Rice MIR398b gene promoter infected and induced by water straw-like dwarf virus and application of rice MIR398b gene promoter

By constructing the MIR398b gene promoter in rice and using the promoter induced by RGSV infection to drive the expression of antiviral genes, the technical problem of rice's lack of resistance to RGSV was solved, and the rice's antiviral ability and yield were enhanced.

CN120683105APending Publication Date: 2025-09-23FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510837617.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

The existing technology lacks effective genes for resistance to Rice Grassy Dwarf Virus (RGSV), resulting in rice diseases seriously affecting rice yield, and there is a lack of major production varieties resistant to RGSV in agricultural production.

Method used

A rice MIR398b gene promoter was constructed, and the MIR398b gene was overexpressed in rice through Agrobacterium-mediated genetic transformation. The promoter induced by RGSV infection was used to drive the expression of antiviral genes to enhance the antiviral ability of rice.

Benefits of technology

It improved rice's resistance to RGSV, enhanced rice's basic antiviral defense ability, balanced the expression of disease-resistance and growth-related genes, and improved rice yield and health traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a rice MIR398b gene promoter infected and induced by a water straw stunt virus and application of the rice MIR398b gene promoter. The nucleotide sequence of the rice MIR398b gene promoter is as shown in SEQ ID NO. 1. Experiments show that the constructed plant expression vector with the rice miR398b gene promoter and the GUS reporter gene is transferred into rice, and the rice miR398b gene promoter can up-regulate the expression of the GUS reporter gene in the rice under the infection induction of the rice straw dwarf virus. The invention has important theoretical and practical meanings for the research on the molecular mechanism of the rice water-resistant straw-like dwarf virus and the molecular breeding of the rice water-resistant straw-like dwarf virus, and has wide application and market prospects in the field of agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention discloses a rice MIR398b gene promoter induced by rice grassy stunt virus infection and its application, belonging to the biotechnology field of plant genetic engineering. The rice MIR398b gene promoter can be activated by rice grassy stunt virus, enhancing miR398-mediated antiviral responses, and can be used to improve plant antiviral traits and other beneficial plant traits mediated by plant genetic engineering technology. Background Art

