Plant source circadian rhythm promoter and application

By introducing the circadian rhythm promoters P2, P3, P4 and P6 into rice, tobacco and Arabidopsis, the problem of differential expression during day and night in genetic engineering was solved, the light intensity of self-luminous plants was improved, and new promoter resources and breeding tools were provided.

CN120683109APending Publication Date: 2025-09-23HUAZHONG AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510873762.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-26
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

In the existing technology, there is little research on circadian rhythm promoters, which makes it difficult to achieve precise day and night differential expression of genes in genetic engineering and molecular breeding. The insufficient light intensity of self-luminous plants limits their application in genetic engineering and molecular breeding.

Method used

A plant-derived circadian rhythm promoter is proposed, including P2, P3, P4 and P6 promoters with nucleotide sequences shown in SEQ ID NOs: 1-4, which are used to drive differential expression of genes during the day and night in rice, tobacco and Arabidopsis. A fluorescent protein gene expression vector is constructed through Agrobacterium tumefaciens-mediated genetic transformation method, and plants in which the fluorescent protein gene is expressed in a dark-induced manner are cultivated.

Benefits of technology

It has achieved differential day and night expression of genes in rice, tobacco and Arabidopsis, provided new promoter resources for specific expression, improved the light intensity of self-luminous plants, and provided new tools for genetic engineering and molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683109A_ABST
    Figure CN120683109A_ABST
Patent Text Reader

Abstract

The invention discloses a plant source circadian rhythm promoter and application, circadian specific rhythm promoters P2, P3, P4 and P6 with nucleotide sequences as shown in SEQ ID NO: 1-4 are identified and can be applied to driving reporter gene expression in rice, tobacco and arabidopsis thaliana, molecular biology experiments show that the promoters P2, P3, P4 and P6 can drive genes to perform circadian differential expression, and the promoters P2, P3, P4 and P6 can be applied to driving reporter gene expression in rice, tobacco and arabidopsis thaliana. A novel specific expression promoter resource is provided for gene engineering and molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, in particular to a plant-derived circadian rhythm promoter and its application. Background Art

[0002] Promoters are non-coding sequences that bind to transcription factors, thereby controlling gene activity. As crucial components in regulating gene transcription, the structure, function, and mode of action of a significant number of promoters have been fully characterized and extensively applied in genetic engineering. Currently, most commonly used promoters are constitutive, inducible, and tissue-specific. However, with the rapid advancement of synthetic biology, the discovery, identification, and application of specialized promoters for precise regulation of gene expression are urgently needed.

[0003] With the advancement of genetic engineering, our understanding of promoters has deepened. In eukaryotes, there are three types of RNA polymerases, each of which binds to a different promoter to direct transcription. Promoters primarily consist of two parts: a core promoter and upstream and downstream cis-acting elements. A full-length promoter generally covers a sequence of about 2000 nt upstream of the transcription start site; a core promoter is the shortest promoter fragment that can meet the basic transcription initiation function and is the smallest unit for a promoter to perform its basic duties. A core promoter is generally about 80 nt in length, covering about 40 nt upstream and downstream of the transcription start site. A core promoter is composed of elements such as the TATA-box, Initiator (Inr), BRE (TFIIB Recognition Element), DPE (Downstream core Promoter Element), MTE (MotifTen Element), XCPE1 (X Core Promoter Element 1), DCE (Downstream Core Element), and UPE (Upstream Promoter Element). These elements are core conserved elements but do not appear in every core promoter.

[0004] Currently, promoters can be simply categorized into four types based on their mode of action and function: constitutive promoters, inducible promoters, tissue-specific promoters, and specialized promoters. Each classification broadly reflects the distinct characteristics of a promoter; in specific cases, one type of promoter may also possess characteristics of other types. Circadian promoters are promoters whose cis-acting elements are responsive to light and temperature stimuli. As environmental conditions change throughout the day, circadian promoters can drive the expression of target genes to oscillate with a 24-hour period. Currently, research on circadian promoters is limited, and circadian promoters are generally described and summarized from the perspective of the overall circadian clock, as part of the circadian clock network.

[0005] Plants that glow in the dark hold great promise. Although bioluminescence is a highly convenient marker for gene expression, plant bioluminescence still relies on externally supplied substrates. However, Krichevsky et al. achieved expression of a bioluminescence system in chloroplasts, producing plants capable of self-luminescence. This work demonstrated that complex metabolic pathways in prokaryotes can be reconstructed and function in plant chloroplasts, and that transgenic plants can emit light visible to the naked eye (Krichevsky et al. 2010). However, due to the low output light intensity, self-luminous plants expressing bacterial bioluminescent gene clusters in plastids have not been widely adopted. Mitiouchkina T et al. applied a fungal bioluminescence system to tobacco plants, converting caffeic acid (present in all plants) into luciferin, and reported self-sustaining luminescence visible to the naked eye (Mitiouchkina et al. 2020). Subsequently, a team led by Researcher Du Hao from the College of Agriculture and Biotechnology at Zhejiang University successfully created plants with enhanced bioluminescence, achieving a luminescence intensity more than fivefold higher than the original (Zheng et al. 2023).

