Method for increasing grain size of rice seeds and / or yield of rice

Abstract

The invention discloses a method for increasing the grain size of rice seeds and / or the yield of rice. A mutant rice strain of the OsSig2b gene is constructed through mutation of the OsSig2b gene, and it is found that the particle size and thousand seed weight of rice seeds can be remarkably increased by inhibiting expression of the OsSig2b gene in rice, and the purpose of increasing the rice yield can be achieved by inhibiting expression of the OsSig2b gene. Meanwhile, the OsSig2b gene can also be used as a target spot to cultivate a high-yield rice strain, and the OsSig2b gene is mutated, so that the inhibition of the expression of the OsSig2b gene does not influence the phenotype of the obtained mutant rice strain, the mutant rice strain can normally grow and develop under the conventional planting condition, and the growth state, the maturing rate and the like have no significant difference from those of a wild type. The method is beneficial to cultivation of high-yield rice varieties, damage to rice genomes is small, and possible risks caused by transgenosis can be avoided.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and more specifically relates to a method for increasing rice seed particle size and / or rice yield. Background Art

[0002] Rice ( Rice L.) is one of the most important food crops, providing staple food for more than half of the world's population. Its production is of great significance to ensuring food security.

[0003] Rice yield is primarily determined by the number of effective tillers, the number of grains per panicle, and 1000-grain weight. 1000-grain weight is in turn influenced by rice seed size. In addition to being a key agronomic trait affecting 1000-grain weight, rice seed size is also an important trait for rice appearance and quality. Therefore, continued research is needed to identify the key genes associated with regulating rice seed size. This, in turn, could provide methods for improving rice yield and appearance using technologies such as gene editing. This could also provide relevant genetic resources for molecular design breeding of high-yield rice, contributing to ensuring and increasing rice yield. Summary of the Invention

[0004] In order to increase rice yield, the present invention discovered a gene related to rice seed size from the rice genome, named UsSig2b The invention also provides a method for increasing rice seed size and / or rice yield.

[0005] The first object of the present invention is to provide a method for increasing rice seed size and / or rice yield.

[0006] A second object of the present invention is to provide an inhibitory UsSig2b Use of a gene expression agent in increasing rice yield or in preparing a product for increasing rice yield.

[0007] A third object of the present invention is to provide an inhibitory UsSig2b Use of gene expression reagents in developing rice plants with increased yield.

[0008] A fourth object of the present invention is to provide a method for inhibiting UsSig2b Use of a gene expression reagent in increasing rice seed size or in preparing a product for increasing rice seed size.

[0009] A fifth object of the present invention is to provide an inhibitory UsSig2b Use of gene expression reagents in breeding rice plants with increased seed size.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions: In order to increase rice yield, the present invention discovered a gene related to rice seed size from the rice genome, named UsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.1. The present invention uses the CRISPR / Cas9 gene editing system to UsSig2b Gene mutation, construction UsSig2b Mutant rice lines found to suppress gene UsSig2b The expression of the gene will not affect the phenotype of the mutant rice line obtained. It can grow and develop normally under conventional planting conditions. The growth state and fruit setting rate are not significantly different from those of the wild type. In addition, it can significantly increase the grain size and thousand-grain weight of rice seeds, that is, it can inhibit UsSig2b The expression of the gene achieves the purpose of increasing rice yield. Based on this, the present invention provides a method for increasing rice seed particle size and / or rice yield.

[0011] Specifically, the method is: inhibiting UsSig2b Gene expression in rice; UsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0012] Specifically, RNA interference can be used to inhibit UsSig2b Gene expression in rice, or through UsSig2b Gene mutation or knockout UsSig2b Gene expression in rice.

[0013] More specifically, gene editing systems UsSig2b Mutation of the coding region and / or promoter region of a gene, or deletion using gene editing technology UsSig2b coding region of a gene, or knocked out by homologous recombination UsSig2b gene to inhibit its expression.

[0014] In a specific embodiment of the present invention, the CRISPR gene editing system is used to UsSig2b The coding region and / or promoter region of the gene is mutated to inhibit its expression; the mutation includes base insertion, deletion or base conversion.

[0015] Specifically, the CRISPR gene editing system is a CRISPR / Cas9 gene editing system.

[0016] Specifically, UsSig2b The coding region sequence of the gene is shown in SEQ ID NO.2. UsSig2b The gene sequence includes its promoter region, which is generally considered to be the 2 kb sequence upstream of ATG, that is, the sequence shown in SEQ ID NO.1. UsSig2b 1 to 2000 bp of gene sequence.