[0002] Rice (Oryza sativa L.) is the staple food for nearly half of the world's population and one of the most important food crops. Its high and stable yields are crucial to national economy and people's livelihoods and are of great significance. During its growth and development, rice is often threatened by pathogens such as fungi, bacteria, viruses, and nematodes. Viral diseases are difficult to control, and outbreaks often result in harvest failure, making them one of the most devastating rice diseases. Rice grassy stunt virus (RGSV) is a serious rice viral pathogen that primarily affects rice-producing areas in Asia. RGSV infects rice and can cause symptoms such as yellowing, stunting, excessive and ineffective tillering, short and thin leaves, and rust spots, severely impacting rice yield (Shi Chaonan et al., Research Progress on Rice Grassy Stunt Virus, 2018). RGSV is transmitted by the brown planthopper (Brown Planthopper) through a persistent transmission mechanism and is a major viral disease in rice-producing areas in Asia. It also occurs frequently in areas such as Hainan and Fujian in my country. In agricultural production, the selection of high-tillering, semi-dwarf rice varieties and excessive nitrogen fertilizer application promote the growth of brown planthopper (NLP), creating a favorable environment for the spread of RGSV. Global warming is affecting the migratory range of NLP, increasing the potential threat of RGSV spreading to high-latitude rice-producing areas (Widiarta I Nyoman et al., Rice virus disease in Indonesia: epidemiology and varietal resistance, 2025). Currently, no major antiviral genes targeting RGSV have been reported, and agricultural production lacks key RGS V-resistant varieties. Previous studies have found that the RGSV-encoded virulence protein P3 interacts with rice OsP3IP1, degrading RNA polymerase IV (Pol IV) through ubiquitination, resulting in symptoms of increased dwarf tillering (Zhang Chao et al., A bunyavirus-inducible ubiquitin ligase targets RNA polymerase IV for degradation during viral pathogenesis in rice, 2020). Therefore, OsP3IP1 is a potential recessive disease resistance target and has application value in RGSV-resistant breeding. RNA interference (RNAi) technology-mediated antiviral pathways are a highly effective and conservative antiviral strategy that can achieve effective control of RGSV by targeting viral gene sequences to induce specific gene silencing.Previous studies have shown that heterologous overexpression of the reverse complement of the RNA fragment of the RGSV coat protein gene (pC5) in rice varieties significantly inhibits viral replication and enhances rice resistance to RGSV (Xie Huiting et al., Development of marker-free transgenic rice exhibiting stable and enhanced resistance to rice ragged stunt virus and rice grassy stunt virus via RNA interference, 2024). RNAi-mediated antiviral mechanisms rely on the RNA-induced silencing complex (RISC), in which small RNA molecules (21-24 nucleotides (nt)) in length recognize their targets through sequence complementarity. MicroRNAs (microRNAs), an important class of small RNAs, are widely involved in rice-virus interactions and play a crucial role in viral pathogenesis and rice antiviral resistance (Zhang Baogang et al., A resource for functional investigation of miRNAs in rice responses to viral infection, 2024). In the interaction between rice and rice stripe virus (RSV), the copper-related miRNA (Cu-miRNA), miR528, influences reactive oxygen species (ROS) levels in rice by regulating ascorbate oxidase (OsAO), thereby modulating rice resistance to the virus (Wu Jianguo et al., ROS accumulation and antiviral defense control by microRNA528 in rice, 2017). miR398b, also a Cu-miRNA, targets multiple superoxide dismutases, promoting hydrogen peroxide production and enhancing rice resistance to rice blast disease (Li Yan et al., OsAO-miR398b boosts H2O2 production and rice blast disease resistance via multiple superoxide dismutases, 2019). Recent studies have shown that RGSV infection induces the accumulation of miR398b, and overexpression of MIR398b enhances rice resistance to RGSV. These results suggest that miR398b may participate in rice's antiviral defense against RGSV by regulating ROS levels.

[0003] Plant promoters are usually located upstream of the 5' end of genes. They regulate the spatiotemporal expression pattern of genes by binding to transcription factors and are one of the core regulatory elements in plant molecular biology research. According to the expression characteristics of promoters, promoters can be divided into three categories: constitutive, tissue-specific, and induced expression. Among them, inducible promoters have important application value in plant disease resistance breeding because they can respond to external signals (such as biological and abiotic stresses) to activate downstream gene expression. Inducible promoters can avoid the energy waste caused by constitutive promoter expression, avoid the adverse effects of overexpressed proteins, meet the needs of specific responses, and have important application value. By cloning antiviral genes and promoters that respond to viral infection, virus-induced expression promoters are used to drive antiviral gene expression, thereby activating downstream antiviral defense reactions, which can be used for rice antiviral breeding. Precisely manipulating the expression of virus-responsive miRNAs can not only sense viral infection and activate antiviral defense responses mediated by RNAi, reactive oxygen species, plant hormones, and pathogenesis-related proteins, thereby enhancing the basic resistance of rice; it can also balance rice disease resistance and yield by coordinating the expression of disease-resistance and growth-related genes. Summary of the Invention

[0004] The purpose of the present invention is to provide a rice MIR398b gene promoter induced by rice grassy stunt virus infection and application thereof.

[0005] To achieve the above object, the present invention adopts the following technical solutions: A first aspect of the present invention provides a rice MIR398b gene promoter induced by rice grassy stunt virus infection. The nucleotide sequence of the rice MIR398b gene promoter is shown in SEQ ID NO.1.

[0006] The second aspect of the present invention provides a recombinant expression vector comprising the rice MIR398b gene promoter; Furthermore, the recombinant expression vector contains a target gene, and the expression of the target gene is controlled by the rice MIR398b gene promoter.

[0007] The third aspect of the present invention provides the use of the rice MIR398b gene promoter and recombinant expression vector in regulating the expression of a target gene; Furthermore, the regulation of target gene expression is the regulation of rice strawy stunt virus infection-induced expression of the target gene; Furthermore, the application method is: introducing a recombinant expression vector containing the rice MIR398b gene promoter and the target gene into rice through Agrobacterium-mediated genetic transformation to obtain transgenic rice in which the expression of the target gene is induced by rice grassy stunt virus infection.