[0006] Therefore, studying plant-derived circadian promoters to drive differential gene expression during the day and night is of great significance for genetic engineering and molecular breeding. Summary of the Invention

[0007] The purpose of the present invention is to propose a plant-derived circadian rhythm promoter to be used to drive genes to express differently during the day and night, providing a new promoter resource for specific expression for genetic engineering and molecular breeding.

[0008] In view of this, the solution of the present invention is: The first aspect of the present invention is to provide a plant-derived circadian rhythm promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1-4.

[0009] The second aspect of the present invention is to provide the promoter-related biological material described in the first aspect, which is any one of the following: a) a gene expression cassette containing the promoter described in the first aspect; b) A recombinant vector containing the promoter described in the first aspect.

[0010] The third aspect of the present invention is to provide a host bacteria comprising the biological material described in the second aspect.

[0011] The fourth aspect of the present invention is to propose an application of a promoter; the application is to drive the circadian expression of exogenous genes in plants; the promoter is any one of the nucleotide sequences shown in SEQ ID NOs: 1-4.

[0012] Furthermore, the plants include rice, tobacco and Arabidopsis thaliana.

[0013] Preferably, the rice includes indica rice and japonica rice, including varieties such as Nipponbare, Zhonghua 11 and Minghui 63; and the tobacco variety is Hongda.

[0014] Furthermore, the exogenous gene is a fluorescent protein gene.

[0015] Preferably, the exogenous gene is the UVGFP gene.

[0016] The fifth aspect of the present invention is to propose a method for cultivating self-luminous plants, using any one of the promoters described in the first aspect and a fluorescent protein gene to construct a genetic transformation vector and introduce it into a recipient plant to obtain a plant in which the fluorescent protein gene is expressed in a dark-induced manner.

[0017] Furthermore, the genetic transformation vector is introduced into the recipient plant through a genetic transformation method mediated by Agrobacterium tumefaciens.

[0018] Furthermore, the genetic transformation vector is connected to the vector backbone via the promoter sequence and the fluorescent protein gene for homologous recombination, and is transformed into Escherichia coli to screen for positive plasmids.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The present invention identifies circadian-specific rhythmic promoters P2, P3, P4, and P6 with nucleotide sequences shown in SEQ ID NOs: 1-4, which can be used to drive reporter gene expression in rice, tobacco, and Arabidopsis. Molecular biological experiments show that promoters P2, P3, P4, and P6 can drive differential expression of genes during the day and night, providing a new specific expression promoter resource for genetic engineering and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1This is the semi-quantitative detection result of gene expression in Example 1 of the present invention.

[0021] Figure 2 The figure shows the diurnal expression of the candidate gene MH02g0443200 in Example 1 of the present invention at different developmental stages of rice Nipponbare.

[0022] Figure 3 The figure shows the diurnal expression of the candidate gene MH06g0238900 in Example 1 of the present invention at different developmental stages in three rice varieties, Nipponbare, Zhonghua 11, and Minghui 63.

[0023] Figure 4 The figure shows the diurnal expression of the candidate gene MH07g0357700 in Example 1 of the present invention at different developmental stages in three rice varieties, Nipponbare, Zhonghua 11 and Minghui 63.

[0024] Figure 5 The expression of the candidate gene MH11g0575900 in Example 1 of the present invention during the day and night in three rice varieties, Nipponbare, Zhonghua 11 and Minghui 63, at different growth stages.

[0025] Figure 6 Schematic diagram of each vector constructed in Example 3 of the present invention.

[0026] Figure 7 The figure shows the diurnal expression of the reporter gene in positive seedlings of Arabidopsis, tobacco and rice after transformation with the pV16 vector in Example 6 of the present invention.

[0027] Figure 8 The figure shows the diurnal expression of the reporter gene in positive seedlings of Arabidopsis, tobacco and rice after transformation with the pV16-2 vector in Example 6 of the present invention.

[0028] Figure 9 The figure shows the diurnal expression of the reporter gene in positive seedlings of Arabidopsis, tobacco and rice after transformation with the pV16-3 vector in Example 6 of the present invention.

[0029] Figure 10 The figure shows the diurnal expression of the reporter gene in positive seedlings of Arabidopsis, tobacco and rice after transformation with the pV16-4 vector in Example 6 of the present invention.

