Application and method of GhDPF1 gene or coded protein in regulation and control of drought resistance of cotton

Abstract

The invention belongs to the technical field of gene engineering, and relates to application and a method of a GhDPF1 gene or a coded protein in regulating and controlling drought resistance of cotton. According to the invention, the drought resistance function of the cotton GhDPF1 gene is cloned and verified for the first time, and the nucleotide sequence of the GhDPF1 gene is as shown in SEQ ID No.1. The blank of the gene in cotton stress resistance research is filled, and a new theoretical basis is provided for deep research of a plant drought-resistant molecular mechanism. The function of the GhDPF1 gene is rapidly determined by using a virus-induced gene silencing (VIGS) technology, and the key effect of the gene in drought regulation is verified. Overexpression of the GhDPF1 gene in cotton finds that the gene shows significant drought resistance under drought stress, and the survival rate of cotton in a drought environment is effectively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to the research on the drought resistance of cotton. Background Art

[0002] Global climate change has brought numerous challenges to agricultural production, with extreme climate events such as high temperatures, droughts, and floods becoming increasingly common. Drought stress can severely harm plant growth and development, leading plants to evolve complex mechanisms to adapt to drought. Cotton is a global fiber and oilseed crop, playing a vital role in agricultural production and economic development. Drought stress is a major factor limiting improvements in cotton yield and quality. Therefore, exploring cotton's drought resistance mechanisms, identifying drought-tolerant germplasm, and discovering drought-tolerant genes are of great significance for increasing yield, optimizing quality, enhancing environmental adaptability, ensuring agricultural production, and promoting sustainable development.

[0003] DREB (Dehydration responsive element binding protein) is a drought response element binding protein that contains an AP2-DNA binding domain and can specifically bind to the DRE / CRT (dehydration responsive element) cis-element in the promoter. When plants are subjected to external environmental stress, the transcription factors produced by the expression of DREB-like genes bind to the DRE cis-acting element, activate the expression of multiple stress-tolerant genes regulated by it, and ultimately enhance the stress resistance of the plant. DREB-like genes belong to the AP2 / EREBP transcription factor family. Five types of such transcription factors have been found in Arabidopsis, among which DREB2A-type transcription factors are mainly induced by drought stress signals. At present, multiple members of this transcription factor family have been reported for genetic engineering applications to improve plant stress resistance, such as the disclosure of soybean in soybean. GmPUB6 Genes can be used to regulate drought tolerance in soybean (Wang N, Liu Y, Cai Y, Tang J, Li Y, Gai J. The soybean U-box gene GmPUB6 regulates drought tolerance in Arabidopsis thaliana Plant Physiol Biochem. 2020 Oct;155:284-296.); overexpression in Arabidopsis thaliana StERECTA Gene can improve drought tolerance in Arabidopsis (Liu X, Yang W, Zhang L, Nie F, Gong L, Zhang H. Overexpressionof Sterecta enhancesdrought tolerance in Arabidopsis thaliana. J Plant Physiol. 2024;303:154353.). However, the gene functions of this family in cotton have not been fully explored. Therefore, exploring the functions of DREB genes related to drought stress in cotton is of great significance for revealing the molecular mechanism of cotton drought resistance and improving cotton drought resistance. Summary of the Invention

[0004] The present invention proposes a GhDPF1 The application and method of the gene or the encoded protein in regulating the drought resistance of cotton provides a candidate gene with application potential for genetic improvement of cotton drought resistance.

[0005] The technical solution of the present invention is achieved as follows: GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.1. GhDPF1 The gene is an important type of transcription factor in plants, belonging to the AP2 / ERF superfamily, and is mainly involved in the drought stress response of cotton.

[0006] This application requests protection GhDPF1 Application of genes or encoded proteins in regulating drought resistance of cotton, GhDPF1 The nucleotide sequence of the gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No.1.

[0007] Furthermore, the above GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0008] The amino acid sequence of the above protein is shown in SEQ ID No.2.

[0009] GhDPF1 Application of genes or encoded proteins in improving drought resistance of cotton, GhDPF1 The nucleotide sequence of the gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No.1.

[0010] Furthermore, the above GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0011] The amino acid sequence of the above protein is shown in SEQ ID No.2.