[0008] The fourth aspect of the present invention provides the use of the rice MIR398b gene promoter and recombinant expression vector in improving the resistance of rice to rice grassy stunt virus.

[0009] The fifth aspect of the present invention provides the use of the rice MIR398b gene promoter and recombinant expression vector in cultivating transgenic rice resistant to rice grassy stunt virus.

[0010] The sixth aspect of the present invention provides the use of the rice MIR398b gene promoter and recombinant expression vector in the study of the molecular mechanism of rice resistance to rice grassy stunt virus.

[0011] The seventh aspect of the present invention provides the use of rice overexpressing the MIR398b gene in improving rice resistance to rice grassy stunt virus and cultivating transgenic rice resistant to rice grassy stunt virus. The miRBase library accession number of the rice MIR398b gene is MIMAT0000983.

[0012] The significant advantages of the present invention are: The present invention utilizes transgenic rice materials overexpressing the MIR398b gene to demonstrate that miR398b enhances rice resistance to RGSV. Furthermore, RGSV infection induces the expression of the MIR398b gene, increasing its accumulation. By constructing transgenic rice lines in which the MIR398b gene promoter drives the GUS reporter gene, the present invention discovered that the MIR398b gene promoter exhibits enhanced induction activity following RGS V infection. This provides a rice virus-inducible promoter for breeding virus-resistant rice. This promoter can be constructed into various plant expression vectors and used as a manipulation target to improve plant antiviral traits and other beneficial production traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : A shows typical symptoms of rice infected with RGSV; B shows the accumulation of mature miR398b detected by real-time quantitative PCR; C shows the accumulation of mature miR398b detected by Northern blot.

[0014] Figure 2 : A is a schematic diagram of the pCAMBIA1305.1-MIR398bpro-GUS vector; B is the PCR identification of T0 generation transgenic positive rice, where WT is the wild type rice Zhonghua 11; C is the GUS staining result of T0 generation transgenic positive rice.

[0015] Figure 3A shows the GUS staining results of pCAMBIA1305.1-MIR398bpro-GUS transgenic rice; B shows the GUS expression level of pCAMBIA1305.1-MIR398bpro-GUS transgenic rice detected by real-time fluorescence quantitative PCR. Mock refers to rice not infected with RGSV, and RGSV-infected refers to rice infected with RGSV.

[0016] Figure 4 : A shows the phenotypes of MIR398b-overexpressing rice and wild-type rice infected with RGSV; B shows the accumulation of RGSV pC5 gene nucleic acid in MIR398b-overexpressing rice and wild-type rice infected with RGSV detected by real-time fluorescence quantitative PCR; C shows the accumulation of RGSV pC5 protein in MIR398b-overexpressing rice and wild-type rice infected with RGSV detected by Western blot. DETAILED DESCRIPTION

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0018] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0019] Rice (Oryza sativa L.) varieties Zhong Hua 11 (ZH11) and Kasalath are available to the public from Fujian Agriculture and Forestry University.

[0020] Rice grassy stunt virus (RGSV) is publicly available from Fujian Agriculture and Forestry University.

[0021] The EHA105 strain, pCAMBIA1305.1 vector, and pCAMBIA2300-ACTIN1 vector are available to the public from Fujian Agriculture and Forestry University.

[0022] Example 1: 1. Preparation of Rice Infected with RGSV Kasalath rice plants at the 3-4 leaf stage were fed with RGSV-carrying brown planthoppers, while kasalath rice plants at the 3-4 leaf stage were fed with non-toxic brown planthoppers as controls. After 4 weeks of cultivation in a glass greenhouse under controlled temperature and humidity (12 hours of light at 28 degrees Celsius, 12 hours of darkness at 25 degrees Celsius, and 75% humidity), the plants were transplanted to the field and observed for typical RGSV disease symptoms. Typical RGSV disease symptoms include Figure 1 As shown in A.