[0030] Figure 11 The figure shows the diurnal expression of the reporter gene in positive seedlings of Arabidopsis, tobacco and rice after transformation with the pV16-6 vector in Example 6 of the present invention. DETAILED DESCRIPTION

[0031] In one embodiment, four circadian-specific promoters were isolated and identified from the rice genome using rice gene rhythmic expression microarray data and qPCR technology from the State Key Laboratory of Crop Genetic Improvement at Huazhong Agricultural University. The applicants named them P2, P3, P4, and P6, respectively. The nucleotide sequence of P2 is shown in the sequence listing as SEQ ID NO: 1, totaling 1494 bp; the nucleotide sequence of P3 is shown in the sequence listing as SEQ ID NO: 2, totaling 3542 bp; the nucleotide sequence of P4 is shown in the sequence listing as SEQ ID NO: 3, totaling 2009 bp; and the nucleotide sequence of P6 is shown in the sequence listing as SEQ ID NO: 4, totaling 1918 bp. The reporter gene is UVGFP, which stands for eYGFPuv, a variant of CpYGFP (Chin et al. 2018) and is referred to as UVGFP in the rest of the text. Analysis of the expression patterns of the reporter genes in transgenic rice, transgenic tobacco, and transgenic Arabidopsis revealed that the reporter genes driven by this promoter exhibit diurnal differences.

[0032] In a preferred embodiment, four candidate genes with diurnal differential expression (high expression at night and low expression during the day) were first discovered based on rice gene rhythmic expression microarray data from the State Key Laboratory of Crop Genetic Improvement at Huazhong Agricultural University. These genes were MH02g0443200, MH06g0238900, MH07g0357700, and MH11g0575900. Gene number conversion was performed on the website http: / / rice.hzau.edu.cn / rice_rs1 / to obtain the corresponding gene numbers in the Nip variety. The CDS sequences of these four genes in japonica rice were then obtained from the Rice Genome Annotation Project (RGAP) website. The CDS sequence of LOC_Os02g36850 is shown in SEQ ID NO: 5, totaling 678 bp; the CDS sequence of LOC_Os06g19444 is shown in SEQ ID NO: 6, totaling 1227 bp; the CDS sequence of LOC_Os07g30670 is shown in SEQ ID NO: 7, totaling 633 bp; and the CDS sequence of LOC_Os11g44810 is shown in SEQ ID NO: 8, totaling 378 bp.

[0033] In a preferred embodiment, cDNA from tissue samples (leaves and spikelets) of the rice varieties Nipponbare (Nip), Zhonghua 11 (ZH11), and Minghui (MH63) at four growth and development stages (seedling, tillering, heading, and filling) was used to perform semi-quantitative detection and qRT-PCR quantitative detection on the candidate genes, identify the expression profiles of the candidate genes in different rice varieties, and determine that these four genes are all circadianly expressed genes.

[0034] In the above example, the promoter sequences of four genes, LOC_Os02g36850, LOC_Os06g19444, LOC_Os07g30670, and LOC_Os11g44810, were amplified from the rice genome using specific primers by PCR. The resulting four promoters were named P2, P3, P4, and P6, respectively. Fusion genes were constructed from the four candidate promoter fragments and the coding sequence of the reporter gene UVGFP and inserted into the plant expression vector PHSGH01 (pV16). The resulting vectors were named pV16-2, pV16-3, pV16-4, and pV16-6. Using Agrobacterium tumefaciens-mediated genetic transformation, the four vectors were transformed into rice, tobacco, and Arabidopsis recipient plants, respectively. pV16 was also transformed as a positive control. Transgenic plants were obtained, and the differential expression of the promoter-driven reporter genes during the day and night was detected by qPCR.

[0035] In some embodiments, promoters P2, P3, P4, and P6 can be used to cultivate self-luminous plants. Genetic transformation vectors constructed using any of these promoters and a fluorescent protein gene are introduced into recipient plants to produce plants in which dark-induced expression of the fluorescent protein gene is obtained. Preferably, the fluorescent protein gene is UVGFP.

[0036] The following will clearly and completely describe the technical solution in conjunction with preferred embodiments and the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0037] If the manufacturer of the reagents or instruments is not specified in the examples, conventional products can be purchased from the market. If the specific conditions are not specified, conventional conditions or conditions recommended by the manufacturers can be followed.

[0038] Example 1 Verification of expression profiles of circadian rhythmic expression candidate genes in different rice varieties

[0039] Material Preparation: The materials used in this example were the indica rice variety Minghui 63, the japonica rice variety Nipponbare (Nip), and the japonica rice variety Zhonghua 11 (ZH11). To verify the expression patterns of the four candidate genes and the universality of the expression patterns within the species, field-grown Nip, ZH11, and MH63 samples were collected from leaves at the seedling, tillering, heading, and grain filling stages, as well as young panicles at the heading stage, for 24 hours. Sampling was performed every 4 hours starting at midnight. The RNA extraction kit used was the TransZol Up kit (ET111) from Beijing Quanshijin Biotechnology Co., Ltd., and the operation was carried out according to the product instructions. An OD260 / 280 value of 1.9 to 2.2 indicated that the RNA sample was of qualified quality and could be used for the next step of the experiment. The reverse transcription kit used was the EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (AE311) from Beijing Quanshijin Biotechnology Co., Ltd., and the reverse transcription method was carried out according to the product instructions. The qPCR kit used was the PerfectStart® Green qPCR SuperMix from Beijing Quanshijin Biotechnology Co., Ltd., and the method was referred to the product instructions.