[0017] Specifically, the CRISPR / Cas9 gene editing system UsSig2b The method of mutating the coding region and / or promoter region of a gene to inhibit its expression is: UsSig2b The coding region and / or promoter region of the gene is designed based on the sgRNA sequence of CRISPR / Cas9, and the DNA fragment (expression cassette) containing the sgRNA sequence is connected to the pCRISPR / Cas9 vector carrying the Cas9 expression cassette and transformed into rice callus to achieve the purpose of UsSig2b Gene mutation, inhibition UsSig2b Gene expression.

[0018] As an optional embodiment, the nucleotide sequence of the target site recognized by the sgRNA is shown as SEQ ID NO.3 and / or SEQ ID NO.4.

[0019] In addition to CRISPR / Cas9 genome editing technology, zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can also be used to edit genes. UsSig2b Gene mutation.

[0020] Specifically, the present invention is achieved by mutation UsSig2b Gene, acquired UsSig2b The method for producing a genetically modified rice line comprises the following steps: S1. Design sgRNA target sequence and adapter primers; S2. Constructing an sgRNA vector containing the target sequence fragment: Synthesize adapter primers, denature the adapter primers, and cool them to room temperature to complete annealing. Ligate the annealed primer pair to the digested sgRNA vector, and verify the positive plasmid by PCR amplification and sequencing. S3. Construction of a pCRISPR / Cas9 vector containing the target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA and then ligate it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette; S4. Transformation: Transform the target site-containing pCRISPR / Cas9 vector into rice callus tissue. After screening, differentiation, and rooting, positive transgenic plants are identified. S5. Identification of mutation sites: Extract DNA from positive plants, design identification primers to amplify the extracted DNA, purify it, and sequence and analyze the mutation.

[0021] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.3, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0022] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0023] Specifically, the nucleotide sequences of the primer pair used to identify the mutation site are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0024] Specifically, the rice is indica rice.

[0025] In a specific embodiment of the present invention, the indica rice is Nanguizhan.

[0026] The present invention claims protection inhibition UsSig2b Use of a gene expression agent in increasing rice yield or in preparing a product for increasing rice yield.

[0027] Specifically, the agent increases rice yield by increasing the thousand-grain weight of rice.

[0028] The present invention also claims to inhibit UsSig2b Use of gene expression reagents in developing rice plants with increased yield.

[0029] The present invention also claims to inhibit UsSig2b Use of a gene expression reagent in increasing rice seed size or in preparing a product for increasing rice seed size.

[0030] The present invention also claims to inhibit UsSig2b Use of gene expression reagents in breeding rice plants with increased seed size.

[0031] Specifically, the rice is indica rice.

[0032] More specifically, the indica rice is Nan Guizhan.

[0033] Specifically, the inhibition UsSig2b Gene expression agents include UsSig2b Reagents for gene expression, such as dsRNA, or for mutagenesis or knockout UsSig2b Gene carrier.

[0034] The present invention has the following beneficial effects: The present invention is through UsSig2b Gene mutation, construction UsSig2b Mutant rice lines found to suppress gene UsSig2b The expression of the gene in rice can significantly increase the grain size and 1000-grain weight of rice seeds, that is, by inhibiting UsSig2b The expression of genes can achieve the purpose of increasing rice yield. UsSig2bGenes are targeted to cultivate high-yield rice strains. UsSig2b Gene mutation, inhibition UsSig2b Gene expression does not affect the phenotype of the resulting mutant rice lines; they grow and develop normally under conventional cultivation conditions, with growth and seed set rates showing no significant differences from wild-type plants. This method facilitates the cultivation of high-yield rice varieties, causes minimal damage to the rice genome, and mitigates the potential risks associated with genetic modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 For wild-type Nanguizhan (NGZ) and UsSig2b Gene mutant strains UsSig2b Gene expression level detection, cross-section observation of mature spikelets, and statistical results of the number of thin-walled cells in the outer layer of the glume; Figure A represents the wild-type NGZ and mutant lines sig-B3 and sig-B8 of UsSig2b Gene expression level detection results; Figure B shows the wild-type NGZ and mutant strains sig-B3 and sig-B8 The cross-section observation results of mature spikelets. The framed positions in the figure are two locations where the number of thin-wall cell layers of the mature spikelets increased significantly; C in the figure is the wild type NGZ and the mutant line sig-B3 and sig-B8 Statistical results of the number of thin-walled cells in the outer layer of the glumes; D in the figure is the wild type NGZ and the mutant line sig-B3 and sig-B8 The number of cells at the O1 position of the outer thin wall cells of the glume; E in the figure is the wild type NGZ and the mutant line sig-B3 and sig-B8 The number of cells at position I1 of the outer thin-walled cells of the glumes; * p <0.05;** p <0.01;*** p <0.001.