[0023] 2. Fluorescence quantitative PCR detection of miR398b accumulation Aerial tissue from rice plants cultured in a greenhouse for four weeks was obtained and ground in liquid nitrogen. Total RNA was extracted using TRIzol Reagent. After determining the RNA concentration, 1 μg of total RNA was extracted and processed according to the instructions of the First-Strand SynthesisMaster Mix Reverse Transcription Kit from Lamblide. Using a conventional reverse transcription system, 0.5 μL of 10 μM miR398b-specific reverse transcription primer, miR398b-RT (5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGGG-3'), was added. cDNA was obtained after reverse transcription and diluted fivefold to serve as a template for fluorescent quantitative PCR. According to the instructions of Kangrun Bio's 2× Real Star Fast SYBR qPCR Mix, the fluorescent quantitative primers miR398b-qF (5'-CGCGTGTGTTCTCAGGTCG-3') and miR398b-qR (5'-AGTGCAGGGTCCG AGGTATT-3') were used to quantitatively detect mature miR398b (miRBase library accession number: MIMAT0000983). The amplification products of the fluorescent quantitative primers U6-qF (5'-CGATAAAATTGGAACGATACAGA-3') and U6-qR (5'-ATTT GGACCATTTCTCGATTTGT-3') of rice U6 were used as internal references. -△△CT The results are shown in Figure 2. Figure 1 As shown in B, the accumulation of miR398b was significantly increased in kasalath rice infected with RGSV.

[0024] 3. Northern blot assay to detect the accumulation of miR398b in rice Using the uninfected and RGSV-infected Kasalath rice leaves obtained in step 2 as experimental materials, approximately 2 g of young rice leaves were thoroughly ground into a fine powder in liquid nitrogen. Total RNA was extracted using TRIzol Reagent and used to extract small molecule RNA after concentration determination. Total RNA was mixed with 5 M NaCl and 30% PEG8000 (15 g of powder dissolved in 50 mL of DEPC water), and small RNA was extracted and concentrated by ethanol precipitation. The concentration was determined and then used for later use. A 15% urea-polyacrylamide denaturing gel was prepared, and then 10-20 μg of small RNA was taken and electrophoresed at a constant voltage of 300 V in 0.5X TBE electrophoresis buffer until the bromophenol blue was about 2 cm from the edge of the gel. The nucleic acid in the gel was then transferred to a PVDF membrane using a 300mA current transfer for 45 minutes, UV crosslinked twice, pre-hybridized for 1-2 hours, and the membrane was divided into two parts near the upper dye band. The lower part was added with a 5'-biotin-labeled miR398b probe (5'-CAGGGGCGACCTGAGAACA CA-3'), and the upper part was incubated with a biotin-labeled U6 probe (5'-TTCCCGATCGGTCACCCATCCCAAAAT TGCT-3'). Hybridization was carried out overnight (approximately 16-24 hours), and the membrane was washed and developed in a chemiluminescence imager. The accumulation of miR398b in rice after infection with RGSV was compared. The results are shown in Figure 3. Figure 1 As shown in Figure C, the accumulation of miR398b in rice infected with RGSV was significantly higher than that in rice not infected with RGSV.

[0025] Example 2: 1. Design primers for amplification of the MIR398b gene promoter The keyword Osa-miR398b (referred to as Pre-miR398b) was searched on the miRBase (https: / / www.mirbase.org / ) website, and the accession number MI0001052 was obtained, and its sequence was obtained, with a length of 88 nt: 5'-GGAGUUCCUACAGGGGCG AGCUGGGAACACACGGUGAUGAGGCGGUCUGGUCUUUCGUGUGUUCUCAGGUCGCCCCUGCCGGGACUCU-3'; among them, mature miR398b was generated from pre-miR398b, and the accession number of mature miR398b was MIMAT0000983, and its sequence was obtained, with a length of 21 nt: 5'-UGUGUUCUCAGGUCGCCCC UG-3'. The U base in the sequence of Pre-miR398b was replaced with T, and this was used as a template for alignment. The BLAST function was used on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to analyze its location in rice. The results showed that Pre-miR398b was located at 14598617-14598704 on chromosome 7 of the genome of the rice variety Nipponbare. The candidate promoter region of Pre-miR398b (SEQ ID NO. 1) extending 2175 nt upstream was located at 14596442-14598616 on chromosome 7 of the genome of the rice variety Nipponbare. Using the sequence of Chr7: 14596442-14598616 as a template, fusion primers for PCR amplification were designed, wherein the front primer was promiR398b-2175F and the rear primer was promiR398b-R. The sequences homologously recombined with the pCAMBIA1305.1 vector are represented by lowercase letters, and the underline represents the restriction site.