[0012] The above GhDPF1 Application of genes or encoded proteins in improving drought resistance of cotton by overexpression GhDPF1 Gene function, improve GhDPF1 The expression of protein can improve the drought resistance of cotton.

[0013] A method for improving drought resistance of cotton, comprising the steps of: overexpressing GhDPF1 Genes, improve GhDPF1 The expression level of the protein was increased to obtain drought-resistant cotton plants.

[0014] The specific steps of the above method are: construct GhDPF1 The gene overexpression vector is transferred into the cotton plant to be improved through the Agrobacterium transformation method, thereby obtaining drought-resistant cotton plants.

[0015] above GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0016] The present invention has the following beneficial effects: 1. The purpose of the present invention is to GhDPF1 Gene and its application in drought resistance. Studies have shown that this gene plays a positive regulatory role in drought stress response. GhDPF1 Functional loss analysis of the gene revealed that the drought resistance of gene-silenced plants was significantly reduced compared to the control group. Further phenotypic observations showed that GhDPF1 Gene silencing resulted in the main root length of the plant being significantly shorter than that of the control. These experimental results fully demonstrated that GhDPF1 The gene has an important positive regulatory function in cotton drought stress response. The present invention provides a candidate gene with application potential for genetic improvement of cotton drought resistance.

[0017] 2. The present invention cloned and verified cotton for the first time GhDPF1 The drought resistance function of the gene fills the gap in the research of cotton stress resistance and provides a new theoretical basis for in-depth study of the molecular mechanism of plant drought resistance. GhDPF1 The gene can positively regulate the drought resistance of cotton, providing feasibility for breeding drought-resistant cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 for GhDPF1 Functional study of genes; Figure (a) is GhDPF1 The expression pattern of the gene in the root, stem and leaf tissues of cotton; Figure (b) is the positive control, TRV: CLAInterference plants (CLA is a key enzyme in chlorophyll synthesis) showed whitening and interference efficiency detection RT-PCR nucleic acid gel electrophoresis diagram and interference efficiency detection qRT-PCR result bar chart ( TRV: 00 : The gray histogram on the left, TRV: GhDPF1 : black bar graph on the right, ***: extremely significant difference).

[0020] Figure 2 Control plants TRV: 00 With silent plants TRV: GhDPF1 Plant phenotype; Figure (a) is the control plant TRV: 00 With silent plants TRV: GhDPF1 Well hydrated 、 Plant growth conditions under conditions of 12 days of drought and 12 hours of rewatering; Figure (b) is the control plant TRV: 00 With silent plants TRV:GhDPF1 Bar graph of plant height and survival rate statistics. ( TRV: 00 : The gray histogram on the left, TRV:GhDPF1 : Black bar graph on the right. ns: no significant difference; ***: extremely significant difference).

[0021] Figure 3 Control plants TRV: 00 With silent plants TRV: GhDPF1 Root phenotype of the control plant; Figure (a) is the root phenotype of the control plant TRV: 00 With silent plants TRV: GhDPF1 Well hydrated 、 Root growth of plants under 12 days of drought; Figure (b) is the control plant TRV: 00 With silent plants TRV: GhDPF1 Histogram of the statistical results of taproot length and root dry weight. ( TRV: 00 : The gray histogram on the left, TRV: GhDPF1 : Black bar graph on the right. ns: no significant difference; ***: extremely significant difference).

[0022] Figure 4 Figure 2 is the phenotype of wild type WT and overexpression plants GhDPF1-OE-1 and GhDPF1-OE-2; Figure (a) is the phenotype of wild type WT and overexpression plants GhDPF1-OE-1 and GhDPF1-OE-2 with sufficient water 、Plant growth after 10 days of drought and 9 days of rewatering. Figure (b) shows the statistical results of plant height (wild-type WT: gray scatter plot on the left, GhDPF1-OE-1 and GhDPF1-OE-2 overexpressing plants); relative expression (wild-type WT: gray histogram on the left, GhDPF1-OE-1 and GhDPF1-OE-2 right red histograms); and survival rate (wild-type WT: gray histogram on the left, GhDPF1-OE-1 and GhDPF1-OE-2 right red histograms). (**: very significant difference; ***: extremely significant difference). DETAILED DESCRIPTION