[0040] Using rice gene rhythmic expression microarray data from the State Key Laboratory of Crop Genetic Improvement at Huazhong Agricultural University, we discovered four candidate genes in the MH63 variety that may be expressed in a circadian rhythm. These genes are MH02g0443200, MH06g0238900, MH07g0357700, and MH11g0575900. Gene numbers were converted to their corresponding gene numbers in the Nip variety at http: / / rice.hzau.edu.cn / rice_rs1 / . Sequences and other basic information were obtained from the Rice Genome Annotation Project using the corresponding Nip gene numbers, as shown in Table 1.

[0041] Table 1: Gene numbers and basic information of the four genes in MH63 and Nip varieties

[0042] Design primers (Table 2) , Semi-quantitative analysis of the expression profiles of four genes was performed using RNA reverse transcription products from leaves of rice (Nipponbare) at the seedling, tillering, heading, and grain filling stages, as well as young panicles at the heading stage, as templates, with rice Actin as an internal reference. PCR reaction conditions were: 95°C for 5 minutes; 95°C for 20 seconds, 57°C for 20 seconds, 72°C for 20 seconds, 30 cycles; 72°C for 3 minutes, 25°C for 1 second. Gel electrophoresis of the PCR products showed ( Figure 1 ), compared with the internal reference gene ( Figure 1 A), candidate gene LOC_Os02g36850 ( Figure 1 B) LOC_Os06g19444 ( Figure 1 C), LOC_Os07g30670 ( Figure 1 D) The PCR product bands at 8:00, 12:00, and 16:00 are all darker, and the sample bands at night are basically brighter, indicating that the above three genes are genes specifically expressed in the circadian rhythm. The candidate gene LOC_Os11g44810 ( Figure 1 E) The brightness of the bands in each sample is comparable, and further gene expression quantification experiments can be performed to analyze their expression.

[0043] Furthermore, qPCR detection was performed using the same primers using RNA reverse transcription products from leaves at the seedling, tillering, heading and filling stages of rice varieties Nipponbare, Zhonghua 11 and Minghui 63, as well as young panicles at the heading stage, as templates to quantitatively analyze the expression of the four genes in different rice varieties.

[0044] The candidate gene MH02g0443200 has circadian rhythmicity at different developmental stages in rice Nipponbare ( Figure 2 The relative expression level of MH02g0443200 was lowest at 8:00 AM in all stages. In leaf samples from the seedling stage, the relative expression level of this gene was highest at 0:00 AM, and the expression level at night and day could differ by up to 78 times. In leaf samples from the tillering stage, the relative expression levels were high at 0:00 AM, 16:00 PM, and 8:00 PM, and the relative expression level at night and day could differ by up to 432 times. In leaf samples from the heading stage, the relative expression level was highest at 0:00 AM, which differed by 309 times from the relative expression level at 8:00 AM. In flower samples from the heading stage, the relative expression level at night and day differed by up to 4 times. In leaf samples from the grain filling stage, the relative expression level of this gene was highest at 8:00 PM, which differed by 139 times from the relative expression level at 8:00 AM.

[0045] The candidate gene MH06g0238900 showed a pattern of higher expression at night than during the day in all three rice varieties: Nipponbare, Zhonghua 11, and Minghui 63. In the seedling-stage leaf samples of Nipponbare, the relative expression level of the candidate gene MH06g0238900 was highest at 0:00 and lowest at 12:00, with a difference of 120 times. In the leaves of the tillering stage, the relative expression level of the candidate gene MH06g0238900 was highest at 20:00 and lowest at 12:00, with a difference of 828 times. In the leaves of the heading stage, the relative expression level of the candidate gene MH06g0238900 was highest at 20:00 and lowest at 12:00, with a difference of 828 times. The relative expression levels of candidate gene MH06g0238900 at 0:00 and 4:00 were similar, and the relative expression levels at 12:00 were 1194 times different. In flowers at the heading stage, the relative expression level of candidate gene MH06g0238900 was the highest at 0:00, which was 35 times different from the relative expression level at 12:00 when the relative expression level was the lowest. In leaf samples at the grain filling stage, the relative expression levels at 0:00 and 20:00 were the highest, which were 1054 times different from the relative expression level at 12:00 when the relative expression level was the lowest ( Figure 3 A).

[0046] In rice Zhonghua 11, the candidate gene MH06g0238900 showed the greatest difference in diurnal expression in leaves at the heading stage, with the highest relative expression at 0:00 differing by 5841 times from the lowest at 12:00. In leaf samples at the seedling stage, the highest relative expression was at 0:00 and the lowest at 16:00, with a difference of 144 times. In leaf samples at the tillering stage, the highest relative expression was at 20:00, with a difference of 728 times from the lowest at 12:00. In flowers at the heading stage, the highest relative expression was at 20:00, with a difference of 113 times from the lowest at 12:00. In leaf samples at the grain filling stage, the highest relative expression was at 0:00, with a difference of 1431 times from the highest relative expression at 12:00. Figure 3 B).