[0036] Figure 2 Wild-type Nanguizhan and UsSig2b Electron microscopic observation results of the outer layer of the ying shell of the gene mutant strain and the statistical results of the diameter of the silicon nucleus cells; A in the figure is the wild type NGZ and the mutant strain sig-B3 and sig-B8 Electron micrographs of the outer layer of the shell of the worm; B in the figure shows the wild-type NGZ and the mutant strain sig-B3 and sig-B8 Statistical results of silicon cell length; C in the figure is the wild type NGZ and mutant strains sig-B3 and sig-B8 Statistical results of silicon cell width; *** p <0.001.

[0037] Figure 3 Wild-type Nanguizhan and UsSig2b Changes in seed size of gene mutant strains; A in the figure represents the wild type NGZ and mutant strains sig-B3 and sig-B8 Seed length measurement chart; B in the figure shows the wild type NGZ and mutant lines sig-B3 and sig-B8 Seed width measurement diagram; C in the figure is the wild type NGZ and mutant lines sig-B3 and sig-B8 Statistics and comparison results of seed length; D in the figure shows the wild type NGZ and mutant lines sig-B3 and sig-B8 Statistics and comparison results of seed width; E in the figure represents the wild type NGZ and mutant lines sig-B3 and sig-B8 Thousand-grain weight statistics; * p <0.05;** p <0.01;*** p <0.001.

[0038] Figure 4 Wild-type Nanguizhan and UsSig2b The growth, leaf width, and ear weight of the mutant strains at the booting stage were measured and compared. Figure A shows the wild-type NGZ and the mutant strains. sig-B3 and sig-B8 Plant growth at the booting stage; Figure B shows the wild-type NGZ and mutant lines sig-B3 and sig-B8 Leaves at the booting stage; Figure C shows the wild-type NGZ and mutant lines. sig-B3 and sig-B8 The measurement and comparison results of leaf width at the booting stage; D in the figure is the wild type NGZ and mutant lines sig-B3 and sig-B8 The overall picture of all the grains in a single plant; E in the figure is the wild type NGZ and the mutant line sig-B3 and sig-B8 Statistics and comparison results of single ear weight; * p <0.05;*** p <0.001. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0040] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0041] The embodiments of the present invention UsSig2b The nucleotide sequence of the gene (gDNA) is shown in SEQ ID NO. 1, which includes the promoter region sequence (generally considered to be the 2 kb sequence upstream of ATG). UsSig2b The nucleotide sequence of the coding region (cDNA) of the gene is shown in SEQ ID NO.2.

[0042] Example 1 UsSig2b Obtaining gene mutant strains The present invention utilizes CRISPR / Cas9 technology to UsSig2b The gene was mutated, and the UsSig2b Gene mutant strains, the specific process is as follows: 1. Design of sgRNA target sequence and adapter primer against UsSig2b The sgRNA target sequence was designed for the gene (sequence shown in SEQ ID NO.1). The designed sgRNA target sequence (5'→3') is as follows: Target- Sig2b -U3: GCGGATAAGAGCGGTGGGGA (SEQ ID NO.3) Target- Sig2b -U6a: ACGTCGCGCGTTCGAGCCTA (SEQ ID NO.4) Based on the designed sgRNA target sequence, the adapter primers with sticky ends (5'→3') designed in the present invention are as follows: Target- Sig2b -U3F: gccgGCGGATAAGAGCGGTGGGGA (SEQ ID NO.5) Target- Sig2b -U3R:aaacTCCCCACCGCTCTTATCCGC (SEQ ID NO.6) Target- Sig2b -U6aF: gccgACGTCGCGCGTTCGAGCCTA (SEQ ID NO.7) Target- Sig2b -U6aR:aaacTAGGCTCGAACGCGACGT (SEQ ID NO.8) 2. Target- Sig2b-U3 fragment pU3-gRNA vector and containing Target- Sig2b -Construction of pU6a-gRNA vector containing U6a fragment The present invention contains Target- Sig2b -U3 fragment pU3-gRNA vector construction as an example to briefly describe, containing Target- Sig2b The construction of the pU6a-gRNA vector containing the -U6a fragment is the same as this, except that different adapter primers and vectors are used.