[0023] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0025] Example 1: GhDPF1 Analysis of gene tissue expression patterns in cotton For analysis GhDPF1 The expression pattern of genes in different tissues of cotton. In this study, the root, stem and leaf tissues (50-100 mg each) of normally grown upland cotton (TM-1) were selected as materials. The samples were quick-frozen in liquid nitrogen and then ground into powder. The total RNA was extracted using the Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) of Tiangen Biological Co., Ltd. Subsequently, the extracted total RNA was used as a template and reverse transcribed using the Toyobo (Japan) ReverTra Ace qPCR RT Kit to obtain cDNA. After the obtained cDNA sample was diluted 50 times, qRT-PCR analysis was performed on the Roche LightCycler 96 real-time fluorescence quantitative PCR system, and three technical replicates were set for each sample. The experiment was based on the cotton housekeeper gene GhUBQ7 As an internal reference, 2 ^-ΔCt Calculation GhDPF1 Relative gene expression.

[0026] qRT-PCR results showed that ( Figure 1 a), GhDPF1 The gene was expressed in cotton root, stem and leaf tissues, with the expression level in stem tissue being relatively high.

[0027] Example 2: Construction of TRV:GhDPF1 viral interference vector and Agrobacterium-mediated transformation The VIGS expression vector was constructed according to GhDPF1 The following primers were designed based on the nucleotide sequence of the primers. The primer sequences are shown below: GhDPF1-VIGS-F: (5'- GGGTAAGTGGGTAGCGGAAAT -3'); GhDPF1-VIGS-R: (5'- CCTCACCACCTTCACCTTTC -3'); First, the TRV:GhDPF1 gene fragment was amplified (reaction system: 10 μL 2×Phanta Max Buffer, 0.4 μL dNTP (10 mM), 30 mM GhDRP2-VIGS-F, 30 mM GhDRP2-VIGS-R, 5 μL template (cDNA), 0.1 μL Phanta Max Super-Fidelity DNA Polymerase (5 U / μL), and ddH2O to 20 μL. Amplification program: 95°C, 5 min; 95°C, 30 s; 58°C, 15 s; 72°C, 10 s; 38 cycles). The pTRV2 plasmid was cleaved with restriction endonucleases. Bam HI and Kpn I double enzyme digestion (reaction system: 5 μL 10× Cutsmart Buffer, 1 μL Bam HI, 1 μL Kpn I. 2 μg of pTRV2 plasmid, filled to 50 μL with ddH2O; reaction schedule: 37°C for 3 h). The PCR product was ligated with the digested pTRV2 plasmid fragment using a one-step cloning method (reaction system: 2 μL 5×CE II Buffer, 100 ng TRV: GhDPF1 gene fragment, 50 ng of pTRV2 plasmid digested product, 1 μL Exnase II, filled to 10 μL with ddH2O; reaction schedule: 37°C for 30 min).

[0028] The ligation product was transformed into Escherichia coli DH5α (Tiangen Biochemical Technology Co., Ltd.) using a heat shock method, plated onto LB plates containing the appropriate antibiotic, and incubated at 37°C for 12-16 hours. Single colonies were selected and tested for PCR-positive results using primers GhDPF1-VIGS-F / GhDPF1-VIGS-R. Correct clones were screened and sent for sequencing verification. After sequence confirmation, positive clones were expanded and plasmids were extracted, which were then transformed into Agrobacterium tumefaciens GV3101 (Tiangen Biochemical Technology Co., Ltd.). After PCR confirmation, the bacterial culture was stored at -80°C until further use.

[0029] The TRV: GhDPF1 Agrobacterium GV3101 strain was inoculated into LB medium (1 g of peptone, 0.5 g of yeast powder, 1 g of NaCl in 100 mL of ultrapure water) at a ratio of 1:10, and cultured at 180 rpm and 37°C for 10-12 h until the bacterial solution OD reached 0. 600 When the OD value reaches 1.0-1.2, collect the bacterial solution, centrifuge at 4000 rpm for 10 min, discard the supernatant, and adjust the bacterial concentration to OD value by resuspension solution (1 mL of 1 M MES, 1 mL of 1 M MgCl2, 200 μL of 0.1 M AS in 100 mL of sterile water). 600 =0.8-1.0. Cotton seedlings grown under 16 h light / 8 h dark conditions, cultured at 23°C for approximately one week, with fully expanded cotyledons, were infected. A 1:1 mixture of pTRV2 empty vector culture and pTRV:GhDPF1 recombinant culture was mixed with a pTRV1 helper vector culture. The abaxial surface of the cotton cotyledons was infiltrated by injection, ensuring coverage of at least 95%. After injection, the seedlings were incubated in the dark for 12 h to facilitate Agrobacterium infection, after which normal light conditions were resumed.