[0047] In rice Minghui 63 leaf samples at the filling stage, the candidate gene MH06g0238900 showed the greatest difference in diurnal expression, with the highest relative expression at 20:00 and the lowest relative expression at 12:00 being approximately 1542 times different. Experimental results of leaf samples at the seedling stage showed that the relative expression of the gene was highest at 0:00, which was 260 times different from the lowest relative expression at 8:00. In leaves at the tillering stage, the relative expression of the gene was highest at 0:00, which was 417 times different from the lowest relative expression at 12:00. In leaves at the heading stage, the relative expression of the gene was highest at 0:00 and the lowest at 12:00 being 555 times different. In flowers at the heading stage, the relative expression of the gene was highest at 4:00 and lowest at 12:00, with a difference of 24 times ( Figure 3 C).

[0048] The candidate gene MH07g0357700 also showed significant diurnal differential expression in all three rice varieties. In seedling-stage leaf samples of Nipponbare, the relative expression level of the candidate gene MH07g0357700 was highest at 0:00, a 165-fold difference from the lowest relative expression level at 12:00. In tillering-stage leaves, the relative expression level was highest at 20:00, a 649-fold difference from the lowest relative expression level at 12:00. In heading-stage leaves, the relative expression levels were highest at 0:00 and lowest at 12:00, respectively, a 142-fold difference. In heading-stage flowers, the gene's diurnal expression difference was the largest, approximately 25-fold. In grain-filling-stage leaves, the relative expression level was highest at 20:00, a 551-fold difference from the lowest relative expression level at 12:00. Figure 4 A).

[0049] In rice variety Zhonghua 11, the candidate gene MH07g0357700 showed very high diurnal expression differences in leaves at the tillering, heading, and grain-filling stages. The relative expression levels at night and day differed by 539 times in samples from the tillering stage, 482 times in samples from the heading stage, and 485 times in samples from the filling stage. Although the diurnal expression differences of this gene in leaves at the seedling stage and flowers at the heading stage were not as large as those in leaves at the tillering, heading, and grain-filling stages, the differences were still significant. The relative expression levels at day and night in leaves at the seedling stage still differed by 43 times, and in flowers at the heading stage by 48 times ( Figure 4 B).

[0050] In the rice variety Minghui 63, although the relative expression levels of the candidate gene MH07g0357700 were the highest at 16:00 in leaves and flowers during the tillering and heading stages, and the relative expression level in leaves at 16:00 during the tillering stage was particularly high, the gene still showed obvious day-night differential expression in Minghui 63 as a whole, with the relative expression levels at 8:00 and 12:00 during the day being the lowest among the six time points ( Figure 4 C).

[0051] The expression pattern of the candidate gene MH11g0575900 in three rice varieties also showed obvious diurnal differential expression, e.g. Figure 5 As shown, Figure 5Figures A, B, and C correspond to the expression of candidate genes at different stages in Nipponbare, Zhonghua 11, and Minghui 63, respectively. Although the difference in diurnal expression of this gene is smaller than that of the three genes above, its baseline expression is very high, even higher than that of the rice internal reference gene OsActin. Furthermore, the overall difference in diurnal expression of this gene is still significant. In leaves of Nipponbare during the tillering, heading, and grain filling stages, the relative expression of this gene during the day and night differed by 40-fold to 70-fold ( Figure 5 A); In the leaves of rice variety Minghui 63 at the heading stage, the relative expression level of this gene was the highest at 20:00 and the lowest at 12:00, with a difference of 769 times between the two; ( Figure 5 C).

[0052] Table 2: Semi-quantitative and qPCR primers

[0053] Example 2 Obtaining a Plant-derived Circadian Rhythm Expression Promoter

[0054] Extraction of Nipponbare genomic DNA: CTAB extraction method, the extracted DNA was completely dissolved and stored in a -20℃ refrigerator.

[0055] After obtaining the gene sequence from the Rice Genome Annotation Project (Rice Genome Annotation Project) bioinformatics website, primers were designed (Table 3) and the promoter was amplified from Nipponbare genomic DNA using PCR. To facilitate subsequent vector construction, linker sequences (indicated in capital letters) corresponding to the terminal sequences of the linearized vector were added to the left and right primers. PCR reaction conditions were: 98°C for 3 minutes; 32 cycles of 98°C for 20 seconds, 57°C for 20 seconds, and 68°C for 1 minute and 30 seconds; and 72°C for 3 minutes and 25°C for 1 second. A portion of the PCR product was analyzed by agarose gel electrophoresis. A portion of the P2 PCR product was sent for sequencing. The remaining PCR product that was sequenced correctly was used to construct the vector using homologous recombination.

[0056] Table 3: Target fragment cloning primers

[0057] Note: The linker sequences indicated by capital letters in the table are consistent with the terminal sequences of the linearized vector.