[0043] Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the above-designed adapter primer Target- Sig2b -U3F and Target- Sig2b -U3R. The synthesized adapter primer was heated at 90 °C for 30 s to denature and then moved to room temperature to cool and complete annealing. The annealed primer was connected to the pU3-gRNA vector after enzyme digestion. After PCR amplification and sequencing verification, the target- Sig2b -U3 fragment pU3-gRNA vector. Wherein, the PCR primer used for PCR amplification verification is the adapter primer with sticky ends.

[0044] 3. Target- Sig2b -U3、Target- Sig2b -Construction of pCRISPR / Cas9 vector for U6a fragment Take the target- Sig2b -U3 fragment pU3-gRNA vector, Target- Sig2b -U3 fragment was cut out from the vector, and Target- Sig2b -U6a fragment was also cut out from the corresponding vector, and the cut Target- Sig2b -U3、Target- Sig2b -U6a fragment was connected to the pCRISPR / Cas9 vector containing Cas9 expression cassette, and the Target- Sig2b -U3、Target- Sig2b -pCRISPR / Cas9 vector containing the U6a fragment.

[0045] 4. UsSig2b Obtaining gene mutant strains Target- Sig2b -U3 fragment, Target- Sig2b-U6a fragment) was transformed into callus tissue of the indica rice variety Nanguizhan (NGZ) through Agrobacterium tumefaciens-mediated genetic transformation. After secondary screening, differentiation and rooting into seedlings, the resulting plants were planted in a net house. Positive plants were selected by hygromycin identification, and mutant strains were selected by sequencing identification.

[0046] 5. Sequencing and identification of mutation sites in mutant strains Extract the genomic DNA (gDNA) of the positive plants screened, and use primers Sig2b TF and Sig2b TR performed PCR amplification on the extracted genomic DNA, and the products were purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequences of the wild-type Nan Guizhan plants before mutation to analyze the mutation situation.

[0047] The primers Sig2b TF and Sig2b The nucleotide sequence of TR is shown below: Sig2b TF: CGGGGTCAAAACTAACAAAGGA (SEQ ID NO.9) Sig2b TR: TAATTACGCAGTCCAAAGTA (SEQ ID NO.10) The PCR amplification reaction system is shown in Table 1: Table 1 PCR amplification reaction system

[0048] PCR amplification reaction conditions: 95°C for 2 min; 35 cycles of 95°C for 20 sec, 58°C for 20 sec, and 72°C for 30 sec; and 72°C for 5 min.

[0049] After sequencing, the present invention obtained two different UsSig2b Gene mutant strains were named sig2b-B3 and sig2b-B8 (abbreviated as sig-B3 and sig-B8 ). Compared with its wild type counterpart (WT), sig-B3 27 bp are missing. sig-B8 The wild-type and mutant strains have a 7 bp deletion. The sequencing results (5'→3') are as follows: WT: CGAGGCACGCCATCGGTGGCGCGCGCGAGAGAGCAGGTACCTTAGGCTCGAACGCGCGACGT sig-B3 : CGAGGCACGCCATCGGTGGC---------------------------TCGAACGCGCGACGT WT: TCCGCACGCTCCCGTCCCCACCGCTCTTATCCGCTTCTCTCCC sig-B8 : TCCGCACGCTCCCGTCC-------TCTTATCCGCTTCTCTCCC The "---" in the sequence indicates a base deletion. Compared with the wild type, the mutant strain obtained in this embodiment has a base deletion mutation in the target sequence, indicating that the present invention has successfully mutated UsSig2b Gene, acquired UsSig2b Gene mutant strains.

[0050] In addition, the present invention extracted the wild type and UsSig2b Gene mutant strains sig-B3 and sig-B8 The total RNA of wild type and UsSig2b Gene mutant strains UsSig2b The gene expression was analyzed, and the results were as follows Figure 1 As shown in A. As can be seen from the figure, in the mutant strains obtained by the present invention, UsSig2b The gene expression level was significantly reduced.

[0051] Example 2 Mutation UsSig2b Genetic influence on rice seed size Under conventional culture conditions, the sequenced and identified strains obtained in Example 1 were cultured. UsSig2b Gene mutant strains sig-B3 and sig-B8 The wild type Nanguizhan was used as the control. The cross sections of mature spikelets of the wild type and mutant strains after normal heading were observed and compared, and the number of cells in the outer thin wall layer of the glume was counted. The results are as follows: Figure 1 As shown in B to E.