[0030] Example 3: TRV: GhDPF1 interference efficiency detection According to the gene sequence of TRV:GhDPF1 vector, the primers for fluorescence quantitative analysis were designed as follows: GhDPF1-qRT-F: (5'- GACGAAGCCGCCAAAGCC -3'); GhDPF1-qRT-R: (5'- TCAGAGCCACCGCAAGTG -3'); Cotton plants grown to the two-leaf, one-heart stage (TRV:00 (empty control) and TRV:GhDPF1 (gene silenced) were selected, and true leaf tissues were collected (three biological replicates each). Total RNA was extracted using the Tiangen Biotechnology Co., Ltd. Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441). RNA was reverse transcribed and synthesized into cDNA using the Toyobo (Japan) ReverTra Ace qPCR RT Kit. RT-PCR experiments were performed to verify the expression of the cotton ubiquitin protein gene. GhUBQ7 As an internal reference, Figure 1 b shows an agarose gel electrophoresis image. qRT-PCR experiments were performed on a Roche LightCycler 384 real-time fluorescence quantitative PCR system, with three technical replicates for each reaction.

[0031] Also using GhUBQ7 As an internal reference gene, the reaction system included 5 μL 2×qPCR Master Mix, 20 mM GhDPF1-qRT-F, 20 mM GhDPF1-qRT-R, and 5 μL template (cDNA).

[0032] Amplification program: 95°C, 30 s; 95°C, 10 s; 60°C, 10 s; 72°C, 10 s; 40 cycles.

[0033] and pass 2 ^-ΔCt The relative expression of target genes was calculated by Figure 1 b). The experimental results showed that compared with the TRV: 00 control group, the TRV: GhDPF1 interference plant leaves GhDPF1 The expression level of β-catenin was significantly reduced to only 32% of the control group, proving that the VIGS system successfully interfered with GhDPF1 Gene expression.

[0034] Example 4: Determination of drought resistance of TRV:GhDPF1 interference materials Observations of the control TRV:00 and TRV:GhDPF1-treated plants revealed no significant differences in plant height at the two-leaf, one-heart stage. When water was reduced to 80% soil moisture, after 12 days of water shortage, the leaves of the TRV:GhDPF1-treated plants wilted more severely than those of the control TRV:00 plants. Results showed that after drought treatment and rewatering for 24 hours, the survival rate of the TRV:GhDPF1-treated plants decreased to approximately 57% of that of the control TRV:00 plants. Figure 2 b), the plant height was about 1.2 times that of the control. The above results showed that TRV: GhDPF1 plants showed weaker drought tolerance than the control TRV: 00 plants ( Figure 2 ),show GhDPF1 Positively regulating cotton drought resistance.

[0035] Example 5: TRV: GhDPF1 interference material root observation Observation of the root systems of the control TRV:00 and TRV:GhDPF1 plants revealed that, when adequately watered, the taproot length of the control TRV:00 plants was 1.6 times that of the TRV:GhDPF1 plants, and the root dry weight was approximately 78% of that of the control plants. This conclusion was further verified by observing the root systems of the TRV:GhDPF1 and control TRV:00 plants after 12 days of drought treatment. This suggests that the root growth of the TRV:GhDPF1 plants exhibited weaker drought tolerance than the control TRV:00 plants ( Figure 3 ), again indicating GhDPF1 Positively regulating cotton drought resistance.

[0036] Example 6: Construction of GhDPF1 overexpression vector and genetic transformation Primer 5.0 was used to design primers and high-fidelity DNA polymerase was used to clone the TM-1 upland cotton cDNA. GhDPF1 Gene CDS sequence, cloning primer sequence is: Cotton2.0-GhDPF1-F: CGACCTGCAGGCGGCCGCACTAGTATGTTTTGGTATGGG; Cotton2.0-GhDPF1-R: CAAGAAAGCTGGGTTCTAGAATTCTCAAGCAAGGAACTCATC.