[0026] promiR398b-2175F:5'-gagctcggtacccgg ggatcc TGCTGGTAGACATCCCGCT-3' promiR398b-R:5'-ttaccctcagatcta ccatgg CTCGCGTTCCATCTCTCTGT-3' 2. Cloning of the MIR398b gene promoter The extracted Nipponbare rice genome was used as a PCR template, the promiR398b-2175F and promiR398b-R primers designed above were used, and the high-fidelity DNA polymerase phanta was added. After PCR reaction, a DNA fragment with a size of ~2kb was amplified. After sequencing confirmed to be the correct target band, it was recovered for future use.

[0027] 3. Use homologous recombination technology to construct a vector for the expression of GUS reporter gene driven by MIR398b gene promoter. The pCAMBIA1305.1 vector carrying GUS reporter gene was double-digested with restriction endonucleases BamHI and NcoⅠ, and the large fragments in the digestion products were recovered by gel cutting. Then, the vector and the target bands of the two clones were recovered by enzyme cutting according to the method of Nanjing Novozyme Biotechnology Co., Ltd. Homologous recombination was performed according to the Ultra One Step Cloning Kit instructions. The reaction products were further transformed into Escherichia coli DH5α by heat shock and plated on LA plates with kanamycin resistance. The obtained monoclonal colonies were verified by colony PCR. Positive colonies were screened and shaken to extract plasmids. The plasmids were sent to a biological company for sequencing. The plasmid with the MIR398b gene promoter sequence (SEQ ID NO. 1) inserted at the restriction site without changing the vector sequence was obtained. It was used as the vector for subsequent genetic transformation and was represented by pCAMBIA1305.1-MIR398bpro-GUS. The map is shown in Figure 1. Figure 2 A.

[0028] Example 3: 1. The pCAMBIA1305.1-MIR398bpro-GUS vector obtained in Example 2 was transformed into rice callus with a Zhonghua 11 genetic background by Weimi Biotechnology (Jiangsu) Co., Ltd. using Agrobacterium (EHA105)-mediated genetic transformation technology. T0 generation transgenic plants were obtained after differentiation and rooting. PCR analysis was performed using primers specifically paired with the vector and the GUS coding region to obtain T0 generation transgenic positive rice ( Figure 2 B).

[0029] 2. GUS staining of T0 generation transgenic positive rice Take the root, stem, leaf and other tissues of T0 generation positive transgenic rice at the tillering stage with a length of about 2 cm, and immediately put them into 90% (volume fraction) acetone fixative for fixation, and fix them on ice for 1 hour; pour out the acetone, add GUS cleaning solution (50mM sodium phosphate buffer (pH7.0), 10mM EDTA, 2mM potassium ferrocyanide), let the leaves soak in the GUS cleaning solution, vacuum on ice for 10 minutes, and repeat three times; after pouring out the GUS cleaning solution, add GUS staining solution (50mM sodium phosphate buffer (pH7.0), 10mM EDTA, 2mM potassium ferrocyanide, 1mM potassium ferrocyanide, 1mg / mL X-gluc), let the rice leaves immerse in the GUS staining solution, vacuum for 20 minutes, and then stain overnight in the dark; after the staining is completed, use 70% (volume fraction) ethanol solution to completely decolorize, observe the staining of the leaves under a stereo microscope, and take pictures. Figure 2As shown in Figure C, the experiment found that relatively weak GUS staining could be observed in the roots, stems and leaves of the T0 generation rice, and the transgenic positive rice expressing GUS was selected for subsequent experiments.

