promoter indicated minimal promoter activity in leaves. Similar results were obtained using hairy root-mediated rapid transformation of kiwifruit. Only the control driven by the CaMV35s promoter exhibited significant GUS staining, while the MLP promoter showed virtually no expression activity in roots. Furthermore, transient expression of the MLP promoter in fruit revealed significant color accumulation, demonstrating fruit-specific expression activity.

[0102] 4. After three days of transient expression in fruit, the MLP gene promoter showed more intense indigo staining in fruit sections than the CaMV35s promoter. Quantitative analysis confirmed that the MLP gene promoter activity was approximately 3.3 times that of the CaMV35s promoter, indicating that the MLP gene promoter has superior expression activity in fruit compared to the CaMV35s promoter.

[0103] 5. Gene expression in the fruit driven by the MLP gene promoter produced obvious red accumulation of the RUBY gene product, further demonstrating that the MLP gene promoter has ultra-high level expression activity in fruit tissue.

[0104] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply the existence of any such actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article, or device comprising a series of elements includes not only those elements, but also other elements not explicitly listed, or elements inherent to such process, method, article, or device. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of other identical elements in the process, method, article, or device comprising the element.

[0105] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A kiwifruit tissue-specific promoter, characterized in that: The promoter is the promoter of the MLP (Achv4p27g041965) gene, the nucleotide sequence of the MLP (Achv4p27g041965) gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the promoter is shown in SEQ ID NO:

2.

2. A primer set for amplifying the kiwifruit tissue-specific promoter according to claim 1, characterized in that: The nucleotide sequence of the primer set is shown in SEQ ID NO: 3-4.

3. A recombinant vector and Agrobacterium transformation strain containing the kiwifruit fruit tissue-specific promoter according to claim 1.

4. The recombinant vector according to claim 3, wherein The recombinant vector is a pBI121:GUS vector or a pRI101:RUBY vector; The pBI121:GUS vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the GUS gene in the pBI121 vector with the promoter sequence according to claim 1; The pRI101:RUBY vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the RUBY gene in the pRI101 vector with the promoter sequence according to claim 1.

5. The pBI121:GUS recombinant vector according to claim 4, wherein Homologous recombination was used for recombination, and the homologous recombination primers were shown in SEQ ID NO: 5-6.

6. The method for constructing the kiwifruit tissue-specific promoter according to claim 1, characterized in that: The following steps are involved: The fruit-specific promoter derived from kiwifruit was obtained by using the DNA of kiwifruit as a template and a primer set consisting of the nucleotide sequences shown in SEQ ID NO: 3-4.

7. A method for verifying transient transformation of kiwi fruit, characterized in that: The method comprises the step of transforming the Agrobacterium transformed strain of the recombinant vector according to claim 3 into kiwi fruit.

8. Use of the kiwifruit tissue-specific promoter according to claim 1, the primer set according to claim 2, or the recombinant vector and Agrobacterium-transformed strain according to claim 3 in mediating expression regulation of downstream target genes in kiwifruit.

9. The use according to claim 8, characterized in that Specifically, it is to regulate the specific expression of target genes in kiwi fruit tissues.

10. The use according to claim 9, characterized in that Specifically, it is to regulate the high-level specific expression of the target gene in the middle and late stages of kiwifruit fruit tissues.

Images