[0037] The size of the PCR product was detected by agarose gel electrophoresis, and then it was purified and recovered using a kit. It was constructed into the overexpression vector Cotton2.0 driven by CaMV35S through a one-step cloning method.

[0038] A 10 μL reaction system consisted of 2 μL of 5× CE Buffer, 1 μL (50 ng) of the overexpression vector Cotton2.0, 1 μL (100 ng) of the gene product, and 1 μL of Exnase II. The mixture was gently mixed and incubated at 37°C for 30 min. The cells were then transformed into Escherichia coli DH5α by heat shock, activated for 50 min, and plated onto LB solid medium containing spectinomycin (Spe). The cells were cultured at 37°C for approximately 12 h. Single colonies were picked and transferred to LB liquid medium containing Spe and activated for approximately 6 h before PCR analysis. Positive clones were sequenced, and plasmids were extracted from the clones. The plasmids were then transformed into Agrobacterium tumefaciens LBA4404 by electroporation. The cells were cultured at 28°C for 60 h on LB solid medium containing Spe and rifampicin (Rif). Single colonies were picked and analyzed by PCR. Positive colonies were pooled and stored in an equal volume of 40% glycerol. Using Agrobacterium-mediated cotton genetic transformation, the T-DNA was integrated into the cotton genome through co-cultivation. Subsequently, through antibiotic selection and plant regeneration, transgenic cotton plants were obtained and designated the overexpression lines GhDPF1-OE-1 and GhDPF1-OE-2.

[0039] Example 7: Drought resistance test of GhDPF1 overexpressing plants In order to further verify the positive regulatory function of GhDPF1 on cotton drought resistance, GhDPF1 overexpression materials were created. The expression levels of the overexpression lines GhDPF1-OE-1 and GhDPF1-OE-2 were detected. The results are as follows Figure 4 The figure (a) in the figure shows that the expression level of GhDPF1 in the overexpression line was significantly increased. The height of the plants grown to the two-leaf and one-heart stage was counted, and the results were as follows: Figure 4 Figure b showed that elevated GhDPF1 expression significantly inhibited cotton plant height. The overexpression lines GhDPF1-OE-1 and GhDPF1-OE-2 reached 80% and 70% of the wild-type plant height, respectively. After 10 days of drought treatment and rewatering, survival rates were measured 9 days after rewatering. The survival rates of the overexpression lines GhDPF1-OE-1 and GhDPF1-OE-2 were 1.75 times and 1.83 times that of the wild-type, respectively. These results further demonstrate that GhDPF1 positively regulates drought resistance in cotton.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. GhDPF1 The use of a gene or an encoded protein in regulating drought resistance of cotton is characterized by: described GhDPF1 The nucleotide sequence of the gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No.

1.

2. according to claim 1 GhDPF1 The application of the gene in regulating the drought resistance of cotton is characterized by: described GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. according to claim 1 GhDPF1 The application of the gene in regulating the drought resistance of cotton is characterized by: The amino acid sequence of the protein is shown in SEQ ID No.

2.

4. GhDPF1 The use of a gene or an encoded protein in improving drought resistance of cotton is characterized by: described GhDPF1 The nucleotide sequence of the gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No.

1.

5. GhDPF1 The use of a gene or an encoded protein in improving drought resistance of cotton is characterized by: The amino acid sequence of the protein is shown in SEQ ID No.

2.

6. The method according to claim 4 or 5 GhDPF1 The use of a gene or an encoded protein in improving drought resistance of cotton is characterized by: The application is achieved by overexpression GhDPF1 Gene function, improve GhDPF1 The expression of protein can improve the drought resistance of cotton.

7. A method for improving drought resistance of cotton, characterized in that: The steps are: by overexpression in cotton plants GhDPF1 Gene function, improve GhDPF1 The expression level of the protein was increased to obtain drought-resistant cotton plants.

8. The method for improving drought resistance of cotton according to claim 7, characterized in that: The steps are: build GhDPF1 The gene overexpression vector is transferred into the cotton plant to be improved through genetic transformation to obtain drought-resistant cotton plants.

9. The method for improving drought resistance of cotton according to claim 7 or 8, characterized in that: described GhDPF1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

10. The method for improving drought resistance of cotton according to claim 9, characterized in that: The genetic transformation method is Agrobacterium transformation.

Images