[0058] Example 3 Construction of a circadian rhythm promoter transformation vector

[0059] Schematic diagram of expression vector Figure 6 shown. Figure 6A is a schematic diagram of the pV16 vector, in which the CaMV35S promoter drives the expression of the UVGFP gene; Figure 6 B is a schematic diagram of the pV16-2 vector, in which the P2 promoter drives the expression of the UVGFP gene; LB and RB are the left and right borders of the vector, respectively; hyg is the hygromycin resistance selection gene; uvgfp is the reporter gene UVGFP; 35sP represents the CaMV35S promoter (cauliflower mosaic virus 35S promoter); the direction of the arrow indicates the direction of gene or promoter expression.

[0060] The construction process is as follows: the vector backbone is PHSGH01 (pV16) transformed from the pC1300s vector ( Figure 6 A), use Hind III. Treat the pV16 vector at 37°C for 3 hours. The 1624 bp sequence between UVGFP and the CaMV35S promoter is excised. The resulting linearized vector backbone is purified and stored. The UVGFP sequence and promoter sequence are then ligated to the vector backbone using homologous recombination. Homologous recombination is performed using the Quan's Gold kit. The recombination system is as follows: 2×Basic Assembly Mix 2.5 μl Linearized Vector 1 μl Inserts 0.1 pmol ddHO to 5 μl After the recombination was completed, the recombinant product was transformed into Escherichia coli DH5α. The target positive clones were screened by bacterial liquid PCR and sequencing, and the obtained recombinant plasmids were named pV16-2 ( Figure 6 B), pV16-3 ( Figure 6 C), pV16-4 ( Figure 6 D) and pV16-6 ( Figure 6 E) The plasmid extraction steps are as follows: 1. Take the shaken bacterial solution (1.5 ml) and add it to a centrifuge tube. Centrifuge for 1 min at 12,000 rpm. Pour off the supernatant and collect the bacteria. Add 350 μl of Solution I (RNase added at a ratio of 1:100, prepared immediately before use) to the centrifuge tube. Place a toothpick in the centrifuge tube and shake to suspend the bacteria at the bottom. 2. Add 350 μl of Solution II (0.4 M NaOH: 2% SDS = 1:1) to the centrifuge tube, gently invert it upside down about 10 times, mix well, and let it stand for 2 minutes. This step is to destroy the bacterial cells. 3. Add 350 μl of Solution III and gently invert the tube about 10 times to mix. Freeze at -20°C for 15 min. Centrifuge at 12,000 rpm for 15 min. Transfer 900 μl of the supernatant to a new centrifuge tube and add 600 μl of isopropanol (supernatant:isopropanol = 3:2). Invert the tube about 20 times to mix, and let it stand for 5 min. 4. Centrifuge for 15 min at 12,000 rpm to sediment the DNA. Discard the supernatant, add 500 μl of 75% ethanol, and shake up and down to mix. Centrifuge for 5 min at 12,000 rpm, discard the supernatant, and invert onto absorbent paper to dry. Add 20 μl of ddH2O to dissolve the DNA.

[0061] Note: If impurities are aspirated, add 1-2 drops of 24:1 before adding isopropanol. Let it stand for 5 minutes, then centrifuge for 15 minutes at 12,000 r / min. Then aspirate the supernatant into a new centrifuge tube and add isopropanol.

[0062] Before infecting plant tissues, Agrobacterium tumefaciens needs to be treated and the target plasmid needs to be electroporated into Agrobacterium tumefaciens; 1. Clean the electric rotating cup: use sterilized ddH2O to suck and rinse 2 to 3 times, then use anhydrous ethanol to suck and rinse 2 times, and place the washed electric rotating cup on the clean bench to dry; 2. Use a small pipette tip to take 0.5 μl of plasmid (plasmid concentration 200-600 ng / μl) and inject the small pipette tip into the centrifuge tube containing Agrobacterium tumefaciens; 3. Replace the medium-sized pipette tip with the small-sized pipette tip from the previous step, gently pipette and mix thoroughly, and pipette 20 μl of the bacterial solution into the gap inside the electroporation cuvette; 4. Electric shock treatment: Pipette 600 μl of resuscitation solution into the electric rotating cup, pipette and pump several times, and then transfer the resuscitation solution into a sterilized centrifuge tube; place in a shaker at 28°C for 1 hour; after coating the dish, place in a 28°C incubator for 24-36 hours.

[0063] After colonies grow on the plate, pick the bacteria and culture them in suspension. Use the shaken bacterial solution for PCR detection. The strains that have successfully been transformed with the plasmid by PCR detection are mixed with glycerol in a 1:1 ratio and stored in a -80 °C refrigerator.