[0030] Example 4: 1. RGSV infection mediated by rice brown planthopper The T0 generation positive transgenic rice seeds of pCAMBIA1305.1-MIR398bpro-GUS obtained in Example 3 were cultured in a greenhouse with 12 hours of light (28 degrees Celsius) and 12 hours of darkness (25 degrees Celsius) for approximately 2 weeks after germination, at which time the rice was approximately in the 3-leaf stage; the cultured rice was co-incubated with brown planthoppers carrying RGSV for 3 days, and RGSV was transmitted by the brown planthoppers, completing brown planthopper-mediated RGSV transmission; thereafter, the rice was cultured for a further 3 weeks, and the expression level of GUS in the rice was detected.

[0031] 2. Analysis of the effect of RGSV on GUS color reaction The rice samples obtained in 1 were stained with the GUS staining method in Example 3, and the leaves of the T1 generation pCAMBIA1305.1-MIR398bpro-GUS transgenic rice were stained as shown in FIG. Figure 3 As shown in A, the leaves of transgenic rice not infected with RGSV were stained lighter in blue, while the leaves of transgenic rice infected with RGSV were stained darker in blue, indicating that the MIR398b gene promoter is activated by RGSV infection, driving GUS expression.

[0032] 3. Comparative analysis of GUS expression in rice by qRT-PCR Referring to the method in Example 1, the total RNA of the pCAMBIA1305.1-MIR398bpro-GUS transgenic rice infected with RGSV in 1 was extracted, and the total RNA of the pCAMBIA1305.1-MIR398bpro-GUS transgenic rice infected with RGSV was extracted according to the method of Nanjing Novozyme Biotechnology Co., Ltd. Reverse transcription was performed according to the instructions of the 1st Strand cDNA Synthesis Kit (gDNA wiper). After the reverse transcription product was diluted 5 times, the expression level of GUS (GUS-qF and GUS-qR) was detected by fluorescence quantitative PCR. The fluorescence quantitative primers of ACTIN in rice (ACTIN-qF and ACTIN-qR) were used as internal references, and the transgenic rice not infected with RGSV was used as the control. -△△CT The results are shown in Figure 2. Figure 3 As shown in B, the accumulation of GUS in pCAMBIA1305.1-MIR398bpro-GUS transgenic rice increased significantly after infection with RGSV.

[0033] GUS-qF: 5'-TCATCCTCTGGGAACCACTGAA-3' GUS-qR: 5'-CATCACATTGCTCGCTTCGTTA-3' ACTIN-qF: 5'-GAGATCACTGCCTTGGCTCC-3' ACTIN-qR: 5'-CGATAACAGCTCCTCTTGGC-3' Example 5: 1. RGSV infection mediated by rice brown planthopper Referring to the method of RGSV infection of rice in Example 4, transgenic rice overexpressing MIR398b (OX398b, from Li Yan et al., Osa-miR398b boosts H2O2 production and rice blast disease-resistance via multiple superoxide dismutases, 2019) and wild-type kasalath rice were inoculated with RGSV to observe their symptoms and virus accumulation. The results are as follows Figure 4 As shown in the figure, it can be seen that the rice with excessive accumulation of miR398b has milder disease symptoms ( Figure 4 A).

[0034] 2. qRT-PCR comparative analysis of RGSV pC5 expression in rice Extract total RNA from rice 1 according to the method of Nanjing Novozyme Biotechnology Co., Ltd. The reverse transcription was performed according to the instructions of the 1st StrandcDNA Synthesis Kit (gDNA wiper). After the reverse transcription product was diluted 5 times, the expression level of RGSV pC5 (PC5-qF: 5'-TTTGTCAACCTGGCTATGGA-3' and PC5-qR: 5'-TGTTACTTTGTGTCCCCTGC-3') was detected by fluorescence quantitative PCR. The fluorescence quantitative primers of ACTIN in rice (ACTIN-qF and ACTIN-qR) were used as internal references, and the transgenic rice not infected with RGSV was used as the control. -△△CT The results are shown in Figure 2. Figure 4 As shown in B, the accumulation of pC5 in OX398b is less than that in wild-type rice.