[0052] Figure 1 B in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 The cross-section observation results of mature spikelets are shown in Figure 1. The framed positions in the figure are the two locations where the number of thin-wall cell layers of the glume of mature spikelets has increased significantly. Figure 1 C in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Statistical results of the number of thin-walled cells in the outer layer of glumes; Figure 1 D in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 The number of cells at position O1 of the outer thin-walled cells of the glumes; Figure 1 E in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 The number of cells at position I1 of the outer thin-walled cells of the glumes.

[0053] Depend on Figure 1 From B to E, we can see that UsSig2b After the gene mutation, the number of thin-walled cells in the outer layer of the seed glume increased significantly.

[0054] At the same time, the present invention also uses scanning electron microscopy to analyze the wild type NGZ and mutant strains. sig-B3 and sig-B8 The outer layer of the shell of the antler was observed and the length and width of the silicon cells on its surface were counted. The results are as follows Figure 2 shown. Figure 2 A in the figure represents the wild type NGZ and mutant strains sig-B3 and sig-B8 Scanning electron micrograph of the outer layer of the Ying shell; Figure 2 B in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 The statistical results of silicon cell length; Figure 2 C in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Statistical results of silicon cell width. Figure 2 It can be seen that OsSig2b After the gene mutation, the length and width of the silicon cells in the outer layer of the seed hull increased, and the cells in the hull became larger.

[0055] Example 3 Mutation OsSig2b Effects of genes on rice seed size and yield traits Under conventional culture conditions, the sequenced and identified strains obtained in Example 1 were cultured. OsSig2b Gene mutant strains sig-B3 and sig-B8 After cultivation to maturity, the wild type Nanguizhan was used as the control to observe and compare the changes in seed size, yield and other traits between the two.

[0056] Wild-type NGZ and OsSig2b Gene mutant strains sig-B3 and sig-B8 The changes in seed particle size are as follows Figure 3 As shown; Figure 3 A in the figure represents the wild type NGZ and mutant strains sig-B3 and sig-B8 Measurement of seed length; Figure 3 B in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Measurement of seed width; Figure 3 C in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Measurement and comparison results of seed length; Figure 3 D in the figure represents the wild-type NGZ and mutant strains. sig- B3 and sig-B8 Measurement and comparison results of seed width; Figure 3 E in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Thousand-grain weight statistics. Figure 3 It can be seen that compared with the wild type Nanguizhan, the mutant OsSig2b The gene can significantly increase the grain length and width of the resulting mutant rice seeds ( p <0.001), thereby increasing the thousand-grain weight of rice seeds ( p <0.05).

[0057] Wild-type NGZ and OsSig2b Gene mutant strains sig-B3 and sig-B8 The growth, leaf width and ear weight of each plant were measured and compared at the booting stage. Figure 4 As shown; Figure 4 A in the figure represents the wild type NGZ and mutant strains sig-B3 and sig-B8 Plant growth at the booting stage; Figure 4 B in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 leaves at the booting stage; Figure 4 C in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 The measurement and comparison results of leaf width at the booting stage; Figure 4 D in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 All the grains per ear of a single plant; Figure 4 E in the figure represents the wild-type NGZ and mutant strains. sig-B3 and sig-B8 Statistics and comparison results of single ear weight. Figure 4 It can be seen that OsSig2b After the gene mutation, the leaf width increased, the number of grains per ear increased, and the yield per plant increased.

[0058] The above embodiments are preferred implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for increasing rice seed size and / or rice yield, characterized in that: inhibition OsSig2b Gene expression in rice; OsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that Inhibition by RNA interference OsSig2b Gene expression in rice, or through OsSig2b Gene mutation or knockout OsSig2b Gene expression in rice.

3. The method according to claim 2, characterized in that CRISPR gene editing technology OsSig2b The gene undergoes mutation; the mutation includes insertion, deletion or base conversion.

4. The method according to claim 3, characterized in that CRISPR gene editing technology OsSig2b The coding region and / or promoter region of the gene are mutated.

5. The method according to any one of claims 1 to 4, characterized in that: The rice is indica rice.

6. Inhibition OsSig2b Use of a gene expression agent in increasing rice yield or in preparing a product for increasing rice yield, characterized in that: described OsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

7. Inhibition OsSig2b Use of a gene expression reagent in cultivating rice plants with increased yield, characterized in that described OsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. Inhibition OsSig2b Use of a gene expression reagent in increasing rice seed size or in preparing a product for increasing rice seed size, characterized in that: described OsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

9. Inhibition OsSig2b The use of a gene expression reagent in cultivating rice plants with increased seed size is characterized in that: described OsSig2b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. The use according to any one of claims 6 to 9, characterized in that: The rice is indica rice.

Images