[0064] Example 4 Agrobacterium tumefaciens-mediated genetic transformation

[0065] In this example, Agrobacterium tumefaciens-mediated transformation was used to achieve stable transformation of three plant species: Arabidopsis thaliana, tobacco, and rice. The steps for stable transformation of tobacco are as follows: 1. Take sterile leaves of red tobacco seedlings and cut off the edges and main veins with a sterilized surgical blade. Cut the leaves into small pieces with a diameter of about 0.5 cm and with wounds on all sides. 2. Infect the cut pieces in the prepared infection solution for 10 minutes, then use sterile filter paper to remove the residual bacterial solution on the surface of the pieces. Transfer the pieces to MS medium covered with a layer of sterile filter paper and incubate in the dark at 28°C for 3 days. 3. After co-culture, transfer the material to differentiation medium (selection medium) containing antibiotics and culture it every 15 days; 4. Cut the resistant buds when they grow to 2-3 cm, transfer them to 1 / 2 MS solid medium, and induce rooting using rooting medium; 5. Take samples of the transformed plants and conduct positive testing to obtain transformed positive plants.

[0066] The stable transformation steps for Arabidopsis thaliana are as follows: Prepare Arabidopsis plants in the flowering period in advance, pinch off the existing seed pods, immerse the top of the Arabidopsis (flower) completely in the infection solution, stir gently with a wooden stick, take it out after 1 minute, and keep the infected plants in the dark for 24 hours. Arrange a second infection after 1 week. Sow the T1 generation after harvesting, and use resistance culture medium to preliminarily screen positive seedlings. Transplant the seedlings that grow stronger in the culture medium, and take samples for positive testing after the seedlings grow up to obtain positive plants.

[0067] The steps for stable transformation of rice are as follows: 1. Induction of Rice Callus 1) Soak the hulled rice seeds in 75% ethanol for 1 min; 2) Pour off 75% ethanol and add sodium hypochlorite, soaking for 15-25 minutes; 3) Pour out the sodium hypochlorite and rinse with ddH2O 5-6 times; 4) After completing the above disinfection steps, place the seeds on callus induction medium and place them in a dark room for about one month, and then subculture them every two weeks.

[0068] 2. Co-cultivation of Rice Callus and Agrobacterium tumefaciens

[0069] Carefully select sterile, well-maintained callus (4-5 days old, pale yellow, and granular) and place it in a 100ml sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium tumefaciens suspension and incubate at room temperature for 20 minutes, shaking occasionally. Discard the suspension and place the callus on sterile filter paper to absorb excess liquid. Immediately transfer the callus to a solid co-culture medium covered with a layer of sterile filter paper and incubate at 25°C in the dark for 2-3 days.

[0070] 3. Screening of resistant callus

[0071] After co-cultivation, the calli were washed and sterilized, then placed on screening medium and incubated in the dark at 26°C for 14 days. They were then transferred to freshly prepared screening medium and screened for another 14 days. Most calli turned brown around 10 days after screening, and then pale yellow resistant calli regrew around the edges of the browned tissue.

[0072] 4. Differentiation of resistant callus

[0073] From the resistant callus tissue grown after two rounds of screening, select the light yellow and dense resistant callus tissue and transfer it to the differentiation medium, and then culture it under 15 h / day light conditions. Generally, after about 15-25 days, green spots will appear, and seedlings will be further differentiated after 30-40 days.

[0074] 5. Rooting, seedling strengthening and transplanting

[0075] When the buds differentiated from the resistant callus grow to approximately 2 cm, transfer the seedlings to rooting medium and culture for about two weeks. Select seedlings approximately 10 cm tall with well-developed root systems, wash off the medium, harden the seedlings for about 3 days, and then transplant them into soil in the greenhouse.

[0076] Example 5 Positive detection of transgenic plants

[0077] Primers hpt557-F / R were designed for the selection marker hpt resistance gene on the vector and used to perform PCR detection on DNA samples of transformed plants. The primer sequences are: hpt557-F: ACACTACATGGCGTGATTTCAT (SEQ ID NO: 35); hpt557-R: TCCACTATCGGCGAGTACTTCT (SEQ ID NO: 36).

[0078] PCR reaction conditions: 95°C for 3 minutes, 32 cycles of 95°C for 10 seconds, 55°C for 10 seconds, and 72°C for 15 seconds, and 72°C for 3 minutes and 25°C for 1 second. PCR-positive plants were screened by agarose gel electrophoresis.

[0079] Example 6 qPCR Analysis of Rhythmic Promoter Expression Patterns in Transgenic Plants

[0080] Transformation-positive Arabidopsis, tobacco, and rice plants were sampled at six different times: 0:00 AM, 4:00 AM, 8:00 AM, 12:00 PM, 4:00 PM, and 8:00 PM. For Arabidopsis, sampling was done before bolting and when leaves were growing vigorously; for tobacco, sampling was done when plants had 5–6 leaves; and for rice, sampling was done at the tillering stage. RNA was extracted and reverse-transcribed to generate cDNA. Appropriate primers were designed for qPCR to monitor target promoter-driven reporter gene expression at different times of day. qPCR primers were selected from Table 2: AtEF1-qRTF and AtEF1-qRTR; NtGAPDH-qRTF and NtGAPDH-qRTR; OsActin-F and OsActin-R; UVGFP-qF and UVGFPCX-1R.