[0035] 3. Comparative analysis of RGSV pC5 protein accumulation in rice by Western blot The whole aerial rice tissue of wild-type kasalath and OX398b transgenic rice, both uninfected and infected with RGSV, was taken from step 1 and thoroughly ground into a fine powder in a liquid nitrogen-chilled mortar. Protein was then added to a 2X SDS buffer (100 mM Tris-HCl (pH 6.8), 4% SDS (mass fraction), 20% (volume fraction) glycerol, 0.2% bromophenol blue (mass fraction), 1% β-mercaptoethanol) at a mass ratio of approximately 1:1. The mixture was vortexed to dissolve the protein. The sample was heat-treated at 95°C for 10 minutes and centrifuged at 13,000 rpm for 5 minutes. The supernatant was collected to obtain total protein. The extracted protein was separated by SDS-PAGE electrophoresis and then transferred to a PVDF membrane using a semi-dry transfer apparatus. The membrane was blocked with 5% skim milk powder for 1 hour, and the corresponding primary antibody was added. The membrane was incubated at room temperature for 1 hour and washed with TPST three times for 5 minutes each. The secondary antibody was added, incubated at room temperature for 1 hour, and then developed on a chemiluminescence imager. The pC5 primary antibody was a peptide rabbit antibody prepared by Nanjing Zhongding Biotechnology Co., Ltd., and the target band detected by RGSVP5V-1:NH2-LTEK NKIVNKVSTKC-CONH2 was between 35 and 40 kD. The ACTIN primary antibody used was the Plant-actin Rabbit Polyclonal Antibody produced by Beijing Huaxing Broad Gene Technology Co., Ltd.; the secondary antibody used was the Goat Anti-Rabbit IgG (H+L), HRP Conjugate. The results are as follows Figure 4 As shown in C, the accumulation of pC5 in OX398b is less than that in wild-type rice.

[0036] The above descriptions are only some embodiments of the present invention and do not limit the scope of protection of the present invention. Any equivalent device or equivalent process transformation made by using the contents of the present invention description and drawings, or directly or indirectly applied in other related technical fields, are also included in the scope of protection of the present invention.

Claims

1. A rice plant induced by rice grassy stunt virus infection MIR398b A gene promoter, characterized in that: The rice MIR398b The nucleotide sequence of the gene promoter is shown in SEQ ID NO.

1.

2. A method comprising the rice according to claim 1 MIR398b Recombinant expression vector of gene promoter.

3. The recombinant expression vector according to claim 2, characterized in that: The recombinant expression vector contains a target gene, which is derived from rice MIR398b Gene promoters control expression.

4. The rice according to claim 1 MIR398b Use of a gene promoter and the recombinant expression vector according to claim 2 in regulating the expression of a target gene.

5. The use according to claim 4, characterized in that: The regulating target gene expression is regulating the expression of the target gene by inducing infection with rice strawy stunt virus.

6. The use according to claim 5, characterized in that: Will contain rice MIR398b The gene promoter and the recombinant expression vector of the target gene are introduced into rice through Agrobacterium-mediated genetic transformation to obtain transgenic rice in which the expression of the target gene is induced by rice grassy stunt virus infection.

7. The rice according to claim 1 MIR398b Use of a gene promoter and the recombinant expression vector according to claim 2 in improving the resistance of rice to rice grassy stunt virus.

8. The rice according to claim 1 MIR398b Use of a gene promoter and the recombinant expression vector according to claim 2 in cultivating transgenic rice resistant to rice grassy stunt virus.

9. The rice according to claim 1 MIR398b Application of a gene promoter and the recombinant expression vector according to claim 2 in the study of the molecular mechanism of rice resistance to rice grassy stunt virus.

10. Overexpression Rice MIR398b The invention relates to an application of a gene for improving resistance of rice to rice grassy stunt virus and cultivating transgenic rice resistant to rice grassy stunt virus, characterized in that: The rice MIR398b The miRBase accession number of the gene is MIMAT0000983.