[0081] In plants transformed with the pV16 vector, the diurnal oscillation of UVGFP expression was generally stable. The expression of the reporter gene driven by the CaMV35S promoter was relatively stable in the three species, with little fluctuation ( Figure 7 In Arabidopsis thaliana ( Figure 7 A) and rice ( Figure 7 C), the relative expression of the reporter gene fluctuated no more than 2-fold during the day. Figure 7 B) the fluctuation in a day is less than 5 times.

[0082] In the three species transformed with the pV16-2 vector, the circadian expression of UVGFP showed a certain rhythmicity ( Figure 8 In Arabidopsis thaliana ( Figure 8 A), the reporter gene expression level is higher in the early morning, the relative expression level is the highest at 0:00 at night, and the relative expression level is the lowest at 12:00 during the day. The relative expression levels of UVGFP at the two times differ by 11 times; in tobacco ( Figure 8 B) The relative expression levels of the reporter gene were high at all three nighttime hours, with the highest relative expression level at 4:00 at night and the lowest relative expression level at 12:00 during the day. The relative expression levels of UVGFP at the two times differed by 8 times; in rice ( Figure 8 C), the relative expression levels at 0:00 and 4:00 were both high, and the maximum difference between the relative expression levels of the reporter gene during the day and night was 7 times.

[0083] The expression detection results showed that the relative expression of the reporter gene driven by the P3 promoter in the three species had a certain circadian rhythm ( Figure 9 In Arabidopsis thaliana ( Figure 9 A), UVGFP expression level was highest at 4:00 in the evening and lowest at 12:00 in the afternoon, with a difference of 8 times; in tobacco ( Figure 9B), UVGFP expression level was highest at 0:00 in the evening and lowest at 12:00 in the afternoon, with a difference of 3 times; in rice ( Figure 9 C) The relative expression levels of UVGFP were high at 0:00, 4:00, and 20:00 at night. The relative expression levels at 4:00 and 20:00 were more than 100-fold (109-fold and 101-fold, respectively) compared to the lowest relative expression level at 12:00.

[0084] The P4 promoter also showed certain rhythmicity in the three transformed species ( Figure 10 In Arabidopsis thaliana ( Figure 10 A) The expression levels of the reporter gene were high at the three dark times: 0:00, 4:00, and 20:00. The highest expression level at 4:00 was 7 times higher than the lowest expression level at 12:00. In tobacco ( Figure 10 B), the reporter gene expression level was highest at 20:00, which was 6 times higher than that at 12:00, and 15 times and 33 times higher than that at 8:00 and 16:00, respectively; in rice ( Figure 10 C) The relative expression levels of the reporter gene at three night times, 0:00, 4:00, and 20:00, were all higher than those at three daytime times, 8:00, 12:00, and 16:00. The highest relative expression level was at 20:00, which was 9 times higher than that at 12:00.

[0085] The reporter gene driven by the P6 promoter also showed a certain circadian expression rhythm in the three transformed species ( Figure 11 In Arabidopsis thaliana ( Figure 11 A), the relative expression level at 20:00 was the highest, which was 5 times higher than that at 12:00; in tobacco ( Figure 11 B), the relative expression levels of the reporter gene were higher at 4:00 and 20:00, with a difference of about 140 times between 4:00 and 12:00, and a difference of 377 times between 20:00 and 12:00; in rice ( Figure 11 C) The relative expression level of the reporter gene was the highest at 20:00, which was 11 times lower than the lowest relative expression level at 12:00.

[0086] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and alterations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A plant-derived circadian rhythm promoter, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO: 1-4.

2. The promoter-related biological material according to claim 1, which is any one of the following: a) a gene expression cassette containing the promoter according to claim 1; b) A recombinant vector containing the promoter according to claim 1.

3. A host bacteria comprising the biological material according to claim 2.

4. The use of a promoter, characterized in that The application is to drive the circadian expression of exogenous genes in plants; the promoter is any one of the nucleotide sequences shown in SEQ ID NOs: 1-4.

5. The use according to claim 4, characterized in that The plants include rice, tobacco and Arabidopsis thaliana.

6. The method according to claim 4, wherein The exogenous gene is a fluorescent protein gene.

7. The method according to claim 6, wherein The exogenous gene is the UVGFP gene.

8. A method for cultivating self-luminous plants, characterized in that: The promoter and fluorescent protein gene of claim 1 are used to construct a genetic transformation vector, which is introduced into a recipient plant to obtain a plant in which the fluorescent protein gene is expressed in a dark-induced manner.

9. The cultivation method according to claim 8, wherein The genetic transformation vector is introduced into the recipient plant through a genetic transformation method mediated by Agrobacterium tumefaciens.

10. The cultivation method according to claim 8, wherein The genetic transformation vector is obtained by connecting a promoter sequence and a fluorescent protein gene to a vector skeleton for homologous recombination and then transforming the vector into Escherichia coli to screen for positive plasmids.